A new television is listed as being 42 in. This distance is the diagonal distance across the screen. If the height of the screen measures , what is the width of the screen? Round to the nearest tenth of an inch.

Answers

Answer 1

The width of the screen measures; 36.37 in.

Given data;

Diagonal = 42 inches

Height=  21 inches

Apply the Pythagoras theorem

\(D^2= H^2+W^2\)

Substitute;

\(42^2= 21^2+W^2\\1764 =441 +W^2\\\\1764- 441 =W^21323 = W^2\)

W=√1323

W= 36.37 inches

Hence the width is 36.37 inches

Learn more about equations here;

https://brainly.com/question/25180086

#SPJ1


Related Questions

Jay has spent 3/8 of his life working for his current company. If Jay has been 8 3working for his current company for 15 years, how old is he?

Answers

Answer:

40 years old

Step-by-step explanation:

If Jay has spent 3/8 of his life working for his current company and it is stated that he has been at the current company for 15 years, we can divide 15 years by 3 to find out how much a single part of the fraction (1/8) is.

15 / 3 = 5 years

5 years = 1/8

Now that we know how many years is a single part of his life we simply multiply this value by 8 to calculate how many years would equal his total life or in other words how old Jay currently is.

5 years * 8 = 40 years old

What is the probability that a random sample of n=45 oil changes results in a sample mean time less than 20 ​minutes?

Answers

Step-by-step explanation:

https://youtu.be/wghLO8hQZrA

watch this video to get the answer and knowledge about this video to get the answer and knowledge about this video to get the answer and knowledge about this video to get the answer and knowledge about this video to get the answer and knowledge about

Herons formula triangle is​

Answers

Answer:

Heron's formula (sometimes called Hero's formula), named after Hero of Alexandria, gives the area of a triangle when the length of all three sides are known. Unlike other triangle area formulae, there is no need to calculate angles or other distances in the triangle first.

Using principle of mathematical induction prove that 6^-1 divisble by 5 .​

Answers

I suppose the claim is \(5 \mid 6^n - 1\) for \(n\in\Bbb N\).

When \(n=1\), we have \(6^1 - 1 = 6 - 1 = 5\), and of course 5 divides 5.

Assume the claim holds for \(n=k\), that \(5 \mid 6^k - 1\). We want to use this to show it holds for \(n=k+1\), that \(5 \mid 6^{k+1} - 1\).

We have

\(6^{k+1} - 1 = \left(6^{k+1} - 6\right) + \left(6 - 1) = 6\left(6^k - 1\right) + 5\)

Since \(5 \mid 6^k - 1\), we can write \(6^k - 1 = 5\ell\) for some integer \(\ell\). Then

\(6^{k+1} - 1 = 6\cdot5\ell + 5 = 5(6\ell + 1)\)

which is clearly divisible by 5. QED

How to calculate your bi-weekly paycheck based on 20 hour weeks at a rate of $9.00 per hour. Also, You will need to deduct Federal Income Tax (11.9%) , State Income Tax (3.6%), F.I.C.A (7.65%), and professional dues. Lastly you will need to look determine whether or not you will be able to pay your monthly car insurance bill of $200.00?

Answers

To calculate your bi-weekly paycheck, follow these steps:

Step 1: Calculate the gross earnings:

Multiply the number of hours worked per week by the hourly rate.

20 hours/week * $9.00/hour = $180.00/week

Step 2: Calculate the total earnings for two weeks:

Multiply the weekly earnings by the number of weeks in a bi-weekly pay period.

$180.00/week * 2 weeks = $360.00

Step 3: Calculate the deductions:

Calculate each deduction separately and subtract them from the gross earnings.

Federal Income Tax: $360.00 * 11.9% = $42.84

State Income Tax: $360.00 * 3.6% = $12.96

F.I.C.A: $360.00 * 7.65% = $27.54

Professional Dues: Amount varies depending on the specific dues.

Total Deductions: $42.84 + $12.96 + $27.54 + Professional Dues

Step 4: Calculate the net earnings:

Subtract the total deductions from the gross earnings.

