You have four tubes with buffer, primer, DNA polymerase, template, and dNTP’s. In tube A, you have added radioactive ddATP at a ratio of 1 ddATP/100 dATP. In tube T, you have added radioactive ddTTP at a ratio of 1 ddTTP/100 dTTP. In tube G, you have added radioactive ddGTP at a ratio of 1 ddGTP/100 dGTP. In tube C, you have added radioactive ddCTP at a ratio of 1 ddCTP/100 dCTP. Here is a picture of the template and based paired primer. Each tube has millions of these base paired constructs.

5’ - CTAGTACTGA

3’ - GATCATGACTAGACTTTGGACTAGCTACAAAGTACGAGTAGAACTAGC

After allowing for DNA synthesis and after denaturing the double strand DNA and after separating the single strand DNA by size in a polyacrylamide gel with the A, T, G, and C tube contents in separate lanes, and after performing autoradiography, you detect bands in the A, T, G, and C lanes. The sequence on the gel is read from bottom to top

Which option choice is correct

A. In a 3’ to 5’ direction.

B. Using a polymolecular ladder step function.

C. In a 5’ to 3’ direction.

D. Including the nucleotides from first the A lane, then the T lane, then the G lane and then the C lane.

RNA directs the synthesis of protein through a process called translation.

Translation is the process by which the information encoded in the messenger RNA (mRNA) molecule is used to synthesize a specific protein. It takes place in the ribosomes, which are cellular structures composed of ribosomal RNA (rRNA) and protein.

The process of translation involves several steps:

1. Initiation: The small ribosomal subunit binds to the mRNA molecule at the start codon, which is usually AUG (adenine-uracil-guanine) in the mRNA sequence. The initiator tRNA (transfer RNA) molecule, carrying the amino acid methionine, binds to the start codon.

2. Elongation: The ribosome moves along the mRNA molecule, reading the codons in a sequential manner. Each codon specifies a particular amino acid. The appropriate tRNA molecules, with complementary anticodons, bring the corresponding amino acids to the ribosome. The ribosome catalyzes the formation of peptide bonds between the amino acids, creating a growing polypeptide chain.

3. Termination: The ribosome reaches a stop codon (UAA, UAG, or UGA) on the mRNA, signaling the end of protein synthesis. Release factors bind to the stop codon, causing the ribosome to dissociate from the mRNA. The newly synthesized protein is released and can undergo further modifications or fold into its functional three-dimensional structure.

During translation, the mRNA serves as a template for the assembly of amino acids in the correct sequence to form a specific protein. Each set of three nucleotides in the mRNA, called a codon, corresponds to a specific amino acid. The genetic code, which is the correspondence between codons and amino acids, is universal in most organisms.

Overall, translation is a fundamental process in protein synthesis, allowing the genetic information stored in the DNA to be expressed as functional proteins necessary for various cellular processes and functions.

to know more about protein visit:

brainly.com/question/29638846

#SPJ11

Replacement of histones with protamines means is the correct option and explain this question more clearly.

Both the protein are the most important protein of our cell because during the combination of DNA.  the chromatin and the chromosome these basic proteins are also present with the DNAThe histone protein are positively charged and contain amino acid residuous that is lysine  and arginine .In the human body their are 23 pair of chromosome. Out of which 22are autosomes and 1 pair is  sex chromosomes.

The binding of protamines to DNA condenses the chromatin structure, rendering the genes inaccessible to the transcription machinery. This transcriptional inactivation ensures that spermatozoa retain their compact and streamlined structure, allowing for efficient motility and fertilization.

To know more about chromosome

https://brainly.com/question/30077641

#SPJ4

Answer:

Translation begins when an mRNA connects to the small subunit of a ribosome.

Explanation:

Connected to the tRNA of the start codon is an amino acid, called f-Met. Once the f-Met tRNA binds to the small subunit of the ribosome, the large subunit of the ribosome binds to the small unit, and translation is ready to begin. Therefore, translation begins when an mRNA connects to the small subunit of a ribosome.

According to the research, the correct answer is that unicellular living beings like prokaryotes have their cell division by binary fission, forming two identical individuals (daughter cells).

It refers to the process of cell division where first the deoxyribonucleic acid (DNA) is duplicated and then cytonesis occurs, which involves the separation of the cytoplasm.

In this sense, it gives rise to two daughter cells with identical genetic material, this is the reproduction method shared by certain yeasts, algae, bacteria and other prokaryotic organisms.

Therefore, we can conclude that the cell division mechanism of prokaryotes is through binary fission where two daughter cells arise.

