which of the following statements is/are correct about the cortisol pathway? question 1 options: a. cortisol is secreted by cells in the adrenal medulla b. cells of the anterior pituitary gland express cortisol receptors (i.e., glucocorticoid receptors) c. a decrease in cortisol causes a decrease in acth. d. (a) and (b) are correct; (c) is incorrect e. (a), (b), and (c) are all correct

Answers

Answer 1

The correct statement about the cortisol pathway is: (c) a decrease in cortisol causes a decrease in ACTH.

Cortisol is secreted by cells in the adrenal cortex, not the adrenal medulla as stated in option (a). Cells of the anterior pituitary gland express cortisol receptors (glucocorticoid receptors) which are involved in negative feedback control of the hypothalamic-pituitary-adrenal (HPA) axis, where cortisol exerts its effects by suppressing the release of corticotropin-releasing hormone (CRH) and adrenocorticotropic hormone (ACTH). Therefore, option (b) is correct.

Option (c) is also correct because a decrease in cortisol levels would lead to a decrease in negative feedback on the HPA axis, resulting in increased release of ACTH. Hence, the correct option is (c).

Learn More about cortisol

https://brainly.com/question/1059659

#SPJ4


Related Questions

Which is evidence for the existence of dark energy?

Black holes that are expanding at a constant rate.

Pulsars that seem to be moving closer at an accelerating rate.

Supernovae that are moving away at an accelerating rate.

Galaxies that are rotating at a constant rate.

Answers

Answer:Supernovae that are moving away at an accelerating rate.

Explanation:

took test

Answer:

Supernovae that are moving away at an accelerating rate.

Explanation

i took the quick check

which is not a significant cause of the current mass extinction event? invasive species overharvesting habitat destruction extreme weather events

Answers

Invasive species is not a significant cause of the current mass extinction event.

Extinction is the final phase of a sort of creature or a taxon—typically a species. Although the ability to reproduce and bounce back may have been lost earlier, the death of the last member of the species is typically considered to be the moment of extinction. Determining this point is challenging because a species' potential range may be quite wide, and is typically done after the fact. Due to this problem, there are phenomena like Lazarus taxa, in which a species that was thought to be extinct suddenly "reappears" after a period of apparent absence (usually in the fossil record).

To know more about mass extinction, click here,

brainly.com/question/8146693

#SPJ4

how does the intestinal mucosa prevent the development of food allergies mounted against innocuous food antigens? group of answer choices it has several tolerogenic (aka immunosuppressive) mechanisms that inhibit immune activation to non-infectious material there are no adaptive immune cells (t or b cells) in the intestine no antibodies can cross the intestinal epithelium to initiate complement signaling all food antigens are broken down into individual atoms before reaching the intestine

Answers

There are no adaptive immune cells (t or b cells) in the intestine .

In general, the epithelial cells transport antibodies, particularly IgA, into the intestinal lumen and these specialized antibodies helps to contribute and act as a  barrier by excluding the uptake of antigens or microbes.

So, in order to prevent a food allergy reaction it is required to completely avoid the food and any product that may contain any such ingredient. Intolerant Food never trigger the immune system and also not considered life threatening, although it may cause similar symptoms like diarrhea and stomach pain.

To learn more about  adaptive immune cells , here

brainly.com/question/29659134

#SPJ4

What happens to the surface are as the cubes get larger?

Answers

Answer:

As a cell grows bigger, its internal volume enlarges and the cell membrane expands. Unfortunately, the volume increases more rapidly than does the surface area, and so the relative amount of surface area available to pass materials to a unit volume of the cell steadily decreases.

Explanation:

the surface area to volume ratio - SA:V ratio decreases.

once a potato is placed in a more and more hypotonic solution it gains less and less weight. this is called turgor pressure. explain what is happening with respect to the water molecules and cell walls of the plant?

Answers

Once a potato is placed in a more and more hypotonic solution, it gains less and less weight because the amount of solute inside the potato is moved into the solution to reach equilibrium.

A hypotonic solution is a kind of solution which has lower solute concentration than the one being compared with, here potato. As per the query, potato is placed in a hypotonic solution. This means that the potato has a larger solute concentration than this hypotonic solution. Now, both the concentrations would try to reach equilibrium in both of their, solute and solvent, aspects. Thus, the potato becomes lighter as the amount of its solute is moved into the solution.

