The correct answer for the first question is a.)It is not exposed to the factor under consideration and all other external influences are held constant. The correct answer for the second question is b.) Randomization.
a. It is not exposed to the factor under consideration and all other external influences are held constant. The control group is used as a standard of comparison to determine the effect of the factor being tested, and therefore it cannot be exposed to the factor under consideration. However, all other external influences must be held constant to ensure that any differences in the results are due to the factor being tested.
The correct answer for the second question is b.) Randomization. Analyzing the results of rolling a fair die 100 times refers to the process of randomly assigning the die to each roll, which helps to ensure that the results are not biased and are representative of the population being studied. Replication refers to repeating the experiment multiple times to confirm the results, control refers to the group that is not exposed to the factor being tested, and treatment refers to the group that is exposed to the factor being tested.
Learn more about consideration here:
https://brainly.com/question/15445409
#SPJ11
prisha is doing some research on mites. she is amazed to find out that there are more than 60,000 identified mite species. some types, like dust mites, feed on dead skin cells, while others, like ear mites feed on ear wax and skin oils. while writing her research paper, prisha decides that even though mites are annoying parasites, they do perform a function in the world. prisha decides to focus on this for her paper. which title would prisha most likely chose for her assignment?
The appropriate title that Prisha would have to give to the paper would be: The Ecological Importance of Mites: An Exploration of their Role in Ecosystems".
What is a title paper?This is a term that is used to refer to the heading that a paper would carry. This helps to highlight what the paper would be for.
Prisha is focusing on the positive aspects of mites in her research paper, so a suitable title for her assignment could be "The Ecological Importance of Mites: An Exploration of their Role in Ecosystems". This title highlights the idea that mites have a purpose beyond being annoying parasites and suggests that they play a vital role in maintaining ecological balance.
Read more on skin cells here:https://brainly.com/question/2742203
#SPJ1
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
Please help. Worth 10 points.
Answer:
i think its the 2.
Explanation:
im sure of it. thinking of formulas.
Answer:
I think it is 3
Explanation:
Find the solution of the given initial value problem: (a) y
′
−y=2xe
2x
,y(0)=1 (b) y
′
+(cotx)y=2cscx,y(π/2)=1
(A) The answer to the initial value problem is given by \(\(y = (x^2 + 1)e^x\)\), where \(\(y' - y = 2xe^{2x}\)\) and \(\(y(0) = 1\)\).
(B) The resolution to the initial value problem can be expressed as \(\(y = \frac{2x - (\pi - 1)}{\sin(x)}\)\), where \(\(y' + \cot(x)y = 2\csc(x)\)\) and \(\(y\left(\frac{\pi}{2}\right) = 1\)\).
(A) To solve the initial value problem:
\(\[y' - y = 2xe^{2x}, \quad y(0) = 1\]\)
We can use an integrating factor method. To begin, let us express the equation in its standard form:
\(\[y' - y - 2xe^{2x} = 0\]\)
The integrating factor \(\(I(x)\)\) is given by \(\(I(x) = e^{\int -1 \, dx} = e^{-x}\)\).
To obtain the solution, apply the integrating factor to both sides of the equation and perform the multiplication.
\(\[e^{-x}(y' - y) - 2xe^{2x}e^{-x} = 0\]\)
This simplifies to:
\(\[e^{-x}y' - e^{-x}y - 2x = 0\]\)
Now, observe that the expression on the left-hand side represents the derivative of \(\((e^{-x}y)\)\) with respect to \(\(x\)\).
Using this observation, we can rewrite the equation as:
\(\[\frac{d}{dx}(e^{-x}y) - 2x = 0\]\)
Integrating both sides with respect to \(\(x\)\), we get:
\(\[e^{-x}y - \int 2x \, dx = C\]\)
where \(\(C\)\) is the constant of integration.
Integrating \(\(\int 2x \, dx\)\), we have:
\(\[e^{-x}y - x^2 + C = 0\]\)
To find the constant \(\(C\)\), we use the initial condition \(\(y(0) = 1\)\).
