Transcribe the following dna strands into mrna strands: ATTCGACGTC
GATAGCTAGG

Transcribe The Following Dna Strands Into Mrna Strands: ATTCGACGTCGATAGCTAGG

Answers

Answer 1

Answer:

1. ATTCGACGTC

  UAAGCUGCAG

2. GATAGCTAGG

   CUAUCGAUCC

Explanation:

First write the DNA strands out:

ATTCGACGTC

GATAGCTAGG

Next, bind the strand with the opposite to the corresponding letter.

For mrna strands, the following is associated with:

A -> U

T -> A (apples in the tree mnemonic)

C -> G (cars in the garage mnemonic)

G -> C (cars in the garage mnemonic)

The strands transcribed into mrna strands would look like:

1. ATTCGACGTC

  UAAGCUGCAG

2. GATAGCTAGG

   CUAUCGAUCC

Answer 2

Answer:

The first one will be UAAGCUGCAG. The second one is CUAUCGAUCC.


Related Questions

Which of the following statements is true?
A.
The Earth's lithosphere is entirely made up of liquid magma.
B.
The Earth's mantle is made up of tectonic plates.
C.
The Earth's mantle is made up of continents.
D.
The Earth's lithosphere is made up of tectonic plates.

Answers

Answer:

D.  The Earth's lithosphere is made up of tectonic plates.

Explanation:

The lithosphere is the Earth's outermost layer. It is made up of the brittle crust and upper mantle. Lithosphere is consist of huge slabs known as tectonic plates. These plates are present on the top of molten layer (partially) of rock. The heat from the mantle allows the bottom of the rocks soft and cause plates to move.

There are two main types of tectonic plates called oceanic and continental.

Hence, the correct answer is "D.  The Earth's lithosphere is made up of tectonic plates."

The Earth's lithosphere is made up of tectonic plates. The correct option is D.

Thus, The Earth's lithosphere, which is its solid outer layer, is made up of numerous large and small tectonic plates that move and float on the asthenosphere underneath.

Along plate borders, these plates, which are made up of both continental and oceanic crust, interact with one another, causing a variety of geologic events like earthquakes, volcanic eruptions, and the construction of mountain ranges.

Liquid magma (A) or tectonic plates (B) do not make up the complete lithosphere; rather, tectonic plates are a part of the lithosphere. The mantle of the Earth, which sits underneath the crust, is made up of solid rock materials rather than continents (C).

Thus, The Earth's lithosphere is made up of tectonic plates. The correct option is D.

Learn more about lithosphere, refer to the link:

https://brainly.com/question/454260

#SPJ6

Is this correct? Please help :)

Is this correct? Please help :)

Answers

Answer:

I am pretty sure correct me if I am wrong

Explanation:

the original hypothesis of this experient was that if scientist cut down trees and applied herbiscide to a watershed

Answers

The statement "The original hypothesis was that if scientists cut down trees and applied herbicide to a watershed, more water would flow out of it" is true.

The hypothesis was that if scientists cut down trees and applied herbicide to a watershed, more water would flow out of it. This is because trees play a role in regulating streamflow by transpiring water into the atmosphere. When trees are removed, there is less water being transpired, which leads to increased streamflow.

The experiment was conducted at the Hubbard Brook Experimental Forest in New Hampshire. Two watersheds were selected, one of which was deforested and the other of which was left intact. Streamflow was measured in both watersheds for a period of five years. The results of the experiment showed that streamflow increased significantly in the deforested watershed.

The findings of the Hubbard Brook experiment have important implications for watershed management. They suggest that deforestation can lead to increased streamflow, which can have a number of negative consequences, such as flooding, erosion, and water quality degradation.

To know more about the Hubbard Brook experiment refer here :

https://brainly.com/question/28309929#

#SPJ11

Complete question :

The original hypothesis was that if scientists cut down trees and applied herbicide to a watershed, more water would flow out of it.  T/F

Are the proteins of one specialized cell made in specialized cells of a different type?

Answers

Yes; The proteins of One specialized cell are made in specialized cells of a different type.

A cell that is specialised has particular features that enable it to perform its specific function in the body.

All cells begin as stem cells, which can differentiate into a wide variety of other cell types. To become specialised, they go through a process known as differentiation.

Diverse environmental factors influence how the cell makes proteins during differentiation.