This happens as follows: water molecules cluster around solutes, pushing them away, allowing more water molecules to enter the region of concentration. As a result, adding a hypotonic solution to a hypertonic solution will cause the mixture to experience highs and lows in concentration at first before quickly coming to equilibrium.

To know more about hypotonic solutions, refer:

https://brainly.com/question/25262148

#SPJ4

The typical order for the major steps of enzyme isolation would be (from first to last)?

Answers

Homogenization, salt fractionation, column chromatography, electrophoresis.

Monitoring the process at each stage by identifying particular activity and carrying out an SDS-PAGE analysis can help you establish whether a protein purification strategy is successful. The following variables are monitored at each step:

Entire protein: The amount of protein in a fraction is calculated by multiplying the protein concentration of a portion of each fraction by the total volume of the fraction.

Entire activity: The enzyme activity in the volume of the fraction utilized in the experiment is calculated by multiplying the enzyme activity by the total volume of the fraction.

For instance, if protein purification procedures like homogenization, salt fractionation, Ion Exchange chromatography, Gel filtering, and Affinity chromatography are used.

Here is another question with an answer similar to this about enzyme isolation: https://brainly.com/question/28099551

#SPJ4

what is known as function

Answers

Answer:

Function, in mathematics, an expression, rule, or law that defines a relationship between one variable (the independent variable) and another variable (the dependent variable).

help i think its D.
Which statement best represents how structure relates to function?

A. Bald eagles primarily prey upon fish.
B. Domestic dogs come in a variety of coat colors and types.
C. Sea turtles can live up to fifty years or more.
D. Sharp, powerful claws allow a falcon to firmly grasp prey or a branch.

Answers

Answer:

D. Sharp, powerful claws allow a falcon to firmly grasp prey or a branch.

Explanation:

what is oscillioric tube

Answers

Answer:

an electronic tube for converting the energy of a DC or AC source into the energy of electrical oscillations. Oscillator tubes are used in radiotransmitters of various designations, measuring devices, radioelectronic devices of experimental physics and medicine, induction heating devices, and the like.

an electronic tube for converting the energy of a DC or AC source into the energy of electrical oscillations.

A characteristic that causes ocean jellies to be classified into the phylum Cnidaria is the presence of

Answers

Presence of intercellular connection?

Please help.


There is a species of frog on an island that puzzles scientists. The proportion of frogs with no stripes is greater than the proportion of frogs with stripes. This is puzzling because the unstriped trait is recessive (s), and the striped patterns are due to dominant alleles (S). Also, natural selection seems to support the striped trait.
How do genetic factors most likely account for the proportion of traits in the frog population?

A. Most of the striped frogs and unstriped frogs have the genotype ss.


B. Most of the striped frogs have the genotype SS and the unstriped frogs have the genotype ss.


C. Most of the striped frogs have the genotype SS and the unstriped frogs have the genotype Ss.


D. Most of the striped frogs have the genotype Ss and the unstriped frogs have the genotype ss.

Answers

The answer is D (further explanation in the comments)

What is the site on ribosome where aminoacyl tRNA enters?

Answers

The site on ribosome where the aminoacyl t-RNA enters is: the A site.

Ribosome is the subcellular component of the cells. It can be found in prokaryotic and as well as eukaryotic cells. The ribosome is a nucleoprotein which is responsible for the synthesis of proteins inside the cell. Most of the ribosomes are present in the cell's cytoplasm.  

A site on ribosome stands for the aminoacyl site. It is the binding site for the charged t-RNAs called aminoacyl t-RNA. All the t-RNAs can bind here except for the first starting t-RNA of the protein chain. There are two other sites on the ribosome called P-site and E-site.

To know more about ribosome, here

brainly.com/question/1604076

#SPJ4

Performing+intervals+of+2+minutes+of+80%+(work+phase)+intensity+followed+by+2+minutes+of+40%+intensity+(recovery+phase)+primarily+target+which+metabolic+energy+system?

Answers

Performing intervals of 2 minutes of 80% work phase intensity followed by 2 minutes of 40% intensity  recovery phase primarily target which metabolic energy system?

Glycolysis

a little summary how ultraviolet light could be the answer to the future outbreak
( Two paragraphs).