Learn more about binary fission here: https://brainly.com/question/12196278

#SPJ1

Answer:

Saliva

Lipase

Amylase

Trysin

Pepsin

Erepsin

Explanation:

Substances? Just any substances?

Answer:

Hi, There!

xXxAnimexXx

Have a great day!

Answer:

\(\huge\fbox\colorbox{pink}{❥answer♡}\)

Parenchyma, in plants, tissue typically composed of living cells that are thin-walled, unspecialized in structure, and therefore adaptable, with differentiation, to various functions.

\(\fbox\colorbox{pink}{❥i \: hope \: it \: help \: you♡}\)

\(\fbox\colorbox{pink}{❥pagal \: kudi♡}\)

Explanation:

Antimicrobial resistance (AMR),develops when microbes, including bacteria, fungi, parasites, and viruses, no longer respond to a drug that previously treated them effectively.

Answer:

The fourth option

Explanation:

A mouse that needs less water, as the desert is an arid climate

The false statement regarding prolactin and oxytocin is option d, which states that prolactin is involved in the production of semen.

Prolactin is a hormone released by the anterior pituitary gland that stimulates milk production in the mammary glands after childbirth. It is not involved in the production of semen, which is primarily controlled by testosterone. On the other hand, oxytocin is a hormone released by the posterior pituitary gland that plays a crucial role in childbirth and breastfeeding.

It causes the contraction of the myometrium, the muscle layer of the uterus, during labor and delivery. After childbirth, oxytocin also stimulates the milk letdown reflex, which causes the expulsion of milk from the mammary glands during breastfeeding.

In addition, oxytocin is also involved in social bonding, sexual arousal, and stress reduction. Mothers nursing newborns can feel strong uterine contractions due to the effects of oxytocin, and it is normal for females to feel sexual arousal during nursing due to oxytocin release. Finally, oxytocin is released in response to stimulation of sensory nerves in the nipples, which triggers the milk letdown reflex.

To know more about prolactin, refer

https://brainly.com/question/15906270

#SPJ11

Answer:

because our body needs six main nutrients to function normally

Answer:

answer A the conversion of CO2 to an organic compound.

Explanation:

Carbon fixation is first step of Calvin cycle. The carbon fixation is process during which inorganic CO2 gas into organic compounds.

The carbon fixation does not involve usage of RuBisCO to form 3-PGA. This step will take place during regeneration process of Calvin cycle.

Carbon fixation refers to the conversion of carbon dioxide to an organic compound.

It is the process by which autotrophs fix atmospheric carbon to produce organic compounds. It is the assimilation of inorganic carbon and its transformation to organic compounds. This can be used as the storage of energy and for the production of biomolecules.

All the autotrophs fix atmospheric carbon dioxide by the phenomenon of chemosynthesis or photosynthesis. The main process of carbon fixation is the photosynthesis. The process of carbon fixation takes place in the light-independent reaction or dark reaction of the process of photosynthesis.

Thus, the correct statement is option a.

Find out more information about carbon fixation here:

https://brainly.com/question/7142342

Answer:

living

Explanation:

Answer:

That is a true statement

Explanation:

Title is no use in graph

hope it's is right

Agar is a gelatinous substance derived from seaweed that is commonly used as a solidifying agent in microbiological media.

It provides a solid surface for bacteria to grow on and makes it easier to isolate individual colonies.

Despite the presence of agar in the glucose minimal media plates, we can still call it a defined medium because agar itself does not provide any nutrients for bacterial growth.

In fact, agar is considered inert and does not interfere with the chemical composition of the medium. The nutrients in the medium, such as glucose, amino acids, and vitamins, are all carefully controlled and precisely defined, which is what makes it a defined medium.

In summary, agar is a solidifying agent commonly used in microbiological media, but it does not provide any nutrients for bacterial growth. Therefore, despite its presence in glucose minimal media plates, we can still call it a defined medium because the nutrients in the medium are carefully controlled and precisely defined.

For more similar questions on microbiology and microbiological techniques:

brainly.com/question/30098569

#SPJ11

Answer:

Damaged DNA causes an increase in the number of mutations in the cell: this is extremely dangerous for the body and in fact this process is at the basis of the birth of cancer cells.

To avoid this, the cell is equipped with some molecular protective systems including the activation of the p53 protein. p53 induces recruitment of DNA damage repair systems and stops cell replication until the damage has been repaired. If the damage cannot be repaired p53 induces cell death through apoptosis

The journey of food from mouth to anus is that the Food is cut into pieces in the mouth, Proteins are broken down in the stomach, Fat is broken down into smaller droplets in the small intestine and Carbohydrates are first broken down in the stomach and waste material is discharged from the anus.

