Answer:
A very fine grained type of massive gypsum is called alabaster which can be used in making ornaments and in carvings. Large quantities of rock gypsum are mined in Barber and Marshall Counties.
It is possible to carve ornaments out of gypsum because it basically consists of fine-grained particles which have a high ability to adhesion and resists one dries. It holds the particles compactly when it completely dries.
What is Gypsum?Gypsum may be defined as a type of soft sulfate mineral which is significantly composed of calcium sulfate dihydrate. It possesses the chemical formula CaSO4·2H2O. It is widely mined and is utilized as a fertilizer and as the main constituent in many forms of plaster, blackboard or sidewalk chalk, and drywall.
Due to having these specific characteristics, gypsum is widely used to make ornaments through the process of carving. It contains a substance that easily gives structure to any ornament like pots, glass, decorative items, etc.
Therefore, gypsum basically consists of fine-grained particles which have a high ability to adhesion and resists dries.
To learn more about Gypsum, refer to the link:
https://brainly.com/question/28238766
#SPJ2
A group of students is asked to make a model of a plant cell. The group is given different objects to represent cell parts. These objects include puzzle pieces, cardboard, plastic bags, and mini solar cells. Which object could be used to represent the function chloroplasts in the model?
Text to speech
a
puzzle pieces, because they put together proteins
b
cardboard, because it helps support the plant cell
c
a plastic bag, because it stores water and other liquids
d
mini solar cells, because they capture energy from sunlight
PLEASE HELP WILL MARK BRAINLIEST
Answer:
mini solar cells is the answer.
gymnosperms, like the angiosperms, represent a single evolutionary line. group of answer choices a) true. b) false.
The statement gymnosperms, like the angiosperms, represent a single evolutionary line' is false as gymnosperms and angiosperms are two different distinct lines of evolution.
Gymnosperms and angiosperms do not represent a single evolutionary line. They are two distinct groups of plants with different evolutionary histories and characteristics.
Gymnosperms are a group of seed-bearing plants that include conifers, cycads, Ginkgo biloba, and others. They are characterized by having "" seeds, which are not enclosed within a protective fruit. Gymnosperms were the dominant plants during the Mesozoic era and still play significant ecological roles today.
Angiosperms, on the other hand, are the flowering plants. They are the most diverse and widespread group of plants, with over 300,000 known species.
Unlike gymnosperms, angiosperms have seeds enclosed within a protective ovary that develops into a fruit after fertilization. They are characterized by the presence of flowers, which are reproductive structures.
While gymnosperms and angiosperms are both seed plants, they have distinct reproductive structures and evolutionary lineages. They represent separate branches of the plant kingdom's evolutionary tree.
To learn more about gymnosperms, click here:
https://brainly.com/question/17194627
#SPJ11
Which of the following best describes a DNA molecule?
Answer:
Double Helix
Explanation:
It is shaped like a ladder, and a double helix is a pair of parallel helices intertwined about a double axis, especially that in the structure of the DNA Molecule
what is the functional difference between type i diabetes mellitus and type ii diabetes mellitus. in each case indicate whether the hormone or receptor is the problem.
The functional difference between type I diabetes mellitus and type II diabetes mellitus is the hormone involved.
The beta cells of pancreas, in charge of making insulin, are attacked and destroyed by immune system in type I diabetes mellitus, an autoimmune condition. A hormone called insulin controls blood sugar levels. Because of this, people with Type I diabetes cannot produce enough insulin on their own and must inject exogenous insulin to regulate their blood sugar levels. As a result, Type I diabetes is caused by the hormone itself.
Conversely, Type II diabetes mellitus is a metabolic illness brought on by insulin resistance, which is when body's cells stop responding to insulin effect. To maintain normal blood glucose levels, the pancreas makes extra insulin as a form of compensation. The pancreas wears down with time, which causes a decline in insulin production. High blood glucose levels result from this, resulting in a number of health issues. As a result, Type II diabetes mellitus is caused by a malfunction with insulin receptor and the body's capacity to react to insulin.
Read more about type I diabetes on:
https://brainly.com/question/1908938
#SPJ4
what two neurotransmitter substances are associated with the sympathetic nervous system? describe the effects of each
Describe the effects of each. Norepinephrine and Epinephrine. NE stimulates alpha receptors, resulting in vasoconstriction of most blood vessels and smooth muscle in internal organs.