Net Earnings = Gross Earnings - Total Deductions

Once you have the net earnings, you can determine if it is sufficient to cover your monthly car insurance bill of $200. If your bi-weekly net earnings are greater than or equal to $200, you will be able to pay your car insurance bill.

It is important to note that these calculations are based on the information provided, and actual tax rates and deductions may vary depending on your specific circumstances and location.

Additionally, professional dues may differ depending on your profession. It is recommended to consult with a tax professional or payroll department for precise calculations.

For  more such questions on gross earning.

https://brainly.com/question/29206567

#SPJ8

6x + y = 8
y= -6x + 8

Answers

Answer:

y = -6x + 8

Step-by-step explanation:

\begin{bmatrix}6x+y=8\\ y=-6x+8\end{bmatrix}

I don't know why it came out like this

A bag of garden soil weighs 44 pounds and holds 5cubic feet. Find the weight of 15 bags in kilograms and the volume of 15 bags in cubic yards.

Answers

Answer:

Weight of 15 bags in Kg: 299.4 Kg

Volume of 15 bags in cubic yards: 1.11 cubic yards

Step-by-step explanation:

Weight of 15 bags is calculated as follows:

Let's convert 44 pounds to Kg.

1 pound-------0,453592 Kg

44pounds------x

To find the weight of 15 bags we have to multiply the weight of one bag by 15:

Weight of 15 bags=19.95*15=299.4 Kg

Volume of 15 bags is calculated as follows:

First we need to convert one bag volume that is given in cubit feet to cubic yards:

1 cubic feet---------------0.03704 cubic yard

2 cubic feet----------------x

To find the volume of 15 bags we have to multiply the volume of one bag by 15:

Volume of 15 bags=0.07407cubic yard*15= 1.11 cubic yards

Step-by-step explanation:

Question 3 (1 point)
If you deposit $400 into an account that offers a 5% interest rate. How much
interest will you earn after 1 year?
$20
$350
$160
$2
Question 4 (Mandatory) (1 point)

Answers

$400 •5/100=$4•5=$20

find the following arc measures

find the following arc measures

Answers

The measure of the angles are;

<KL = 23 degrees

m<LON is 23 degrees

m<OM = 113 degrees

m<KNL = 23 degrees

m<NL = 157 degrees

How to determine the measures of the arc

To determine the measures of the arc, we need to note the following;

Angles on a straight line is equal to 180 degreesAngle at right angle is equal to 90 degrees

From the information shown in the diagram, we have;

<KL +<KM = 90 degrees

Now, substitute the values

<KL + 67 = 90

collect like terms

<KL = 23 degrees

m<LON and <KL are corresponding angles

Then, m<LON is 23 degrees

m<OM = m<LON + 90 degrees

Substitute the values

m<OM = 113 degrees

m<KNL = 23 degrees

m<NL = 90 + <LM

Substitute the values

m<NL = 157 degrees

Learn more about angles at: https://brainly.com/question/25770607

#SPJ1

-2(8x-1)=5(1-3x)

What is the answer to this equation?

Answers

Answer:

x= -3

Step-by-step explanation:

−2(8x−1)=5(1−3x)

Step 1: Simplify both sides of the equation.

−2(8x−1)=5(1−3x)

(−2)(8x)+(−2)(−1)=(5)(1)+(5)(−3x)(Distribute)

−16x+2=5+−15x

−16x+2=−15x+5

Step 2: Add 15x to both sides.

−16x+2+15x=−15x+5+15x

−x+2=5

Step 3: Subtract 2 from both sides.

−x+2−2=5−2

−x=3

Step 4: Divide both sides by -1.

−x

−1

=

3

−1

x=−3

Evaluate
3(x+4)(x+1)
(x+2)(x-2)
for x = 4.

Answers

Answer:

1440

Step-by-step explanation:

3(4+4)(4+1)(4+2)(4-2)

3*8*5*6*2

1440

PLEASE HURRY DUE TONIGHT
Mary is babysitting a 4-year-old. The little boy wants to play in the kiddie pool in the backyard. Mary knows that using the hose that is near the kiddie pool will take 30 minutes to fill up. The little boy has already asked 17 times if the pool is ready but she hasn't even turned on the water yet. Mary also knows that the hose from the front yard works faster and can fill the pool in 1/2 the time as the hose in the back yard. If she can use both hoses at the same time, how long will it take for the pool to fill up?