Through gene regulation, individual genes can be activated or inactivated, which results in the production of unique proteins that give cells their structure and function.

Protein translocation: At this stage, protein synthesis is stopped, allowing fully produced proteins to be released into the cytoplasm. Then, in order for these proteins to act by a certain type of mechanism, they are directed to various places.

To know  more about Protein synthesis refer to:

https://brainly.com/question/18800216

One of the major positive effects of globalization is:
OA. faster spread of technology and ideas around the world.
B. decreased environmental damage from burning fossil fuels.
C. businesses choosing to hire more workers in their own countries.
D. less economic competition between different countries.
SUBMIT

Answers

The major positive effect of globalization is faster spread of technology and ideas around the world. The correct option is A

What is globalization ?

Technology and ideas have spread more quickly thanks to globalization. This is due to the fact that globalization has made it simpler for people to communicate and travel. People are therefore more likely to be exposed to novel concepts and cutting-edge innovations from many civilizations. Progress and innovation may result from this.

For instance, the internet has made it easier than ever for people to communicate information and ideas with one another. As a result, new technologies like social media and online education have emerged.

Learn more about globalization here : brainly.com/question/25499191

#SPJ1

Which statement describes a difference between the nitrogen and carbon cycles?



The nitrogen cycle occurs entirely in the ocean.

The nitrogen cycle requires a process called nitrogen fixation that is carried out by certain bacteria.

The carbon cycle requires freezing temperatures.

The carbon cycle involves only plants.

Answers

Answer:

The nitrogen cycle requires a process called nitrogen fixation that is carried out by certain bacteria

The primary distinction between the carbon and nitrogen cycles is that the former involves recycling carbon, whilst the latter involves recycling nitrogen. There are numerous ways for both systems to recycle carbon and nitrogen. With gases, both cycles begin and end. Thus, option B is correct.

What between the nitrogen and carbon cycles?

Both go through chemical changes that change the shape of the molecules they are contained in. All organisms that are living contain both nitrogen and carbon. Both entail releasing the element into the atmosphere in a molecular form. The cycles start and end as gases.

Therefore, The amount of nitrogen that can be absorbed into organic matter and then recycled rises as the flux of carbon does.Both involve releasing the element as a molecule form into the atmosphere. As gases, the cycles begin and finish.

Learn more about nitrogen cycle here:

https://brainly.com/question/1615727

#SPJ12

the purpose of DNA replication in the cell cycle?

the purpose of DNA replication in the cell cycle?

Answers

B I think I’m not sure
To increase genetic diversity
I think I m not sure.
Thank you

List at least two ways that viral diseases can be spread.

Answers

How are bacterial and viral infections spread?

Coughing and sneezing.

Contact with infected people, especially through kissing and sex.

Contact with contaminated surfaces, food, and water.

Contact with infected creatures, including pets, livestock, and insects such as fleas and ticks.

Which of the following is not an example of green infrastructure?
OUrban tree canopy
O Permeable pavement
Rainwater harvesting
Streets and parking lots

Answers

Answer:

Streets and parking lots

Explanation:

The example that is not an example of green infrastructure from the given options is Streets and parking lots.Green infrastructure refers to the network of natural and semi-natural features, green spaces, and ecological systems in cities and towns. It is an approach to managing stormwater runoff that emphasizes infiltration and the use of natural systems to filter pollutants from water.Green infrastructure helps to manage stormwater, improve air quality, and create healthier urban environments. It includes practices such as urban tree canopy, permeable pavement, and rainwater harvesting. Streets and parking lots, on the other hand, are not examples of green infrastructure.

List 3 adaptations of organisms for living in a desert

Answers

Answer:

1.LONG LEGS TO KEEP AWAY FROM THE LAND BECAUSE ITS REALLY HOT

2. SHORT FUR OR FEATHERS

3. LIGHT COLORED COATS TO KEEP THE SUN FROM REFLECTING OFF OF YOU SO THAT YOU AREN'T HOT

what is the name of the acute inflammatory eruption of highly painful vesicles, mostly on the trunk of the body, and also known as shingles?

Answers

Herpes Zoster or Shingles is the name of the acute inflammatory eruption of highly painful vesicles, mostly on the trunk of the body, and also known as shingles.

Herpes zoster, usually referred to as shingles, is a severe inflammatory skin eruption of very painful vesicles.