Answers

Ultraviolet light can be the answer to future outbreaks because it has the capability to kill the microorganisms present in air and thus can prevent the infectious diseases caused by them.

Ultraviolet light is the EM radiation with the wavelength range 10 nm to 400 nm. It is already being used in research labs for maintaining the microbe free environment. Researches are also being conducted to produce such ceiling lights that can be used normally in households so that the the air-borne microorganisms can be killed.

Microorganisms are the small living organisms not visible to the unaided eyes. They have the strong capability to produce their new variants by mutation and cause infectious diseases. The ultraviolet light can kill them even before they are able to transform themselves.  

To know more about microorganisms, here

brainly.com/question/14754874

#SPJ1

♡ Observations... ! I NOTICE... ? I wonder... Think = Reminds me of...

Answers

Answer:

???? whats this and where is the image

Describe the role that rivers and streams play in the water cycle.​

Answers

Rivers and streams carry water, and pick up runoff water after precipitation. Rivers and streams are a source of water to be evaporated into clouds.

8. In pea plants, purple (P) flower color is dominant to
white (p) flowers, and yellow (Y) seeds are dominant to
green (y) seeds. Flower color and seed color are inherited
independently. A cross is done between two plants of
unknown genotypes and the results of the F, generation
are analyzed.
Purple/yellow
0
Purple/green
0
White/yellow
321
White/green
101
Sh
You notice right away that all offspring are white. You
then notice that the yellow: green ratio is approximately
3:1. Knowing this, determine the parental genotypes.

Answers

As the yellow: green ratio is approximately 3:1, the genotype of the parents will be PYPy and PYpy.

What is genotype?

The genotype of an individual is their own DNA pattern. More specifically, the two alleles a person acquired for a particular gene are referred to by this phrase.

The clinical presentation of a patient is the observable expression of this genotype, or phenotype.

You immediately see that all of the progeny are white. The yellow to green ratio is then shown to be roughly 3:1. Given this, the parents' genotypes will be PYPy and PYpy.

Thus, this is the genotype of the parents.

For more details regarding genotype, visit:

https://brainly.com/question/12116830

#SPJ1

Which layer appears to be the least resistant to
weathering?

Which layer appears to be the least resistant toweathering?

Answers

Answer:

A

Explanation:

A is at the top therefore would be most affected by the weathering

its not that hard 20 points! im just too lazy
Ferns have _____.
A.nonvascular tissue and no seeds
B.vascular tissue and no seeds
C.nonvascular tissue and seeds
D.vascular tissue and seeds

Answers

Answer:

I think the answer is gonna be b

Answer:

B

Explanation:

it is correct because I did it

So now this is an easy question.
\({\huge{\underline{\small{\mathbb{\pink{REFER \ TO \ THE \ ATTACHMENT}}}}}}\).
NOTE: Need perfect answers.​

So now this is an easy question. [tex]{\huge{\underline{\small{\mathbb{\pink{REFER \ TO \ THE \ ATTACHMENT}}}}}}[/tex].NOTE:

Answers

Your answer will be option C. They are static.

Option A and B are true because mitochondria have their own DNA known as mitochondrial DNA. Also, they make some of their own proteins because they have their own DNA and ribosomes. So they are also called semi-autonomous organelles.

They are not static because their structure changes every few seconds.

Hope it helps.

Do comment if you have any query.

What configuration do atoms usually take by forming covalent bonds?

Answers

Electron sharing occurs so that atoms attain the configurations of noble gases

What makes sperm and testosterone

Answers

Answer:

your brain makes special hormones called GnRH, and these hormones signals the testes to make more testosterone.

Explanation:

i hoped this helped:)

Bad weather is normally associated with_.

Answers

Answer:

Dropping Air Pressure

Explanation:

pls Rate And Brainlist

Use your knowledge of science to answer the questionSelect the three correct answers

Use your knowledge of science to answer the questionSelect the three correct answers

Answers

They give us the following statements

A) Glucose is broken down into carbon dioxide and water.

This statement would be correct if we are talking about cell respiration because glucose and oxygen produce carbon dioxide, water, and energy in that reaction.

B) Energy is stored in the bonds of ATP.