A neurotransmitter is a signaling chemical that a neuron secretes to effect another cell across a synapse. The cell receiving the signal, which might be any major body component or target cell, could be another neuron or a gland or muscle cell.
Neurotransmitters are released from synaptic vesicles into the synaptic cleft and interact with neurotransmitter receptors on target cells. The receptor to which the neurotransmitter binds determines the neurotransmitter's action on the target cell.
Learn more about neurotransmitter substances
https://brainly.com/question/28498879
#SPJ4
What is the relationship between population number and caring capacity in a stable population
Answer:
As resources are depleted, population growth rate slows and eventually stops: This is known as logistic growth. The population size at which growth stops is generally called the carrying capacity (K), which is the number of individuals of a particular population that the environment can support
hope it helped!
True/False: Most of the minerals have only one primary function in the body.
False. Most minerals have multiple primary functions in the body.
The statement is false. Most minerals play multiple primary functions in the body rather than having just a single primary function. Minerals are essential nutrients that are required in varying amounts for the proper functioning of the body.
For example, calcium is well-known for its role in maintaining strong bones and teeth, but it is also involved in muscle contraction, nerve transmission, blood clotting, and cell signaling. Similarly, magnesium is involved in over 300 enzymatic reactions in the body, including energy production, protein synthesis, and muscle function. Iron is crucial for oxygen transport in red blood cells, but it also plays a role in immune function and cognitive development.
Other minerals like potassium, sodium, zinc, copper, selenium, and many more have diverse functions in the body, ranging from fluid balance regulation to antioxidant defense, enzyme activation, and hormone production.
Overall, minerals are multifunctional and play vital roles in various physiological processes. A balanced diet that includes a variety of mineral-rich foods is essential to ensure an adequate intake of these essential nutrients and support overall health and well-being.
Learn more about minerals here:
https://brainly.com/question/1333886
#SPJ11
The fact that the base of the basilar membrane responds best to high frequencies supports the ________ theory of hearing.
The fact that the base of the basilar membrane responds best to high frequencies supports the Place theory of hearing.
The place theory of hearing states that the different parts of the basilar membrane respond to sounds of different frequencies. We hear different pitches due to specific frequencies vibrating specific parts on the basilar membrane.
As mentioned, the base part of the basilar membrane responds best to high frequencies but the tip of the basilar membrane won't respond in the same way. the tip of the basilar membrane will respond best to sounds of low frequency.
It also states that the pitch of a sound is determined by the place of vibration of the membrane.
If you need to learn more about Place theory of hearing. click here
brainly.com/question/1658085?referrer=searchResults
we can hear different pitches due to specific sound frequencies causing vibrations in specific parts on the basilar membrane of the cochlea
One Strand of DNA is listed below. Which of the following best
represents the complementary strand of DNA?
DNA Strand: TCGAGGCTAA
A. ACGUCCGAUU
B. GATCTTAGCC
C. AGTCCGAUU
Answer:Problem Set 4 Answers
1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
2. Below is a table for the genetic code:
T
C
A
G
T
TTT Phe (F)
TTC "
TTA Leu (L)
TTG "
TCT Ser (S)
TCC "
TCA "
TCG "
TAT Tyr (Y)
TAC "
TAA Stop
TAG Stop
TGT Cys (C)
TGC "
TGA Stop
TGG Trp (W)
C
CTT Leu (L)
CTC "
CTA "
CTG "
CCT Pro (P)
CCC "
CCA "
CCG "
CAT His (H)
CAC "
CAA Gln (Q)
CAG "
CGT Arg (R)
CGC "
CGA "
CGG "
A
ATT Ile (I)
ATC "
ATA "
ATG Met (M)
ACT Thr (T)
ACC "
ACA "
ACG "
AAT Asn (N)
AAC "
AAA Lys (K)
AAG "
AGT Ser (S)
AGC "
AGA Arg (R)
AGG "
G
GTT Val (V)
GTC "
GTA "
GTG "
GCT Ala (A)
GCC "
GCA "
GCG "
GAT Asp (D)
GAC "
GAA Glu (E)
GAG "
GGT Gly (G)
GGC "
GGA "
GGG "
a. The following codons can be mutated by one base to produce an amber codon:
CAG Gln
AAG Lys
GAG Glu
TCG Ser
TTG Leu
TGG Trp
TAA Stop
TAT Tyr
TAC Tyr
b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.
c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.