The same virus that causes chickenpox, varicella-zoster, is responsible for its reactivation. It normally affects just one dermatome on the body's trunk and is distinguished by a band-like dispersion of vesicles there. Itching and a burning feeling are frequently present in addition to it.

Shingles can also affect the face and result in severe side effects include vision loss, hearing issues, and excruciating pain that persists even after the rash has disappeared.

Antiviral drug therapy is advised in order to lessen the intensity and duration of the sickness.

To learn more about chickenpox visit:

https://brainly.com/question/4024185

#SPJ4

How might retaining too much heat be a disadvantage to an organism?

Answers

Answer:

Too much heat can disrupt subcellular structures such as membrane proteins, and enzymes while damaging the integrity of the plasma membrane.

Explanation:

Proteins are macromolecules made up of amino acids. These fold and bond to form several biologically important molecules. For instance, enzymes, a special type of protein functions by providing alternative reaction pathways. They work best at a specific pH and optimal temperature range, beyond which they become non-functional  or denatured entirely.

The denaturing of proteins occur at high temperatures, and alter protein folding, bonding and other types of behavior. Furthermore, membrane proteins are  important for regulating cell function. If these are disrupted, the system cannot maintain homeostasis i.e a constant internal environment.

How might retaining too much heat be a disadvantage to an organism?

The maps above show the arrangements of Earth's continents and oceans 65 million years ago and at present. Which of the following best explains the change seen in the Atlantic Ocean over the last 65 million years?
A.
Tectonic plate motion caused the Atlantic Ocean basin to increase in size.
B.
Magnetic forces pulled continents apart to make the Atlantic Ocean basin larger.
C.
Tectonic plate motion caused the Atlantic Ocean basin to decrease in size.
D.
Magnetic forces pushed continents toward each other to make the Atlantic Ocean basin smaller.

The maps above show the arrangements of Earth's continents and oceans 65 million years ago and at present.

Answers

Answer:

Tectonic plate motion caused the Atlantic Ocean basin to increase in size.

Explanation:

Tectonic plate motion caused the Atlantic Ocean basin to increase in size. In fact, all of the differences in size, shape, and position seen between the two maps are due to the shifting of tectonic plates over time.

According to plate tectonic theory, tectonic plate motion caused the Atlantic Ocean basin to increase in size. Therefore, option A is correct.

What are tectonic plates?

Huge fragments of the Earth's crust and upper mantle make up tectonic plates. They are composed of both continental and oceanic crusts. Around mid-ocean ridges and the significant faults that define the plate boundaries, earthquakes happen. African, Antarctic, Eurasian, Indo-Australian, North American, Pacific, and South American are the seven primary plates mentioned in the World Atlas.

Large rock slabs called tectonic plates, which separate the Earth's crust, are continually moving and changing the planet's topography. According to the framework of ideas underlying the plate tectonics theory, the lithosphere, the Earth's outer shell, is divided into many plates that move across the rocky interior of the planet.

Tectonic plate motion caused the Atlantic Ocean basin to increase in size. Thus, option A is correct.

Learn more about tectonic plates, here:

https://brainly.com/question/19317822

#SPJ2

Each time a fatty acid bonded to the glycerol molecule, you should have -H and an O-H left over. What molecule
does these left-over atoms bind together to create?

Answers

Each time a fatty acid is bonded to the glycerol molecule the leftover atoms -H and -OH bind together and create a water molecule i.e H₂O molecule.

What are Fatty Acids?

A fatty acid is a carboxylic acid having an aliphatic chain that is either saturated or unsaturated.

Fatty acids are the building blocks of fat in our bodies and our meals. The body converts lipids into fatty acids during digestion, which can subsequently be absorbed into circulation. Fatty acid molecules are typically joined in groups of three to form a molecule known as a triglyceride.

To learn more about fatty acids click on the given link:

https://brainly.com/question/4318895

#SPJ1

A heterozygous tall (Tt) plant is crossed at with a short plant (tt). The probability that offspring plants will be tall is
a. 25%

b. 50%

c. 75%

d. 100%

Answers

The answer is 50%, or B.

the florida panther, a member of the cat family, has a population of fewer than 100 individuals and has limited genetic variation. which inference based on this information is valid? select one: a. these animals will begin to evolve rapidly. b. these animals are easily able to adapt to the environment. c. over time, these animals will become more likely to be resistant to disease. d. over time, these animals will become less likely to survive in a changing environment.