Substituting \(\(x = 0\)\) and \(\(y = 1\)\) into the equation, we get:
\(\[e^{0} \cdot 1 - 0^2 + C = 0\]\)
\(\[1 + C = 0\]\)
\(\[C = -1\]\)
Substituting \(\(C = -1\)\) back into the equation, we have:
\(\[e^{-x}y - x^2 - 1 = 0\]\)
Finally, we can solve for \(\(y\)\) by isolating it:
\(\[e^{-x}y = x^2 + 1\]\)
\(\[y = (x^2 + 1)e^x\]\)
(B) To solve the initial value problem:
\(\[y' + \cot(x)y = 2\csc(x), \quad y\left(\frac{\pi}{2}\right) = 1\]\)
We can use an integrating factor method. To begin, we will rewrite the equation in standard form:
\(\[y' + \cot(x)y - 2\csc(x) = 0\]\)
The integrating factor \(\(I(x)\)\) is given by:
\(\(I(x) = e^{\int \cot(x) \, dx} = e^{\ln(\sin(x))} = \sin(x)\).\)
Apply the integrating factor to both sides of the equation and perform the multiplication.
\(\[\sin(x)(y' + \cot(x)y) - 2\csc(x)\sin(x) = 0\]\)
This simplifies to:
\(\[\sin(x)y' + \cos(x)y - 2 = 0\]\)
Now, observe that the expression on the left-hand side represents the derivative of \(\((\sin(x)y)\)\) with respect to \(\(x\)\). Using this observation, we can rewrite the equation as:
\(\[\frac{d}{dx}(\sin(x)y) - 2 = 0\]\)
Integrating both sides with respect to \(\(x\)\), we get:
\(\[\sin(x)y -\)\(\int 2 \, dx = C\]\)
where \(\(C\)\) is the constant of integration. Integrating \(\(\int 2 \, dx\)\), we have:
\(\[\sin(x)y - 2x + C = 0\]\)
To find the constant \(\(C\)\), we use the initial condition \(\(y\left(\frac{\pi}{2}\right) = 1\).\)
Substituting \(\(x = \frac{\pi}{2}\)\) and \(\(y = 1\)\) into the equation, we get:
\(\[\sin\left(\frac{\pi}{2}\right) \cdot 1 - 2\left(\frac{\pi}{2}\right) + C = 0\]\)
\(\[1 - \pi + C = 0\]\)
\(\[C = \pi - 1\]\)
Substituting \(\(C = \pi - 1\)\) back into the equation, we have:
\(\[\sin(x)y - 2x + (\pi - 1) = 0\]\)
Finally, we can solve for \(\(y\)\) by isolating it:
\(\[\sin(x)y = 2x - (\pi - 1)\]\)
\(\[y = \frac{2x - (\pi - 1)}{\sin(x)}\]\)
\(\(y = \frac{2x - (\pi - 1)}{\sin(x)}\).\)
To learn more about initial value problem follow the link
https://brainly.com/question/30503609
#SPJ4
The complete question is:
Find The Solution Of The Given Initial Value Problem:
(A) \(\(y' - y = 2xe^{2x}\)\), and \(\(y(0) = 1\)\)
(B) \(\(y' + \cot(x)y = 2\csc(x)\)\), and \(\(y\left(\frac{\pi}{2}\right) = 1\)\)
What is the function of the chloroplasts?
Answer:
I think I iver explained it but here
Explanation:
Chloroplasts are organelles that conduct photosynthesis, where the photosynthetic pigment chlorophyll captures the energy from sunlight, converts it, and stores it in the energy-storage molecules ATP and NADPH while freeing oxygen from water in plant and algal cells.
A chloroplast is an organelle inside the cells of plants and certain green growth that is the site of photosynthesis.
Functions of chloroplast:Chloroplasts permit plants to catch the energy of the Sun in energy-rich atoms. The cell dividers permit plants to have unbending designs as fluctuated as wood trunks and flexible leaves, and vacuoles permit plant cells to change size.
Find more information about Chloroplast here:
brainly.com/question/13650763
are males more likely to have hypophosphatemia than females explain
Answer:
Males are more likely to have hypophosphatemia.
Explanation:
In females, a mutation would have to happen in both copies of the genes to cause the disorder. It is rare having females with 2 altered copies of this gene. Males are X-linked by recessive disorders much more frequently then females.