(PLEASE SHOW YOUR WORK)(I saw other people get 7.5 min and 75 min but those answers are incorrect.)

A. 5 minutes
B. 10 minutes
C. 22.5 minutes

Answers

Using both hoses will take 10 minutes to fill up the kiddie pool. Mary can fill up 1/3 of the pool using the front yard hose in 10 minutes and 1/6 of the pool using the backyard hose in 10 minutes.

To solve this problem, we need to use the concept of rates. Let's assume the rate of the hose in the backyard is x, so the rate of the hose in the front yard is 2x (because it is twice as fast as the other hose).

The combined rate of the two hoses is x + 2x = 3x, which means they can fill the pool in 30/3x = 10/x minutes.

We know that the area of the pool is 600 square feet and each small rock covers 20 square feet, so we need a total of 600/20 = 30 small rocks to cover the pool.

Since the mass of each rock is 20 grams, the total mass of all 30 rocks is 30 x 20 = 600 grams.

To find the density, we divide the total mass (600 grams) by the total volume of the rocks (30 x 20 cubic feet = 600 cubic feet)

Density = 600g / 600 cubic feet = 1g/cubic foot

Therefore, the answer is B. 10 minutes for the pool to fill up, and the density of the rocks is 1 gram per cubic foot.

To know more about density

https://brainly.com/question/29775886

#SPJ1

What is the area of this figure?

Question 10 options:

124 in2

112 in2

184 in2

What is the area of this figure?Question 10 options:124 in2112 in2184 in2

Answers

Answer:

112 in2

Step-by-step explanation:

6 x 4 / 2 + 10 x 10 = 24 / 2 + 100

12 + 100 = 112 in2

Hope that helps!

I am lost please help thank you all

I am lost please help thank you all

Answers

Answer:

Step-by-step explanation:

At least 9 means more than 9 and includes 9

x ≥ 9     and    [9,  +∞)

At most 9 means numbers less than 9

x≤9       and  (-∞, 9]

more than 9 means bigger than 9 but not including 9

x > 9     and    (9,  +∞)

fewer than 9 means less than 9 but not including 9

x<9       and  (-∞, 9)

strictly between 7 and 9   means between 7 and 9 but not including

7<x<9      and    (7,9)       (This is the only one I'm unsure of.  Strictly, not sure if it includes or doesn't include, usually it just says include or doesn't include)

between 7 and 7 inclusive.   means it's just =7  There's no boundaries

x=7

no more than 7 means less than 7 and includes 7

x ≤ 7   and   (-∞, 7]

What is the slope of the equation y- 5 = -3x?

Answers

Answer:

-3/1

Step-by-step explanation:

It's always the x value over the y value, so whatever's in the x

Answer:

-3

Step-by-step explanation:

the equation is y=-3x+5, so m=-3

Enter the number that belongs in the green box. 4 51° 109°

Enter the number that belongs in the green box. 4 51 109

Answers

The answer choice which belongs in the green box and is the longest side of the triangle as required is; 11.06.

What is the length of the longest side?

It follows from the task content that since the sum of angles in a triangle is; 180°, the missing angle measure is; 180 - 51 - 109° = 20°.

Consequently, it follows from the sine law that;

4 / sin 20° = x / sin 109°

x = 4 sin 109° / sin 20°

x = 11.06.

Ultimately, the number that belongs in the green box is; 11.06.

Read more on sine rule;

https://brainly.com/question/27174058

#SPJ1

What is 27 5/6 - 2/7?

Answers

Your answer would be 27 23/42

Answer:

my calculator says 1159/35

Step-by-step explanation:

Verify that the indicated family of functions is a solution of the given differential equation. dP/dt = P(1-P); P = ce^t / 1+ ce^t?