3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain. The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.
b. Template strand is the DNA strand off which the mRNA is synthesized. The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.
c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA. The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit. The sequence signals which AUG acts as the translation start in mRNA.
4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.
b. False, a frameshift mutation affects all the subsequent amino acids.
c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.
d. False, the wobble is first base (5’ to 3’) in the anticodon.
e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.
f. True. For example, a single base substitution causing CAT to change to AAT would signal a termination.
g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.
5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate. Therefore, the products remaining will consist of pppNp, Np, and N-OH
b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.
c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.
d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.
6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product. With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.
Explanation:
The complementary strand of the mentioned DNA strand is AGCTCCGATT.
What is DNA?DNA is a hereditary material which is present in human beings as well as all other living organisms. Every cell which is present in an organism's body has DNA which is the same. Most of the DNA is situated in the cell's nucleus and small amount of it can be found in the cell's mitochondria as well.
Information which is stored in DNA is stored as codes made up of four chemical bases namely, adenine, thymine , cytosine and guanine.Human DNA consists of 3 billion bases .The order of the bases determines information which is required for building and maintaining an organism.
DNA bases are capable of pairing up with each other. Adenine pairs with thymine and guanine pairs up with cytosine .Each base is also attached to a sugar molecule and a phosphate group. A base, phosphate sugar are together called as nucleotides.
Learn more about DNA,here:
https://brainly.com/question/2293843
#SPJ2
Your question is incomplete but most probably your full question was ,one Strand of DNA is listed below. Which of the following best
represents the complementary strand of DNA?
DNA Strand: TCGAGGCTAA
A. ACGUCCGAUU
B. GATCTTAGCC
C. AGTCCGAUU
D. AGCTCCGATT.
The lymphatic system absorbs glucose that is absorbed by small intestines for transport.
True
False
False. The lymphatic system does not directly absorb glucose from the small intestines for transport.
The absorption of glucose from the small intestines primarily occurs through the blood vessels in a process called intestinal absorption. After food is digested in the small intestines, glucose molecules are transported across the intestinal lining into the bloodstream. This process is facilitated by specialized cells in the intestinal wall called enterocytes.
The lymphatic system, on the other hand, plays a crucial role in the absorption of dietary fats. It absorbs fat molecules, known as fatty acids and glycerol, from the small intestines in the form of chylomicrons. These chylomicrons are then transported through the lymphatic vessels and eventually enter the bloodstream.
Glucose, being a simple sugar, is absorbed directly into the bloodstream through the blood capillaries in the small intestines, not through the lymphatic system. Therefore, the statement that the lymphatic system absorbs glucose from the small intestines for transport is false.
Learn more about lymphatic system here: https://brainly.com/question/32505766
#SPJ11
The tissue, at the top of this slide, is simple columnar epithelium and can be found in our intestines. Kellot OFPONSOR 7 N SIMPLE COLUMNAR Select one: True False
Name the bone seen here. Select one:
The given statement, "The tissue, at the top of this slide, is simple columnar epithelium and can be found in our intestines" is true.
The epithelial tissue found in our intestines is known as simple columnar epithelium. The simple columnar epithelium has column-shaped cells, which are elongated and taller than their width. These cells have a single nucleus and have a goblet cell that secretes mucus to lubricate the surface. It lines the gastrointestinal tract, uterus, and excretory ducts. Therefore, the given statement is true.The bone shown in the given image is the femur bone. The femur bone is the longest and strongest bone in the human body.
It is located in the thigh region and extends from the hip joint to the knee joint. The femur bone is responsible for supporting the entire weight of the body when a person is standing or walking. It is composed of the head, neck, shaft, and distal ends. The head of the femur bone fits into the acetabulum socket of the hip bone to form the hip joint. The distal end of the femur bone articulates with the tibia bone to form the knee joint.
Therefore, the given bone in the image is the femur bone.
know more about columnar epithelium click here:
https://brainly.com/question/30765951
#SPJ11
Clear-winged dragonflies live longer and can reproduce
many more times than yellow-winged dragonflies.
How is this population of dragonflies most likely to change as a result of this
difference?
O A. Dragonflies with yellow wings will evolve into ones with clear
wings
O B. Clear-winged dragonflies will become more common over time.
O C. The number of dragonflies will shrink until they become extinct.
O D. Yellow-winged dragonflies will become more common over time.
might use to further study the role of predators in the natural selection process.