What is the maximum volume of blood that can be collected form a 110-lb donor, including samples for processing? A 450mL. B 500mL. C 525mL. D 550mL
The maximum volume of blood that can be collected from a 110-lb donor, including samples for processing, is typically limited to around
c. 525mL, or slightly less than 2 pints called maximum blood volume
This is known as the "maximum blood volume" or "maximum blood draw" limit, and it is established to minimize the risk of adverse effects, such as lightheadedness, fainting, or low blood pressure. The maximum blood volume is calculated based on various factors, including the donor's weight, height, and overall health. The amount of blood that can be collected also depends on the specific procedures being performed, as well as the presence of any underlying medical conditions that may affect the donor's ability to tolerate the blood draw. Overall, it is important to follow established guidelines and protocols when collecting blood from donors to ensure the safety and well-being of the donor.
Learn more about maximum blood volume here:
https://brainly.com/question/30328660
#SPJ4
A technical term for fat is:
A) cartilage
B) epithelial tissue
C) tendons
D) adipose tissue
Adipose tissue :) I hope that helps and all please awnser one of my questions!
The diagram below represents a cycling of materials.
X
Human
Y
Plant
a Identify what molecules letter X represents and give the name of the process
responsible for synthesizing these molecules.
Letter X represents carbon dioxide molecules, which are synthesized through the process of photosynthesis.
What is molecues?Molecules are the smallest physical unit of a substance that can exist on its own and retain its chemical characteristics. Molecules are made up of two or more atoms that are held together by chemical bonds. These bonds can be either covalent, in which electrons are shared between atoms, or ionic, in which one atom takes an electron from another atom.
Letter X represents carbon dioxide molecules, which are synthesized through the process of photosynthesis. Photosynthesis is a process in which light energy is used by plants to convert carbon dioxide and water into oxygen and glucose. This process is essential for life on Earth, as it provides the oxygen necessary for respiration.
b Identify what molecules letter Y represents and give the name of the process
responsible for breaking down these molecules
Letter Y represents glucose molecules, which are broken down through the process of cellular respiration. Cellular respiration is a process in which glucose molecules are broken down by cells to release energy in the form of ATP (adenosine triphosphate). This energy is then used by cells to carry out their essential functions.
To know more about molecules click-
https://brainly.com/question/13348791
#SPJ1
1. Compare gaseous biogeochemical cycle and sedimentary biogeochemical cycle.
Answer:
Gaseous cycles include those of nitrogen, oxygen, carbon, and water; sedimentary cycles include those of iron, calcium, phosphorus, and other more earthbound elements. In a sedimentary cycle elements move from land to water to sediment. Main reservoirs are the soil and sedimentary rocks.
During an experiment, a scientist crosses a pea plant that has purple flowers with a pea plant that has white flowers. The plants that result from this cross in the F1 generation have both purple and white flowers. What can the scientist conclude?
White flowers are dominant over purple flowers.
Neither purple flowers nor white flowers are dominant.
At least one of the plants in the P generation were not true-breeding.
All the plants in the F2 generation will have purple flowers.
The scientist can conclude that at least one of the plants in the P generation was not true-breeding, resulting in the expression of both purple and white flower colors in the F1 generation. The outcome in the F2 generation cannot be determined based on the information provided, as it would depend on the genetic makeup of the F1 plants and whether they undergo further crossbreeding.
Based on the information provided, the scientist can conclude that at least one of the plants in the P generation was not true-breeding.
In this scenario, the scientist crossed a pea plant with purple flowers (referred to as the P generation) with a pea plant with white flowers. The resulting plants in the F1 generation (first filial generation) exhibit both purple and white flowers. This indicates that the purple flower trait did not completely dominate over the white flower trait, nor did the white flower trait completely dominate over the purple flower trait.
If both the purple and white flower traits were fully dominant or recessive, the plants in the F1 generation would only exhibit one of the flower colors, not a combination of both. The presence of both purple and white flowers in the F1 generation suggests that the traits for flower color in the P generation were not true-breeding, meaning they were not consistently passing on the same trait to all their offspring.