Answers

The value for differential equation is found as -

\(\frac{dP}{dt} =\frac{d}{dt} (\frac{c_1e^t}{1+c_1e^t})\\\)

\(\frac{dP}{dt} - (\frac{c_1e^t}{(1+c_1e^t)} )(1-\frac{c_1e^t}{(1+c_1e^t)^2})\\ =(\frac{c_1e^t}{(1+c_1e^t)^2} )-(\frac{c_1e^t}{1+c_1e^t})(1-\frac{c_1e^t}{1+c_1e^t})=0\)

What is differential equation?

Any equation with one or more terms and one or more derivatives of the dependent variable with respect to the independent variable is referred to as a differential equation.

The equation given is - \(P=\frac{c_1e^t}{1+c_1e^t}\)

Take derivative with respect to t -

\(\frac{dP}{dt} =\frac{d}{dt} (\frac{c_1e^t}{1+c_1e^t})\\\frac{dP}{dt} =\frac{d}{dt}c_1 (\frac{e^t}{1+c_1e^t})\)

By Quotient rule \(\frac{d}{dt} \frac{u}{v} =\frac{v\frac{du}{dt}- u\frac{dv}{dt}}{v^2}\) -

\(\frac{dP}{dt} =c_1 (\frac{(1+c_1e^t)\frac{d}{dt}(e^t)-(e^t)\frac{d}{dt}(1+c_1e^t)}{(1+c_1e^t)} )\\\frac{dP}{dt} =c_1 (\frac{(1+c_1e^t)(e^t)-(e^t)(0+c_1e^t)}{(1+c_1e^t)} )\)

(\(\frac{d}{dx} e^t=e^t\) and \(\frac{d}{dx} c_1=0\) here \(c_1=\)constant)

\(\frac{dP}{dt} =c_1e^t (\frac{(1+c_1e^t-c_1e^t)}{(1+c_1e^t)^2} )\\\frac{dP}{dt} = (\frac{(c_1e^t)}{(1+c_1e^t)^2} )\)

Now, \(\frac{dP}{dt} =P(1-P)\) -

\(\frac{dP}{dt} - (\frac{c_1e^t}{(1+c_1e^t)} )(1-\frac{c_1e^t}{(1+c_1e^t)^2})\\ =(\frac{c_1e^t}{(1+c_1e^t)^2} )-(\frac{c_1e^t}{1+c_1e^t})(1-\frac{c_1e^t}{1+c_1e^t})\\\frac{dP}{dt} =(\frac{c_1e^t}{(1+c_1e^t)} )(\frac{1}{1+c_1e^t}-1+\frac{c_1e^t}{1+c_1e^t})\\\frac{dP}{dt} =(\frac{c_1e^t}{(1+c_1e^t)} )(\frac{1-(1+c_1e^t)+c_1e^t}{1+c_1e^t})\\\frac{dP}{dt} =(\frac{c_1e^t}{(1+c_1e^t)} )(\frac{1-1-c_1e^t+c_1e^t}{1+c_1e^t})\\\)

\(\frac{dP}{dt} =(\frac{c_1e^t}{(1+c_1e^t)} )(\frac{0}{1+c_1e^t})\\\frac{dP}{dt} =(\frac{c_1e^t}{(1+c_1e^t)} )(0)\\\frac{dP}{dt} =0\)

Therefore, the value is \(\frac{dP}{dt} =0\).

To learn more about differential equation from the given link

https://brainly.com/question/28099315

#SPJ4

Verify that the indicated family of functions is a solution of the given differential equation. dP/dt

What are the center and radius if the equation (x-2)^2 + (y-9)^2

Answers

Step-by-step explanation:

(x-2)^2 + (y-9)^2   = r^2

this is of the form fora circle with center  h,k and radius r

(x-h)^2 + (y-k)^2 = r^2

for the equation given   center =   2, 9    and radius = r

Write an inequality for which 3, -4, 0, and 2,300 are solutions.

Answers

The inequality for which 3, -4, 0, and 2,300 are solutions, is n ≥ -4.

What is an inequality?

In mathematics, "inequality" refers to a relationship between two expressions or values that are not equal to each other. To solve the inequality, you may multiply or divide each side by the same positive number, add the same amount to each side, take the same amount away from each side, and more. You must flip the inequality sign if you multiply or divide either side by a negative number.

We have numbers:

3, -4, 0, 2, and 300.