Answers

The valid inference based on this information is d. over time, these animals will become less likely to survive in a changing environment.

Limited genetic variation in a population can decrease its ability to adapt to changes in the environment, making it more vulnerable to extinction. Inbreeding and genetic drift can also occur in a population with limited genetic variation, which can lead to decreased fitness and reproductive success.

Genetic variation is essential for a species to adapt to a changing environment. If a population has limited genetic variation, it means that they do not have many different versions of genes to respond to environmental pressures, such as changes in climate or availability of food. This lack of genetic diversity can make the population less adaptable to changes, which increases their risk of extinction.

Know more about genetic variation here: https://brainly.com/question/848479

#SPJ4

Give me at least two examples
of using biology in everyday life​

Answers

Answer:

Agriculture. The food that we consume is the result of agriculture. ...

Food & Drinks. What keeps us alive is the food that we consume. ...

Health & Medicine. Whenever we get sick, we consult a doctor. ...

Clothing.

Jet lag.

Stem cells.

Altitude Sickness.

Environment & Ecosystem.

Explanation:

Answer:

Circadian cycle= You fall asleep at night and wake up during the daylight.

Nerve receptors =You feel the sense of things around you.

Where in the cell does anaerobic respiration occur?.

Answers

Anaerobic respiration occurs in the cytoplasm of the cell.

WHAT IS ANAEROBIC RESPIRATION?

Anaerobic respiration is one of the two types of respiration that occurs in the absence of oxygen.

Anaerobic respiration includes;

Lactic acid fermentation- occurs in bacteria like lactobacillusAlcoholic fermentation- occurs in yeast cells.

Generally, anaerobic respiration occurs in the cytoplasm of living organisms that undergo it.

Learn more about anaerobic respiration at: https://brainly.com/question/1439976

What specific bond in a protein absorbs light at 215 nm (choose the best answer)?
Group of answer choices
Hydrogen bond
Tryptophan bond
Peptide bond
Covalent bond

Answers

The specific bond in a protein that absorbs light at 215 nm is the Tryptophan bond.

Tryptophan is one of the 20 amino acids that make up proteins and has an aromatic ring structure that absorbs light in the ultraviolet range. This ring structure, known as an indole group, is unique to tryptophan and allows it to absorb light at 215 nm. In proteins, tryptophan residues are often found in hydrophobic environments, where they are protected from the solvent, and this environment can influence the way that tryptophan absorbs light. Because of this, the absorption of light at 215 nm by tryptophan residues in proteins can provide information about the protein's structure and stability.

Here you can learn more about Tryptophan

https://brainly.com/question/28299872#

#SPJ11

Which phase of Mitosis is pictured?

Which phase of Mitosis is pictured?

Answers

Answer:

Anaphase

Explanation:

If you place a feather on the surface of a bowl of water, the feather remains suspended on the surface due to the:

a)fact that water is a good solvent.
b)surface tension of the water.
c) polarity of the water.
d)density of the water.

Answers

If you place a feather on the surface of a bowl of water, the feather remains suspended on the surface due to the B) surface tension of the water.

What is surface tension?

Surface tension is the property of the surface of a liquid that enables it to resist an external force, for example, a weight in contact with the surface. The molecules at the surface of a liquid experience a net inward force due to the unbalanced intermolecular forces at the surface.

Surface tension, measured in newtons per meter (or dynes per cm), is the force perpendicular to a line on the surface that acts on the opposite side of the line.

The feather stays on the surface of the water because of the high surface tension. Since the feather's density is less than the water's, the feather cannot sink. Because the feather does not penetrate the surface of the water, it rests on it. This is the reason why the feather remains suspended on the surface of the water.

Thus, the answer is B) Surface tension of the water.