Another hypothesis suggested by researchers that can be used to further study the role of predators in the natural selection process is the study of the total or partial absence of predators, visualizing the response in the environment.
Predators can act by controlling the population size of some species. When the population size of their prey begins to decrease, many species seek to feed on prey that are in greater abundance in the environment.
With this information, we can conclude that another hypothesis suggested by researchers that can be used to further study the role of predators in the natural selection process is the study of the total or partial absence of predators, visualizing the response in the environment.
To know more about natural selection, refer here:
https://brainly.com/question/20152465#
#SPJ11
Un instructor desea preparar un experimento sobre movimiento armónico simple. Sólo dispone de una masa de 2 kg pero tiene una colección de resortes. ¿Qué constante elástica, en N/m, debe elegir para tener un período de 2 s?
Answer:
Constante de resorte, k = 19.745 N/m
Explanation:
Dados los siguientes datos;
Masa, m = 2 kg
Periodo, T = 2 segundos
Para encontrar la constante del resorte, k;
\( Period, \; T = 2 \pi \sqrt {\frac {m}{k}} \)
Dónde;
T es el período. m es la masa del objeto. k es la constante del resorte.Haciendo k el tema de la fórmula, tenemos;
\( k = \frac {(2 \pi )^{2}m}{T^{2}} \)
Sustituyendo en la fórmula, tenemos;
\( k = \frac {(2 * 3.142)^{2} * 2}{2^{2}} \)
\( k = \frac {6.284^{2} * 2}{4} \)
\( k = \frac {39.49 * 2}{4} \)
\( k = \frac {78.98}{4} \)
Constante de resorte, k = 19.745 N/m
Summarize How cells divide
Tee wants to win a blue ribbon at the fair this year for the largest tomato plants. He would like to compare two new plant foods on his tomato plants to see if they really make the plants grow larger. Tee needs to design an experiment to see which plant food works better. He has three of the same type of tomato plant and they all receive the same
amount of sunlight and water, and are kept at the same temperature. Tee adds Miracle Grow to plant A, Kate’s Fertilizer to plant B, and he lets plant C grow without any plant food. He measures the growth of the plants every week.
A. What is the independent variable? (1 pt)
B. What is the dependent variable? (1 pt)
C. What would the control group be? (1 pt)
Independent variable is the variable that is changed or manipulated in a series of experiments while the dependent variable is the outcome measured to see the effectiveness of the treatment.
Control group in an experiment is the group of test subjects left untreated or unexposed to some procedure and then compared with treated subjects in order to validate the results of the test.
According to this question, Tee compared two new plant foods on his tomato plants to see if they really make the plants grow larger. He designed an experiment to see which plant food works better.
He has three of the same type of tomato plant and they all receive the same amount of sunlight and water, and are kept at the same temperature (control variables).
The independent variable is the type of plant food used while the dependent variable is the growth of plant.
Learn more about independent variable at: https://brainly.com/question/1479694
#SPJ1
What makes up a bay?
Bays are formed when the regions where the soft rock is eroded away that is present to the headland.
How is a bay formed simple?The regions where the soft rock is eroded away that is present to the headland is known as bays. The bands of soft rock i.e. sand and clay which erode more quickly than other more resistant rock. This leaves a part of land to stick out into the sea which is known as a headland. When a stretch of coastline is created from different kinds of rock, headlands and bays can be formed. Bands of soft rock i.e. clay and sand are weaker so that's why they can be eroded quickly. This process will leads to the formation of bays. A bay is also defined as inlet of the sea where the land curves inwards. A bay is a water body that is covered by land on three sides while on the other hand, oceans have no land is present on a specific side.
So we can conclude that due to erosion of soft rocks at the headland, bays are formed.
Learn more about bay here: https://brainly.com/question/16109710
#SPJ1
Can someone please compare and contrast the different types of distribution for populations of animals?
Answer:
The answer is below
Explanation:
Different types of distribution for populations of animals are:
1. Uniform distribution: the is a form of population distribution in which animals are divided or spaced out evenly across a certain territory. It is mostly observed in an area where there are limited resources to compete for.
2. Random distribution: this is a form of population distribution whereby animals or organisms are distributed without a predictable arrangement. It is mostly observed in an area where resources are sporadically distributed
3. Clumped distribution: this is a type of population distribution in which animals are crowded in groups in different places of the territory. It is mostly observed where resources are patchy.
benet is a very fat man ,he goes to the gym to lose his weight but he didnt achieve his goal so he decides to go on a diet to lose weight.as of his diet he leaves out all plants and animal fats completely .Do you think this action is wise .Give reason for answer
Answer:
no
Explanation:
because to have a healthy lifestyle you need to eat all different food (especially veggies) to have healthy lifestyle.