All the numbers are greater than or equals to -4.

So, the inequality is,

n ≥ -4.

And the solutions are  3, -4, 0, 2, and 300.

Hence, n ≥ -4.

To learn more about the inequality;

brainly.com/question/28823603

#SPJ1

Janet wants to buy a car that will cost $19500. So far, she has saved
$16575. What percent of the price of the car has she saved?
90%
75%
80%
85%

Answers

Answer:

75%

Step-by-step explanation:

Your answer should be written in paragraph/essay format.

Any sources used should be cited at the bottom of your paper.

All answers should show you have learned something from Unit 9.  Material from other units will not be graded for this assignment.

If you are stuck, you can think about the following topics: textile mills, interchangeable parts, the Lowell System, unions, labor reform, steamboats, railroads, coal, the telegraph, and/or new inventions.

When plotting points on the coordinate plane below, which point would lie on the x-axis?



(6, 0)
(0, 2)
(3, 8)
(5, 5)

When plotting points on the coordinate plane below, which point would lie on the x-axis?(6, 0)(0, 2)(3,

Answers

Answer: (6,0)

Coordinate points are always written in pairs of the x- and y-coordinate: (x, y). Knowing this, the point would need to have a y-value of 0 in order to lie on the x-axis (otherwise, it would be on a random spot on the grid). The only coordinate point with a y-value of 0 is (6, 0). Therefore, the coordinate point (6, 0) lies on the x-axis.

Please refer to the attached graph below to see all the coordinate points.

When plotting points on the coordinate plane below, which point would lie on the x-axis?(6, 0)(0, 2)(3,

HELP PLEASE!!!!!

Which statement describes the system of equations?
x+2y=2
x-2y=-2

It has infinitely many solutions.
It has no solution.
It has one solution (0, 1).
It has one solution (4, –1).

Answers

It has one solution (0,1)

1)eliminate y
x + 2y + x -2y = 0
2x = 0 x = 0

2)eliminate x
x + 2y - x + 2y = 4
4y = 4
y = 1

Find a . the mean ; b . the deviation from the mean for each data item ; and c . the sum of the deviations in part ( b ) for the following group of data items . 155 , 156 , 162 , 164 , 168

Answers

(a) The mean of the data item from the group data is 161.

(b) The deviation from the mean for each data is -6,-5,1,3 and 7. respectively.

(c) The sum of the deviation is 0

What is a group data?

Grouped data are data formed by aggregating individual observations of a variable into groups, so that a frequency distribution of these groups serves as a convenient means of summarizing or analyzing the data.

(a) To find the mean of the data, we use the formula below.

Formula:

M = ∑x/n.......... Equation 1

Where:

M = Mean = ?∑x = Sum of each data = 155+156+162+164+168 = 805n = Total number of data item = 5

Substitute these values into equation 1

M = 805/5M = 161

(b) To calculate the deviation from the mean (M') for each of the data item we use the formula below.

M' = x-M

For data 115,

M' = 155-161 = -6

For data 156,

M' = -5

For data 162,

M' = 162-161 = 1

For data 164,

M' = 164-161M' = 3

For data 168,

M' = 168-161M' = 7

(c) The sum of the deviation is

∑M' = -6+(-5)+1+3+7∑M'  = 0

Hence, the mean, the diaviation from the mean is -6,-5,1,3 and 7  and the sum of the deviation of the data is 161 and 0 respectively,

Learn more about group data here: https://brainly.com/question/24298037

#SPJ1

Rectangle LMNP was dilated using the rule DP,3. Which statements are true? Check all that apply. The length of line segment M'N' is 18 units. The length of segment M'N' is 14 units. The dilation is a reduction. The dilation is an enlargement. The scale factor is One-third. The scale factor is 3.

Answers

The given rule of the dilation indicates that the scale factor is 3 which is

larger than one, therefore, given an enlarged image.