Describe at least 4 concepts learned this unit in genetics. Explain why each concept is important. (Digital biology 10th grade)

Answers

Transcription and gene regulatory networks. coding and noncoding RNA mechanisms of action and function. protein synthesis are 4 concepts learned this unit in genetics.

What is genetics?

The study of genes and heredity, or how particular characteristics or traits are passed from parents to offspring as a result of changes in DNA sequence, is known as genetics. A gene is a section of DNA that has the instructions needed to create one or more molecules that support bodily function. A double helix, or corkscrew-shaped ladder, is how DNA is shaped. The bases are pairs of the four building blocks adenine, thymine, guanine, and cytosine, and the two ladder rails are referred to as the backbones. The instructions for constructing molecules, the majority of which are proteins, are included in the sequences of these nucleotides. According to researchers, there are around 20,000 genes in humans.

Read more about genetics:

https://brainly.com/question/12111570

#SPJ1

Un carnera de lana negra se cruza con una oveja de lana blanca y tienen al menos un cordero de lana negra. El canero tiene las orejas largas y la oveja las tiene cortas. Sabiendo que el color de la lana sigue una herencia dominante para el color blanco y que esta especie puede tener las orejas Cortas, medianas o largas (herencia intermedia), deduce qué fenotipos se esperan en la F1 y su proporción. Cuadro de punnett necesito?

Answers

Answer:

Fenotipos de la F1: 50% de la progenie muestra orejas medianas y lana blanca, mientras que el otro 50% muestra orejas medianas y lana negra. En este caso en particular, el cuadro de Punnett no es necesario pero resulta de gran utilidad para visualizar la cruza.

Explanation:

Datos disponibles:

El color de la lana sigue una herencia dominante para el color blancoEsta especie puede tener las orejas cortas, medianas o largasCruza: carnero de lana negra y orejas largas X oveja de lana blanca y orejas cortasProgenie: al menos un ejemplar con lana negra

Podemos suponer que para el gen determinante del color de lana, el alelo dominante L determina lana blanca, mientas que el alelo recesivo l determina lana negra. También podemos suponer que para el gen que determina la longitud de las orejas, el genotipo LL expresa orejas largas, el genotipo Ll expresa orejas medianas, y ll expresa orejas cortas por tratarse de herencia intermedia. Entonces:

B--> Lana Blanca

b --> Lana Negra

LL --> Orejas largas

Ll --> Orejas medianas

ll --> Orejas cortas

Cruza: carnero de lana negra y orejas largas X oveja de lana blanca y orejas cortas

Puesto que en la progenie habia por lo menos un ejemplar con lana de color negro, podemos suponer que la oveja era heterozigota para la caracterítica en cuestión, ya que es la única forma de obtener un genotipo recesivo en la F1.

Parentales)   bb LL           x        Bb ll

Gametos) bL, bL, bL, bL          Bl, bl, Bl, bl

Cuadro de Punnet)   Bl        bl        Bl       bl

                     bL      BbLl     bbLl    BbLl   bbLl

                     bL      BbLl     bbLl    BbLl   bbLl

                     bL      BbLl     bbLl    BbLl   bbLl

                     bL      BbLl     bbLl    BbLl   bbLl

F1) Genotipo: 8/16 BbLl

                      8/16 bbLl

    Fenotipo: 8/16 o 50% animales de lana blanca

                      8/16 o 50% animales de lana negra

                      16/16 o 100% animales de orejas medianas

Posiblemente no sea necesario utilizar un cuadro de Punnet con la cruza mencionada. Sabiendo los genotipos paterno y materno es posible determinar las proporciones fenotipicas de la F1 sin realizar el cuadro de Punnet.

Para longitud de orejas se puede deducir que todos los ejemplares en la F1 serian heterocigotos, expresando orejas medianas. Esto se debe a que la cruza ocurre entre un homocigota dominante y un homocigota recesivo para esta característica.En tanto que para la caracteristica del color de lana se podria asumir que la mitad sería blanca y la otra mitad negra, puesto que la cruza es entre un homocigota recesivo y un heterocigota.