No links! pls help
What process is occurring in the illustration?
a) classic ecosystem
b) climax community
c) primary succession
d) secondary succession
Answer:
I believe its primary succession
Explanation:
Answer: C
Primary Succession
Explanation:
I took the quiz.
Describe how the fossil record could be used by scientists to help explain the evolution of a species. Justify your response in two or more complete sentences.
Answer:
You could use the fossil record to help explain the evolution of a species by watching how it aged, what it ate, how it breed and where it lived along with a million of other things. It could have lived in the 20 below freezing and then you find that same fossil in the warmest place in the world it shows that the species either adapted or possibly had an offspring that could handle the high temperatures.
Explanation:
Answer:
By looking at a fossil record, a scientist can learn how a species developed over time. These fossils show what a species looked like in the past. Through testing, they can determine how old and what kind of organism it was so they can compare it to similar organism today to see how it evolved.
Hope this helps! :D
1. Which of the following is not a type of hypertrophy?
a. Sarcoplasmic
b. Sarcolemmic
C. Protein
d. Glycogenic
Answer:
it might be C
Explanation:
Which of the following traits tend(s) to tie amphibians to wet or moist habitats? -small body size
-the amniotic egg
-tetrapod body form and lack of lungs
-moist skin and soft, unprotected eggs
The trait that tends to tie amphibians to wet or moist habitats is their moist skin and soft, unprotected eggs. This is because amphibians rely on their skin for respiration and they need a moist environment to keep their skin from drying out.
Additionally, their soft eggs need to be laid in water or a moist environment to prevent them from drying out as well. Small body size, the amniotic egg, and tetrapod body form and lack of lungs are traits that are more commonly associated with reptiles and do not necessarily tie amphibians to wet or moist habitats.
Amphibians are ectothermic vertebrates in the class Amphibia with four legs. The Lissamphibia family includes all living amphibians. The majority of species live in terrestrial, fossorial, arboreal, or freshwater aquatic ecosystems, though they can be found in a wide range of habitats.
Know more about amphibians, here:
https://brainly.com/question/31785803
#SPJ11
Match the rocks with the descriptions.
dark, dense _________________
light colored with mineral crystals _________________
most common rocks on earth's surface _________________
found under the oceans _________________
I WILL BRAINLIEST
Answer:
*dark, dense- igneous rocks(gabbro & basalt)
*light colored with mineral crystals- igneous rocks (Rhyolite)
*most common rocks on earth's surface-sedimentary rocks
*found under the oceans- igneous, sedimentary and metamorphic rocks (gabbro, basalt, serpentine, peridotite, olivine and ore minerals)
Please mark me brainliest
Answer:
imma need my points back
Explanation:
You are requested to implement a simple virus management system. " A virus is a submicroscopic infectious agent that replicates only inside the living cells of an organism. Viruses infect all life forms, from animals and plants to microorganisms, including bacteria and archaea." Viruses can be classified into various categories according to the Baltimore classification (see link for more details). Any virus can be identified by many fields including an official name, date when it was first discovered, who discovered, ... 1- (1 mark) Describe the virus and research Lab data types, Virus and ResearchLab, using Java classes. Make sure to use Java inheritance, an interface, and an abstract class. 2- (4 marks) We want to implement a simple application that manages the viruses stored in research Labs. You are asked to develop a Java application that uses an array to store all information regarding the viruses maintained in each research Lab and using the newly created data types: Virus and ResearchLab defined in 1). You should provide a menu with the following options: Virus Management System (CSC301, Fall2022) 1- Create a new Research Lab 2- Add a new Virus to a research Lab 3- List all research Labs storing a particular virus 4- Delete all existing viruses from a given a category in a research Lab 5- Check if a particular virus exists based on its official name 0- Quit Your choice? Please use the partial Java code provided with this assignment which prints the menu.
The virus data type can be implemented as a Java class with properties such as the official name, discovery date, and discoverer. The research lab data type can be implemented as a subclass of the virus class, inheriting its properties and methods.
To represent the virus data type in Java, we can create a Virus class that includes fields to store information such as the official name, discovery date, and discoverer. This class can serve as the base class for other virus-related classes.