Therefore, the scientist can conclude that at least one of the plants in the P generation was not true-breeding, resulting in the expression of both purple and white flower colors in the F1 generation. The outcome in the F2 generation cannot be determined based on the information provided, as it would depend on the genetic makeup of the F1 plants and whether they undergo further crossbreeding.
For more question on crossbreeding
https://brainly.com/question/10880595
#SPJ8
4. Cystic fibrosis is a homozygous recessive condition that affects 1 in 10,000 of the Hispanic population
in the United States. Calculate the frequency of the dominant allele, the frequency of the recessive
allele, and the percentage of heterozygous individuals (carriers) in the Hispanic population.
Frequency of the
dominant allele
Frequency of the
recessive allele
% homozygous dominant
% homozygous recessive
% heterozygous
One in 10,000 people who identify as Hispanic have cystic fibrosis. The frequency of the dominant allele is 10-9, or 0.01%; that of the recessive allele is 1-0, or 100%; and the proportion of heterozygous people (carriers) is 9-0, or 100%.
In a Hardy-Weinberg population, what does 16% of the population have?There are only two eye colors in a population that is in Hardy-Weinberg equilibrium: brown (dominant) and blue. (recessive). The population's blue eye percentage is 16%.
What is the allele frequency formula?The Hardy-Weinberg equation, p2 + 2pq + q2 = 1, describes allele frequency and how these alleles are divided into genotypes within a population. The three variables p2, 2pq, and q2 represent the genotypes, whereas the two variables p and q stand in for the alleles.
To know more about cystic fibrosis visit:-
https://brainly.com/question/30754172
#SPJ1
What structure connects the right and left cerebral hemispheres?
Intermediate mass
Vermis
Septum pellucidum
Corpus callosum
Corpus callosum connects the right and left cerebral hemispheres.
The right and left brain hemispheres are connected by the extensive fibre tract of axons known as the corpus callosum.
White matter fibres that connect the left and right cerebral hemispheres make up the principal commissural region of the brain, known as the corpus callosum.
Your brain's two hemispheres are joined by a substantial network of nerve fibres known as the corpus callosum, which permits communication and signal transmission between the two sides of the brain.
Learn more about Corpus callosum from:
https://brainly.com/question/28901684
#SPJ4
How are humans circulatory system similar and different to other animals
Answer:
Humans have a heart with two atria and two ventricles that pushes blood in one direction. Some animals have hearts similar to humans but, other animals have only one atrium and one ventricle or a cardiovascular system that can push blood in two directions.
Humans circulatory system is similar due to presence of artrium and ventricles and different to other animals due to number of heart chambers.
How human circulatory system similar and different to other animals?Humans have a heart with two atria and two ventricles that prevents bactward flow of blood. Some animals have hearts similar to humans but, other animals have only one atrium and one ventricle that can push blood in two directions.
So we can conclude that Humans circulatory system is similar due to presence of artrium and ventricles and different to other animals due to number of heart chambers.
Learn more about circulatory system here: https://brainly.com/question/2107209
Please answer thanks
grass goes first then insects then Meerkats
the sry gene on the y sex chromosome triggers the synthesis of
The SRY (sex-determining region Y) gene, which is located on the Y chromosome, is responsible for triggering the synthesis of a protein known as testis-determining factor (TDF).
This protein is crucial for the development of male sex characteristics and the formation of the testes during embryonic development. The long answer to your question involves understanding the complex genetic mechanisms that regulate sexual development in humans and other animals, including the roles of hormones, signaling pathways, and other genetic factors.
While the SRY gene is a key player in this process, there are many other genes and factors that also contribute to sex determination and differentiation, making this a fascinating and ongoing area of research in developmental biology.
To know more about chromosome visit:-
https://brainly.com/question/30077641
#SPJ11
what are the 4 different bases in dna and how do they pair?
Answer:
Attached to each sugar is one of four bases--adenine (A), cytosine (C), guanine (G), or thymine (T). The two strands are held together by hydrogen bonds between the bases, with adenine forming a base pair with thymine, and cytosine forming a base pair with guanine.