Learn more about Surface tension:

https://brainly.com/question/14530972

#SPJ11

A new vaccine has been developed to protect people against salmonella food poisoning
Explain how the vaccine prevents people becoming ill with salmonella food poisoning
PLEASE HELP ITS DUE TMRW

Answers

Answer:

Explanation:

I really don’t know I just wanted to write this to get the point’s because I’m new to dis app

Contains an inactive or dead form of the pathogen which makes the memory cells remember the shape of the antigens on the pathogen so when a live salmonella pathogen enters the body it will trigger a secondary response, the memory cells will trigger a quicker response and the pathogen will be destroyed quickly, without any symptoms being present

Hope this helps :))

aldosterone . is secreted by the posterior pituitary gland functions to increase sodium concentration in the blood presence increases potassium concentration in the blood production is greatly influenced by tsh

Answers

Aldosterone is not secreted by the posterior pituitary gland, but by the adrenal cortex. Its main function is to regulate the levels of sodium and potassium in the blood by increasing sodium reabsorption in the kidneys and promoting potassium excretion.

This helps to maintain blood pressure, fluid balance, and electrolyte homeostasis. The production of aldosterone is primarily regulated by the renin-angiotensin-aldosterone system (RAAS), which responds to changes in blood volume and pressure. While thyroid-stimulating hormone (TSH) can indirectly affect adrenal function, it does not directly influence aldosterone production.


Aldosterone is a hormone primarily involved in regulating blood pressure and electrolyte balance. It is produced by the adrenal cortex, not the posterior pituitary gland. Its main function is to increase sodium concentration in the blood by promoting its reabsorption in the kidneys, while simultaneously increasing potassium excretion. The presence of aldosterone thus helps maintain a proper balance between sodium and potassium levels in the blood. The production of aldosterone is not directly influenced by TSH (thyroid-stimulating hormone), as TSH specifically targets the thyroid gland to regulate the production of thyroid hormones.

To know about Aldosterone visit:

https://brainly.com/question/28303131

#SPJ11

What is greatly affected by atmospheric pressure?

Answers

High pressure and stressful situations and others like this

if something has a high kinetic energy, what would the temperature and
motion of molecules most likely be?
A. high temperature, slow motion of molecules
B. low temperature, fast motion of molecules
C. high temperature, fast motion of molecules
D. low temperature , slow motion of molecules

Answers

The answer is C your welcome
Answer: Either c or d hope this can help


The scientist is studying the processes for which cellular respiration provides
work, such as the contraction of muscles. Drag the processes into the correct
order to show how respiration provides energy to a muscle fiber for contraction to
take place

The scientist is studying the processes for which cellular respiration provideswork, such as the contraction

Answers

Answer:

Glucose molecules in the bloodstream are absorbed by a muscle cell

The answer is Glucose molecules in the bloodstream are absorbed by a muscle cell. A metabolic pathway called cellular respiration breaks down glucose and generates ATP

What does cellular respiration mean in a scientific context?Cellular respiration is a metabolic process that converts glucose into ATP. Cellular respiration is divided into four stages: glycolysis, pyruvate oxidation, the citric acid cycle, or Krebs cycle, and oxidative phosphorylation.During cellular respiration, glucose is converted into chemical energy in order to produce ATP from ADP and phosphate. The majority of cells' cellular respiration can be divided into two basic steps: glycolysis and oxidative phosphorylation.The mitochondrial energy is stored as potential energy in molecules known as adenosine triphosphate (ATP). ATP is the primary chemical produced during cellular respiration. ATP is the standard unit for storing the energy released during respiration.

To learn more about cellular respiration refer to:

https://brainly.com/question/8790025

#SPJ2

a student completes a pet experiment using chloroplasts from leaves lacking pigments that absorb in the 550 nm to 600 nm wavelength range. which color of light should they avoid in their experiment if they want to measure activity at different wavelengths?

Answers

The student should avoid using yellow light, which has wavelength around 550-580, which will not get absorbed at all since the pigment absorbing this wavelength is missing

Color Wavelength (nm)

Red        650 - 800

Orange   590 - 640

Yellow   550 - 580

Blue   460 - 480

Indigo   440 - 450

Violet   390 - 430

The distance over which a periodic wave's form repeats is known as the wavelength in physics.  It is a property of both traveling waves and standing waves as well as other spatial wave patterns.

It is the distance between two successive corresponding locations of the same phase on the wave, such as two nearby crests, troughs, or zero crossings. The spatial frequency is the reciprocal of wavelength. The Greek letter lambda () is frequently used to represent wavelength.

learn more about wavelengths

https://brainly.com/question/19448078

#SPJ4

Full Question :A student completes a PET experiment using chloroplasts from leaves lacking pigments that absorb in the 550 nm to 600 nm wavelength range. Which color of light should they avoid in their experiment if they want to measure activity at different wavelengths? Absorbance 360 760 460560660 Wavelength (nm)

O Blue

O Orange

O Yellow

O Red

O Violet

At the end of transcription, rna polymerase dissociates from the dna when the enzyme reaches a site called the region.