For the research lab data type, we can create a ResearchLab class that extends the Virus class. This inheritance allows the ResearchLab class to inherit the properties and methods of the Virus class while also providing additional functionality specific to research labs.
Using Java inheritance, we can establish a hierarchical relationship where the ResearchLab class inherits the characteristics of the Virus class. This promotes code reuse and allows us to organize the codebase efficiently.
By implementing the virus and research lab data types using Java classes and inheritance, we can effectively represent and manage viruses and research labs in a structured manner within the virus management system.
To learn more about Java code, here
https://brainly.com/question/31569985
#SPJ4
alcohol has diuretic effects, increasing urine output. by which one of the following is this mediated? group of answer choices alcohol decreases the amount of sodium reabsorbed. alcohol makes the renal tubules more permeable to water. alcohol increases the amount of sodium reabsorbed. alcohol inhibits the release of adh. drinks with alcohol also contain a lot of water, and the kidneys excrete this.
The diuretic effects of alcohol that increase urine output are mediated by: alcohol inhibiting the release of ADH.
Alcohol has diuretic effects, which means that it leads to increased urine output. The concentration of urine becomes low due to the increase in urine output, which causes a decrease in the concentration of electrolytes in the body. The concentration of sodium decreases in the body, which can lead to dehydration.
Alcohol inhibits the release of ADH, an antidiuretic hormone, by the pituitary gland. This hormone is responsible for water reabsorption by the kidneys. When there is less ADH, more water is excreted in the form of urine, and less water is reabsorbed by the kidneys, which causes dehydration.
Drinks with alcohol also contain a lot of water, but the diuretic effects of alcohol can cause dehydration despite the water content. The increase in urine output is not mediated by decreasing the amount of sodium reabsorbed or increasing the amount of sodium reabsorbed, but by inhibiting the release of ADH.
You can learn more about diuretic effects at: brainly.com/question/31821292
#SPJ11
can someone help me with the ones that are blank i will give brainliest.
Answer:
Heritable - transmittable from parents of an organism to their offspring
Protein - genes provide the instructions to make these
Mutation - a slight change in an organism or population that is not normal
Gene - carried in the nucleus of a cell to determine what a cell makes
Resistance - the genetic ability of an organism to repel an attack to their survival
Which answer describes the tundra biome?
A) It is Earth's wettest biome.
B) It is Earth's largest biome.
C) It is Earth's least biodiverse biome.
D) It is Earth's driest biome.
15 points shall go to the noble hero who answers this question, Thank You :D
Answer: The correct answer is C) It is Earth's least biodiverse biome.
Explanation:
The tundra biome is Earth's least biodiverse biome, characterized by cold temperatures, low precipitation, and a short growing season. It has a harsh environment with frozen soil and limited vegetation, resulting in low species diversity.
What lab tools are present in the picture?
A.
ring stand, ring clamp, wire gauze, erlenmeyer flask, bunsen burner
B.
balance, beaker, tongs, filter paper, bunsen burner
C.
ring stand, tongs, watch glass, flint striker, erlenmeyer flask
D.
balance, beaker, wire gauze, hot plate, forceps
Answer:
the correct answer is A.
Lab tools present in the picture are ring stand, tongs, watch glass, flint striker, erlenmeyer flask.Thus, option C is correct.
What are the safety measures that should be taken in laboratory?There are several safety measures that should be taken while performing an experiment in lab such as avoid drink and food while working in laboratory and wear PPE kit to keep yourself safe.
Never work lonely in the lab because this condition will turn into danger situation as suppose a person works lonely and due to reaction of some chemical the person become unconsious than there is no one to help him.
Always wear gloves, PPE kit, proper shoes, lab coat of full sleeves with safety goggles. All these things will helps to keep a person safe in lab while experiment.
Therefore, Lab tools present in the picture are ring stand, tongs, watch glass, flint striker, erlenmeyer flask.Thus, option C is correct.
Learn more about safety measures in laboratory here:
brainly.com/question/17303366
#SPJ2
Climate change has a negative effect on biodiversity.
Answer:
True statement.
Explanation:
Climate change is the shift or abnormal change in climate patterns. As the planet warms quickly, mostly due to human activity, climate patterns in regions around the world will fluctuate. Ecosystems and biodiversity will be forced to fluctuate along with the regional climate, and that could harm many species.