Aun así, mientras haya pocos genes dialélicos involucrados en la cruza, el uso del cuadro de Punnet siempre resulta útil para una mejor visualización de la cruza.

based on the five components of a corporate socially responsible strategy depicted in figure 9.2 in chapter 9, is nestlé’s strategy socially responsible? explain. The Five Components of a Corporate Social Responsibility Strategy Actions to ensure the company operates honorably and ethically Actions to promote workforce diversity Actions to support philanthropy, community service, and better quality of life worldwide A Company's Corporate Social Responsibility Strategy Actions to enhance employee well-being and make the company a great place to work Actions to protect and sustain the environment

Answers

To decide if Nestlé's method is socially responsible primarily based on the five components of a corporate social responsibility (CSR) strategy, we need to assess its movements in each region: Actions to ensure the employer operates honorably and ethically, Actions to sell team of workers variety, Actions to support philanthropy, community carrier, and higher quality of existence worldwide, Actions to enhance employee well-being and make the organization a tremendous vicinity to work, and Actions to defend and maintain the environment

Actions to ensure the employer operates honorably and ethically: Nestlé's commitment to operating ethically is reflected in its Code of Business Conduct, which outlines ideas together with integrity, honesty, and transparency. The business enterprise has implemented various tasks to make certain moral behavior across its operations.

Actions to sell team of workers variety: Nestlé recognizes the significance of the body of workers variety and has implemented applications to foster inclusion and diversity in its group of workers. The organization has initiatives centered on gender stability, cultural variety, and identical possibilities.

Actions to support philanthropy, community carrier, and higher quality of existence worldwide: Nestlé has diverse company tasks and partnerships aimed toward improving first-rate lifestyles in groups international. These tasks encompass promoting nutritious schooling, helping rural improvement, and supplying clean water and sanitation.

Actions to enhance employee well-being and make the organization a tremendous vicinity to work: Nestlé invests in worker well-being through numerous programs, including health and well-being tasks, schooling and improvement opportunities, paintings-life stability projects, and employee aid packages.

Actions to defend and maintain the environment: Nestlé has set environmental sustainability dreams and has implemented measures to lessen its environmental impact. The organization makes a specialty of areas which include water and strength efficiency, waste control, sustainable sourcing, and climate change mitigation.

Based on these additives, Nestlé's method appears to be socially accountable as the corporation takes movements throughout numerous dimensions of CSR. However, it is essential to be aware that assessing an enterprise's typical social responsibility involves a more complete analysis, such as evaluating the effectiveness and impact of these moves, as well as thinking about any criticisms or controversies surrounding the organization's practices.

To know more about Nestlé

https://brainly.com/question/29786027

#SPJ4

The correct question is:

"based on the five components of a corporate socially responsible strategy depicted in figure 9.2 in chapter 9, is Nestlé’s strategy socially responsible? explain. The Five Components of a Corporate Social Responsibility Strategy are Actions to ensure the company operates honorably and ethically Actions to promote workforce diversity Actions to support philanthropy, community service, and better quality of life worldwide A Company's Corporate Social Responsibility Strategy Actions to enhance employee well-being and make the company a great place to work Actions to protect and sustain the environment"

based on the five components of a corporate socially responsible strategy depicted in figure 9.2 in chapter

What are the steps of gene expression?

Answers

Answer:

The process of gene expression involves two main stages: Transcription: the production of messenger RNA (mRNA) by the enzyme RNA polymerase, and the processing of the resulting mRNA molecule.

...

Translation involves four steps:

Initiation. ...

Elongation. ...

Termination. ...

Post-translation processing of the protein.

Explanation:

Why is anesthesia used while surgery? I what will happen if we don't give anesthesia before surgery ?​

Answers

Answer:

Anesthesia is used because it puts people to sleep, so they don't feel pain.

If you don't use anesthesia the patient will feel the pain, but might also die.

Explanation:

hope it helps

sorry if I'm wrong

Answer:

It keeps you from feeling pain during the procedure, if anesthesia is not used on you while you're having surgery you will feel EVERYTHING, and you will not have the anesthesia's side effects! :)