The digestive system has been shatters down food to the nutrients such as the carbohydrates, as well as fats and proteins. They can then be soaked into the main bloodstream so that the body can utilize them for the purpose of energy, along with growth and repair.

Proteins are broken down in the stomach, Fat is broken down into smaller droplets in the small intestine and Carbohydrates are first broken down in the stomach and waste material is discharged from the anus.

Therefore, The waste material is discharged from the anus.

Learn more about digestive system on:

https://brainly.com/question/29485648

#SPJ1

The sodium and chloride ion concentrations are lower inside the cell than outside, and the potassium concentration is greater inside the cell. These concentration differences for sodium and potassium are due to the action of a membrane active transport system which pumps sodium out of the cell and potassium into it.

Answer:

Sample 1

Explanation:

Dna contains carbon, hydrogen, oxygen, nitrogen, and phosphorus. These make up the sugar-phosphate backbone of the DNA also known as the sides of the ladder.

Answer:

58 – 68 days or about 2 months

Answer:

Long necks were a random genetic change and resulted in the gradual increase of organisms with long necks.

Answer:

Archaea is prokaryotes...

Explanation:

Hope it helps you

mark me as brainliest ❤️

Answer: A. Archaea

Explanation: Prokaryotes are single-celled organisms of the domains

Answer:

politics,imigration

Explanation:

welcome

The hormone produced by cells around the embryo that maintains the corpus luteum and pregnancy is called human chorionic gonadotropin (hCG).

Human chorionic gonadotropin (hCG) is a hormone that is produced by cells around the embryo, that is, trophoblastic cells that develop into the placenta, after fertilization. Its main function is to maintain the corpus luteum during the early stages of pregnancy. The corpus luteum is a temporary endocrine structure that develops after the release of an egg from the ovary, that is, after ovulation. It produces progesterone, which is essential for the maintenance of pregnancy in humans.

If an egg is fertilized by a sperm, the resulting embryo secretes hCG, which signals the corpus luteum to continue producing progesterone. This is necessary to prevent the lining of the uterus from shedding and to maintain the pregnancy. If the corpus luteum did not receive this signal, it would degenerate after about 12 days, and progesterone levels would decline. This would cause the lining of the uterus to be shed and menstruation to occur. The levels of hCG in a woman's blood and urine can be used to diagnose pregnancy. hCG levels rise rapidly in the first few weeks of pregnancy and can be detected by a blood or urine test. After about 10 weeks of pregnancy, hCG levels start to decline and eventually level off.

To know more about embryo visit:

https://brainly.com/question/30808880

#SPJ11

Answer:

To me i would say B is the answer

Answer:

D - a solar prominence is a column of gas that stretches out from the sun's (or any other star's) surface

Answer:

B

Explanation:

It was right for me

The correct statements about the Adenomatous Polyposis Coli (APC) gene are B, C, and E.

B. APC mutations found in human cancers increase the binding of APC to Beta-catenin: Mutations in the APC gene can lead to increased binding of APC to Beta-catenin, which in turn can result in the stabilization and accumulation of Beta-catenin in the cell, contributing to the development of colon cancer.

C. Beta-catenin levels are high in the presence of APC: In normal conditions, the APC protein helps regulate the levels of Beta-catenin by promoting its degradation. However, when the APC gene is mutated, the degradation of Beta-catenin is impaired, leading to elevated levels of Beta-catenin in the cell.

E. Hypermethylation of APC gene promoter is observed in some sporadic colon carcinomas: Methylation of the promoter region of the APC gene can occur in sporadic colon carcinomas. Hypermethylation of the gene promoter can result in the silencing or reduced expression of the APC gene, which plays a role in regulating cell growth and division. This alteration can contribute to the development of colon cancer.

Statements A and D are incorrect:

A. During colon cancer progression, APC mutations only occur after mutation of proto-oncogenes, such as RAS: APC mutations can occur early in the development of colon cancer and are considered to be one of the initiating events rather than occurring after mutations in proto-oncogenes like RAS.

D. APC protects the colonic crypts from developing cancer by limiting the lifespan of cells that are more likely to encounter carcinogens present in the intestines: While the APC gene plays a role in regulating cell growth and division, its primary function is to regulate the Wnt signaling pathway and control the levels of Beta-catenin. The main mechanism by which APC protects against cancer is by controlling Beta-catenin levels, rather than limiting the lifespan of specific cells.

Learn more about proto-oncogenes here:

https://brainly.com/question/13959639

#SPJ11