What term is used for the muscles and glands whose activities are controlled by nervous activity?
explain why a plant is likely to wither if too much fertilizer is applied to it.
Science , grade 8
Which of the following is not a product of the electron transport chain?
A. NAD+
B. Oxygen
C. ATP
D. FAD
E. Water
The product of the electron transport chain that is not listed is: A. NAD+
During the process of oxidative phosphorylation, which occurs in the electron transport chain, electrons are transferred along a series of protein complexes embedded in the inner mitochondrial membrane. This electron flow ultimately leads to the production of ATP, which is the energy currency of the cell.
B. Oxygen is the final electron acceptor in the electron transport chain. It accepts electrons and combines with protons to form water (E), which is an essential product of this process.
C. ATP is synthesized through chemiosmosis, driven by the electron flow in the electron transport chain. It is a direct product and serves as the main energy source for cellular processes.
D. FAD (flavin adenine dinucleotide) is a coenzyme that carries electrons in the electron transport chain, similar to NADH. While FAD is not directly listed as a product, it participates in the electron transfer reactions.
A. NAD+ is not a product of the electron transport chain but rather a coenzyme that functions as an electron carrier. NAD+ accepts electrons during glycolysis and the citric acid cycle, and it is then reduced to NADH. NADH, in turn, donates electrons to the electron transport chain for ATP synthesis.
Overall, the electron transport chain produces ATP, water, and NADH as important products, while NAD+ is not directly produced but rather participates in the electron transfer reactions.
To learn more about electron transport chain, here
https://brainly.com/question/24372542
#SPJ4
How does nitrogen get into the air
PLEASE HELP
What happens to your eyes when they are exposed to light? To darkness?
NO COPY AND PASTE!11!!!!!!1!11
Answer:
Your pupils adjust to the amount of light that they are receiving.
When it is dark, then enlarge. When it is light, they shrink.
Explanation:
food provides energy when it is broken down by a chemical change known as?
(Answer: Metabolism)
Part I Illuminating Photosynthesis #1 : Fill in this concept map depicting the major steps in photosynthesis in the chloroplast H20 of Photosystem I transfers Word Bank Electron Transport Chain ATP Synthase Calvin Cycle Light NADPH Chlorophyll Protons CO2 Photosystem II Electrons 02 to produce ATP G3P (Sugar Building Block) #2 : Fill in the table: Major Steps in Does this step depend on Experimental variable to What would happen if an Photosynthesis any other step? How? measure? herbicide disrupted this Photosystem II Photosystem l ATP Synthase Calvin Cycle
Photosynthesis in chloroplasts involves major steps such as light absorption, electron transport, ATP synthesis, and carbon fixation. It begins with light-dependent reactions in photosystems I and II, followed by electron transport and ATP synthesis.
Step 1: Photosynthesis is a complex process that occurs in the chloroplasts of plants, involving several major steps such as light absorption, electron transport, ATP synthesis, and carbon fixation.
Step 2:Photosynthesis is the process by which plants, algae, and some bacteria convert light energy into chemical energy in the form of glucose. It occurs in the chloroplasts, specifically in three main stages: light-dependent reactions, electron transport chain, and the Calvin cycle.
During the light-dependent reactions, light energy is absorbed by chlorophyll molecules in photosystem II (PSII) and photosystem I (PSI). In PSII, water molecules are split, releasing electrons, protons (H+ ions), and oxygen. The electrons move through an electron transport chain, creating a proton gradient across the thylakoid membrane. This gradient is essential for ATP synthesis by ATP synthase, using the energy from the electron flow.
In PSI, electrons are re-energized by absorbing more light energy and are ultimately used to produce NADPH, another energy carrier. The ATP and NADPH generated in the light-dependent reactions are then used in the Calvin cycle.
The Calvin cycle, also known as the light-independent reactions or carbon fixation, occurs in the stroma of the chloroplast. It uses ATP, NADPH, and carbon dioxide (CO2) to produce glucose (G3P), which serves as a building block for sugars and other organic compounds. The cycle regenerates the starting molecule, ribulose bisphosphate (RuBP), allowing the process to continue.
Learn more about Photosynthesis:
brainly.com/question/29764662
#SPJ11
What is the most significant limitation that Carl Schurz's work has as a resource for a historian?