Please I need help with this

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA
Other Questions
help i need to know the answer ASAP Help Please!! Which of the described compounds is required for cheese making?O AlcoholO Sodium bicarbonate (baking soda)O Lactic acidGluten The fractional scale for a map Go west of Boomer Lake and find the Stillwater Airport. Center it on your screen. Your measurement units should still be in meters and kilometers 4.7 Measure the real distance of the longest runway. For this, go to the top bar and select the icon with a ruler. Click on one end of the runway and then on the other end. A yellow line will appear between the two points. In the box, you will see the distance in kilometers. You can change it to centimeters. ( 1 pt) 4.8 Your boss asks you to make a map of Stillwater Airport. We do not have time for that today, but at least you can calculate the fractional scale of the map. The only clue you have is that your boss told you that the longest runway should measure 12 cm on the map. With the previous measurement of the real length of the runway, calculate the fractional scale. (2 pts) Fractional scale of the Stillwater Airport Map: How has the increase in information technology affected criminal activities globally?A. Crime has remained about the same.B. Crime has decreased due to better monitoring efforts.C. The need for government cooperation has been reduced.D. New mechanisms for stealing data, trafficking contraband and laundering money haveemerged. In "Letter from Birmingham Jail" Martin Luther King, Jr. writes: "But as I continued to think about thematter I gradually gained a bit of satisfaction from being considered an extremist....Was not ThomasJefferson an extremist - 'We hold these truths to be self-evident, that all men are created equal.' So thequestion is not whether we will be extremist but what kind of extremist will we be. Will we be extremistsfor hate or will we be extremists for love?" In at least 150 words, identify and explain the allusion in thisquotation and discuss how this allusion strengthens King's arguments in the letter. At t=1.0s, a 0.40 kg object is falling with a speed of 6.0 m/s. At t=2.0s, it has a kinetic energy of 25 J.Part AWhat is the kinetic energy of the object at t=1.0s? IN JOULESPart BWhat is the speed of the object at t=2.0s? in m/sPart CHow much work was done on the object between t=1.0s and t=2.0s? IN JOULES AthleticsBasketballTeam consists of 5 playersYou are not allowed to use your feet.Not much equipment usedFootballTeam consists of 11 playersYou are allowed to use your feet and hands.____________________SoccerTeam consists of 11 players (10 players and 1 goalie)You are only allowed to use your feet.Not much equipment usedThe item above is an example of which form of prewriting? A. outline B. semantic map C. concept map D. brainstorm What is the molarity of a solution containing 7.78 gram of urea in 203 gram of water? HELP PLEASEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE Help help help help help help straightforward answer Study the image.What type of weather are the upper part of Africa and the lower half of Asia most likely experiencing, based on the image?rainfalldry heatcold breezesthunderstorms I need help with this one A customer ordered 3 machines from ABC Limited on 20 September 2020. On 1 October 2020, ABC Limited sold three machines to customer for a total amount of Rs 1900 000. The three machines were delivered to the premises of the customer on the same day. Included in the sales are 1 year contract for all three of the machines. A warranty for each of these machines may cost R 20 000 to obtain. The customer received a trade discount of 10% for both tractors. Ben bought a total of 11 pizzas for his class party. The amount of large pizzas was one less than twice the amount of medium pizzas. How many large pizzas and how many medium pizzas did he buy? l'echarpe de soie rouge : pourquoi peut ton affirmer que Lupin utilise abusivement ces deux expressions sachant que Stanley earns $10 an hour babysitting his little cousin. He babysat 3 hours last week. He used that money to buy three orders of nachos that cost $3.75 each. How much of his babysitting money does he have left? scientists hypothesize that cabbage, broccoli, cauliflower and radishes developed along a common pathway. which observation would best support this hypothesis? selected:a. fossils of these plants were found in the same rock layerthis answer is incorrect. b. chloroplasts of these plants produce a gas c. these plants live in the same environment d. these plants have similar proteins suppose that swaziland decides to open trade with the world market for carbonated beverages and becomes an importer. please answer the following questions. a. if swaziland becomes an importer of carbonated beverages, what must be true? the world price is less than the domestic price. the domestic price is less than the world price. swaziland has an excess supply of carbonated beverages. a tariff is being charged in the trade. b. after the opening of trade, the price per can of carbonated beverage for the domestic consumer does not change. decreases. increases. c. after trade opens for carbonated beverages, the resulting change in price causes quantity to equal 7 million cans per year, while quantity equals 3 million cans. how many cans will be imported? demanded; supplied, 4 million cans per year supplied; demanded, 4 million cans per year supplied; demanded, 10million cans per year demanded; supplied, 10 million cans per year How did the 100 year war affect society? Using the real world scenario given, answer the following questions.