Answers

The enzyme reaches a site called the region terminator.

As RNA polymerase approaches the ends of transcribed genes it encounters regions rich in C and G nucleotides. RNA transcribed from this region folds and binds complementary C and G nucleotides to each other. The result is a stable hairpin that stalls the polymerase.

Termination is the termination of transcription and occurs when RNA polymerase crosses the termination sequence of a gene. The mRNA strand is intact and separated from the DNA. Once termination is complete, the mRNA molecule sheds from the DNA template. At this point at least in eukaryotes, newly synthesized mRNAs undergo a process in which non-coding nucleotide sequences called introns are excised from the mRNA strand.

Learn more about The enzyme here:-https://brainly.com/question/1596855

#SPJ1

What is the probability of producing a tall pea plant from a genetic cross between two heterozygous tall pea plants (tall is dominant)?



25%


50%


75%


100%​

Answers

Answer:

100%

Explanation:

There are 4 individual outcomes. (s = short)

TT

TT

Ts

Ts

So its 100% (The dominant is always expressed unless the genotype is ss)

100% hope this help stay safe

when does conjugation occurs in paramecium​

Answers

Answer:

I hope the information in the image can help

when does conjugation occurs in paramecium
when does conjugation occurs in paramecium
when does conjugation occurs in paramecium
Other Questions
An electron transitions from n = 5 to n = 3 in a hydrogen atom. What is the energy required for this transition? Is energy emitted or absorbed in the transition?Your solution must include a step-by-step solution with units included throughout. The cost of wages paid to employees directly involved in the manufacturing process in converting materials into finished products is classified asa. direct labor cost How is the gender of an organism determined ?Please help , thank you Most individuals continually monitor their own behavior and note how others react, and then adjust accordingly. this action is referred to as ______. What is the difference between a solstice and an equinox ?Using three or more complete sentences, describe the reasons why these days are unique?? suppose 50 percent of the customers at pizza palooza order a square pizza, 72 percent order a soft drink, and 36 percent order both a square pizza and a soft drink. is ordering a soft drink independent of ordering a square pizza? Which of the following statements best describe Edisons contributions? What is the term for the study of the physiochemical properties of drugs and how they influence the body Use the Terms & Names list to complete each sentence online or on your own paper.A. Quartering ActB. Continental ArmyC. First ContinentalCongressD. Sons of LibertyE. Townshend ActsF. Paul RevereG. Sugar ActH. Thomas JeffersonI. Crispus AttucksJ. PhiladelphiaK. Boston Tea PartyL. Writs of AssistanceThe ____ was a secret society established to oppose British policy. A docter recommends that sachi drink 90 fluid ounces of water each day. for every 1 liter, there is approximately 33.8 fluid ounces. how many liters of water does sachi need to drink each day, rounded to the nearest tenth? Search about the names and places of the Worlds most active volcanoes Which would be a qualification to the view that oligopoly is allocatively and productively inefficient? If $5000 is put into a savings account that pays 3.5% interest compounded monthly, how much money, to the nearest ten cents, would be in that account after 6 years, assuming no money was added or withdrawn? 1) $5177.80 3) $6146.30 2) $5941.30 4) $6166.50 Answer the following question be sure to do the following to receive full credit: Include the formula you are using--explain why you chose this formula Define all key components of the formula-- explain how you knew the value for each Show all calculations for how to solve The length of the rectangle is one units more than the width. The area of the rectangle is 56 units. What is the width, and units, of the rectangle? for a supernova such as sn 1987a, what is responsible for the radiation detected after the radiation from the explosion itself fades away? 1) What is the distance between (4.3)and (3,-2)? Justification of War - Iliad Indicate how the location of each of the following curves would be altered if (1) total fixed cost increases and (2) total variable cost decreases at each level of output. Curve Change when TFC Increases Change when TVC Decreases (AFCAVCATCMC Express the equation in logarithmic form: = 1024 is equivalent to log, A = B. (a) 45 and B = (b) 10 0.01 is equivalent to log10 C = D. C= and D Simplify -121O-111O 11O-11O 11