A. Schurz was too young to be a reliable witness.
B. Schurz was not an eyewitness to the events he describes.
C. Schurz wrote his account about fifty years after the events occurred.
D. Schurz was a government official likely biased against the revolution.
Answer is C. Schurz wrote his account about fifty years after the events occurred
The most significant limitation that Carl Schurz's work has as a resource for a historian is that he wrote his account about fifty years after the events occurred.
Carl Christian Schurz was an American statesman, author, and reformer. He immigrated to the United States after the German Revolution of 1848 and quickly rose to prominence within the newly formed Republican Party. He wrote a number of works, such as his Reminiscences (1907–09), a volume of talks, and a two-volume biography of Henry Clay (1887). According to the inquiry, his work is limited by the time interval between the actual incident and the time he ultimately wrote it down.
Because a good eyewitness account necessitates documenting events as they happen, this was a significant limitation. The narratives of occurrences are typically more accurate and in-depth when they are recorded according to how they occur.
To learn more about Carl Schurz visit: https://brainly.com/question/28603655
#SPJ1
Explain how and why water travels through the four Earth systems as it moves through the water cycle.
Explanation:
It is a complex system that includes many different processes. Liquid water evaporates into water vapor, condenses to form clouds, and precipitates back to earth in the form of rain and snow. Water in different phases moves through the atmosphere (transportation).
if you come across a child with swollen face hands and feet thin upper arms and weak muscles what would you primary advise the parents based on your biology knowledge?
Answer:
I will tell them to take care of their child
Explanation:
HOPE IT HELPS!
Help with whatever yk plzzzzz!!!!! ‼️‼️‼️‼️‼️
Answer:
Triglycerides are lipid compounds composed of a glycerol esterified to 3 fatty acid chains of varying length and composition.
fat molecules yield more energy than carbohydrates and are an important source of energy for the human body.
Explanation: this is all I know, hope it helps :)
Someone helm me asap pls I'm on a quiz!!!
Pick the correct match.
Animal cell / plant cell
no cell wall, only plasma membrane: Animal cell / plant cell
no large vacuole, only small ones: Animal cell / plant cell
no chlorophyll or chloroplasts: Animal cell / plant cell
cell plate and no centrioles in cell division: Animal cell / plant cell
cleavage furrow plus centrioles in cell division: Animal cell / plant cell
presence of cell wall plus plasma membrane: Animal cell / plant cell
large hypertonic vacuole: Animal cell / plant cell
chloroplasts: Animal cell / plant cell
no cell wall, only plasma membrane: Animal cell
no large vacuole, only small ones: Animal cell
no chlorophyll or chloroplasts: Animal cell
cell plate and no centrioles in cell division: Plant cell
cleavage furrow plus centrioles in cell division: Animal cell
presence of cell wall plus plasma membrane: Plant cell
large hypertonic vacuole: Plant cell
chloroplasts: Plant cell
Animal cells and plant cells have distinct characteristics that differentiate them from each other.
Animal cells do not have a cell wall but are surrounded by a plasma membrane that maintains the cell's shape and provides protection.
On the other hand, plant cells possess a cell wall in addition to the plasma membrane. The cell wall provides structural support and protection for the plant cell.
Plant cells typically contain a large central vacuole, which helps regulate cell turgidity and store water, ions, and other substances. In contrast, animal cells may have smaller vacuoles or several small ones.
Chlorophyll and chloroplasts are responsible for photosynthesis in plant cells, allowing them to convert sunlight into energy.
Animal cells do not possess chlorophyll or chloroplasts since they obtain energy through other means such as respiration.
During cell division, plant cells form a cell plate that eventually develops into a cell wall, while animal cells undergo cell division through the formation of a cleavage furrow.
Plant cells also lack centrioles, which are present in animal cells and play a role in organizing the spindle fibers during cell division.
For more such answers on animal and plant cell
https://brainly.com/question/913732
#SPJ11
13. What are the products of cellular respiration that are needed for photosynthesis?
sugar and oxygen
carbon dioxide and water
water and sugar
energy and oxygen
Answer:
Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.