The correct options are;

The length of line segment M'N' is 18 unitsThe dilation is an enlargementThe scale factor is 3

Methods by which the scale factor is obtained

Please find attached the possible diagram of rectangle LMNP obtained from a similar question posted online;

L'M' = 12

LM = 4

MN = 6

The rule of the dilation of rectangle LMNP = \(D_{p, \, 3}\)

L'M' = 3 × LM

Therefore;

The image following the dilation of the preimage LMNP, which is rectangle L'M'N'P' is larger than LMNP

Therefore;

The dilation is an enlargement

The scale factor is the number with which the preimage dimension is multiplied to get the image, which is 3

The scale factor is 3

M'N' = 3 × MN

Therefore;

The length of line segment M'N' = 3 × 6 units = 18 units

Learn more about scale factor of a dilation here:

https://brainly.com/question/840682

Rectangle LMNP was dilated using the rule DP,3. Which statements are true? Check all that apply. The

Answer:

a. The length of line segment M'N' is 18 units.

d. The dilation is an enlargement.

f. The scale factor is 3.

Step-by-step explanation:

got it right on ed23

helpppppp!!!!!!!!!!!!!!!!!!!!

helpppppp!!!!!!!!!!!!!!!!!!!!

Answers

Answer

D. Observations of constellations show that stars have moved over time.

Explanation:

A scientific claim is basically an observation in science.

Constellation changes there position over time because of earth's rotation around sun. So, observation of constellations shows that stars have moved over time is a scietific claim. If stars would not move then constellation will not form.

A system of equations is made up of an ellipse and a hyperbola.

A system of equations is made up of an ellipse and a hyperbola.

Answers

Ok, so

We want to find the equation of an ellipse centered at the origin with a horizontal major axis of 8 units and a minor axis of 6 units.

For this, let's remember the form of the equation of an ellipse:

\(\frac{(x-h)^2}{a^2}+\frac{(y-k)^2}{b^2}=1\)

Where the center of the ellipse is located at the point (h,k).

If the ellipse is centered at the origin, then, h=0 and k=0, so the form of our equation will be:

\(\frac{x^2}{a^2}+\frac{y^2}{b^2}=1\)

Now, we're given that our ellipse has a horizontal major axis of 8 units and a minor axis of 6 units. Since the major and minor axis are given by the parameters 2a and 2b, then, a=4 and b=3. the greater number will divide the x² term and a>b.

So, the equation of this ellipse is:

\(\frac{x^2}{16}+\frac{y^2}{9}=1\)

The graph of this ellipse will be something like:

A system of equations is made up of an ellipse and a hyperbola.

Evaluate: xy+2x^2, if x=0.1 and y=9.8

Answers

Answer: 1

Step-by-step explanation:

\((0.1)(9.8)+2(0.1)^2\\0.98+0.02=1\)

Try Photomath! I always use the app for evaluating

Given that a+b = 10 and a square - b square = 40 find the value of a-b

Answers

Answer:

the value of a - b is 4.

Step-by-step explanation:

We have been given the following two equations:

a + b = 10 ------------(1)

a² - b² = 40 -------(2)

We can factor the left-hand side of equation (2) using the difference of squares identity:

(a + b)(a - b) = 40

Substituting equation (1) into this equation, we get:

10(a - b) = 40

Dividing both sides by 10, we get:

a - b = 4

Therefore, the value of a - b is 4.

Step-by-step explanation:

if I understand this correctly :

a + b = 10

a² - b² = 40

(a² - b²) = (a + b)(a - b) = 40

10(a - b) = 40

(a - b) = 4

Convert 14.8% to a decimal

Answers

Answer:

0.148

Step-by-step explanation:

Other Questions
The height of a golfball hit off a 128-foot hill is modeled by the function h(t) = 16t2 + 32t + 128, where h is height in feet and t is time in seconds. Find the time the golf ball takes to reach the ground. Find the missing numbers:X + 9x + 14 = (x + 2)(x + ?) in how many minutes does the hand nake 1/6 of a rotation Let f(x)= x^4 - 8x - 4. a) Find the intervals on which f is increasing or decreasing. b) Find the local maximum and minimum values off. c) Find the intervals of concavity and the inflection points. Consider the polynomial function.f(x)=-(x-2)(x+1)^2(x-1)^2List each real zero of f according to the behavior of the graph at the x-axis near that zero. If there is more than one answer separate with commas. Zero(s) where the graph crosses the x-axis: Zero(s) where the graph touches, but does not cross the x-axis:Find the y-intercept of the graph f: What are your thoughts on the virtual frog dissections compared to an in-person dissection? Explain. PLEASEEEEE HELP ITS DUE TONIGHT PLSSSSSSS What was the outcome of the olive branch petition ? Maggie's Skunk Removal Corp.'s 2021 income statement listed net sales of $14.0 million, gross profit of $9.20 million, EBIT of $71 million, net income available to common stockholders of $4.7 million, and common stock dividends of $2.7 million. The 2021 year-end balance sheet listed total assets of $54.0 million and common stockholders' equity of $22.5 million with 2,0 million shares outstanding. Calculate the gross profit margin. (Round your answer to 2 decimal places.) Heights of certain plants at a nursery are normally distributed with a mean of 45.3 centimeters and a standard deviation of 6.6 centimeters. if their z-scores are greater than 1.75, the plants are displayed in the main lobby. to the nearest centimeter, what is the minimum required height for this type of plant to be displayed in the main lobby? medical direction has advised you to place obese pt with sob in supine position. would increase sob. best action would be to? Question 13Which TWO sentences support the inference that the narrator has encountered the stranger before he looked in at her through the window?A One step into the room had sufficed; my vision was instantaneous; it was all there.B The person looking straight in was the person who had already appeared to me.C He was the samehe was the same, and seen, this time, as he had been seen before, from the waist up, the window, though the dining room was on the ground floor, not going down to the terrace on which he stood.D He remained but a few secondslong enough to convince me he also saw and recognized; but it was as if I had been looking at him for years and had known him always.E On the spot there came to me the added shock of a certitude that it was not for me he had come there. Kelly owns a comic book that is currently worth $840, and she believes that its value will increase by $30 every year. Kelly plans to sell the comic book for $1,500 and wants to know how long she must wait until the comic book's value reaches at least 90% of that amount.This problem can be solved with an inequality that uses the variable x.How should x be defined?x = the number of years until the comic book is worth 90% of $1,500x = the price Kelly plans to sell the comic book forx = the current value of the comic bookx = the number of years Kelly has already owned the comic book A simulation for rolling two number cubes is run with 50 trials. The results are shown below.(4,6)(2,4)(3,1)(1,6)(6, 1)(2, 2)(2, 2)(5, 1)(5,3)(3,2)(2,6)(6,6)(4,2)(4,3)(3,4)(3, 1)(1,2)(3,6)(6,4)(4,4)(5,5)(3,6)(1,2)(2,3)(4,4)(3, 3)(4,4)(6,6)(1,5)(2,3)(2, 1)(3,5)(4,1)(4,4)(4,5)(4, 5)(4,6)(2,1)(6,6)(5,2)(1,4)(1,6)(6, 6)(3,6)(2,1)What is the experimental probability a total of 9 will be rolled on two number cubes?(6,4)(2,4)(4,3)(2,4)(1, 1) I dont really understand theres questions HURRY I NEED THIS ASAP.!!!!!! FILL THE BLANK. The worldly philosophies that have a false view of _______ are deterministic, fatalistic, and humanistic. Select the statement that BEST describes what the information in "VideoGaming Should Be Considered a Sport" reveals about the author's opinion. willie just bought a home and financed his purchase with a$1,000,000 6% 20-year mortgagea. what is willies mothly mortgage payment?b. what will be the balance on willies mortgage after 12years? Which three details from the passage represent key events that should be included in an objective summary?"The serpent deceived me, and I ate." (paragraph 13)A) "But the Lord God called to the man, 'Where are you?" (paragraph 9)B) "God did say, 'You must not eat fruit from the tree that is in the middle of the garden, and you must not touch it, or you will die." (paragraph3)C) "Then the eyes of both of them were opened, and they realized they were naked, so they sewed fig leaves together and made coverings forthemselves." (paragraph 7)D) "Then the man and his wife heard the sound of the Lord God as he was walking in the garden in the cool of the day, and they hid from theLord God among the trees of the garden." (paragraph 8)ASAP Transcribe the following dna strands into mrna strands: ATTCGACGTCGATAGCTAGG