When any object is observed under the microscope, which objective lens should be used first and why?.

Answers

Answer 1

Answer: The 4x objective lens has the lowest power and, therefore the highest field of view.


Related Questions

How does
the process of subduction provide a water source for volcanic gases?

Answers

Answer:

As an oceanic plate is subducted beneath a continental plate, seafloor sediments rich in water and carbon dioxide are carried beneath the overriding plate. These compounds may act as fluxes, reducing the melting temperature of magma. Although the process is not clearly understood,…Explanation:

Answer: I would just reword some of the stuff

Explanation:

How doesthe process of subduction provide a water source for volcanic gases?

A comet is close to the sun. How fast would you claim it might travel?

Answers

Answer:

When the comet is far from the sun, it travels at about 2,000 miles per hour. As it gets closer to the sun, its speed increases. It may travel at over 100,000 miles per hour! As a comet approaches the sun, its icy body begins to melt, releasing gas and dust.

Explanation:

(GIVING BRAINLIEST!!!!!)

(GIVING BRAINLIEST!!!!!)

Answers

Answer: last one

Explanation: the 1st screenshot is sleet 2nd is hail and you can see how big the hail is

(GIVING BRAINLIEST!!!!!)
(GIVING BRAINLIEST!!!!!)
it’s the last option!!

A food web is more realistic because a snake
A. has multiple adaptations

B. eats more than just frogs

C. just feeds on birds

Answers

Answer:

B. eats more than just frogs

Explanation:

A food web is more realistic because a snake eats more than just frogs

A food web is more realistic because a snake eats more than just frogs. The correct option is B.

What is a food web?

A food web is a network of interrelated food chains that represents the movement of materials and energy within an ecosystem. In a food chain, the various arrows symbolize the various species that are being consumed by one another and so represent the flow of energy. Additionally, it shows that an animal can eat a variety of foods.

Food chains that are linked together form food webs. In a food chain, arrows point from the organism being eaten to the organism eating it.

The energy flow in a food web is depicted by arrows. Food webs display every form of eating in an environment.

Thus, the correct option is B. eats more than just frogs.

To learn more about the food web, refer to the link:

https://brainly.com/question/15544799

#SPJ2

Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as:

Answers

Hardwired characteristics of the brain that attempt to keep us in balance by correcting deficiencies are referred to as homeostatic mechanisms.

Homeostasis is the body's ability to maintain a stable internal environment despite external changes.

In the context of the brain, homeostatic mechanisms involve various processes that regulate physiological functions and maintain optimal levels of essential substances.

These mechanisms can include feedback loops that detect imbalances and initiate corrective actions.

For example, if there is a deficiency in a particular nutrient or hormone, the brain may activate mechanisms to increase its production, decrease its consumption, or enhance its absorption from the environment.

Homeostatic mechanisms play a crucial role in ensuring the body's overall stability and functioning, helping to maintain proper levels of various substances and promoting overall well-being.

To know more about Homeostasis, refer here:

https://brainly.com/question/15647743#

#SPJ11

need help please bio is kicking my noggin

need help please bio is kicking my noggin

Answers

Answer: C

Explanation:

Plants take in co2 and sunlight during photosynthesis to produce glucose. If we remove plants from the ecosystem, there will be nothing to take in the co2 which means there will be a lot of co2 in the atmosphere.

The answer is C have a great day

Which of the following scenarios would MOST LIKELY lead to a change in DNA that would increase genetic variation in the individual’s offspring? An A - T base pair changes to a C - G base pair during mitosis in a liver cell of a young man. A virus inserts nine base pairs into a lung cell of an elderly man. UV radiation mutates the skin cells of a pregnant mother, changing two G bases to T bases. A G - C base pair changes to an A - T base pair randomly in a young woman's egg cell during meiosis.

Answers

The scenario that would most likely lead to a change in DNA that would increase genetic variation in the individual’s offspring is when a G-C base pair changes to an A-T base pair randomly in a young woman's egg cell during meiosis. The last option is correct regarding mutation.

What happens to the mutation in the reproductive organs?

The mutations that happen to the reproductive organs, such as the ovary of the female and the testes of the male, have a higher chance of being inherited by the next generation. Because it occurs in the ovum, this type of mutation is inheritable.

Hence, the last option is correct because it states that a change in DNA that would increase genetic variation in the individual’s offspring is when a G-C base pair changes to an A-T base pair randomly in a young woman's egg cell during meiosis.

Learn more about the mutation here.

https://brainly.com/question/17130462

#SPJ1

The soybean aphid was introduced to the United States in 2000. The aphid killed many soybean plants. In 2004, scientists
discovered that some soybean plants were resistant to the aphid. This resistance was genetically based. The scientists
wanted to determine whether the resistant trait in these soybean plants has a dominant inheritance pattern. Which of the
following would provide the best evidence that the trait is dominant?

Answers

Answer:

The soybean aphid was introduced to the United States in 2000. The aphid killed many soybean plants. In 2004, scientists discovered that some soybean plants were resistant to the aphid. This resistance was genetically based. The scientists wanted to determine whether the resistant trait in these soybean plants has a dominant inheritance pattern. Which of the following would provide the best evidence that the trait is dominant

α-latrotoxin, a neurotoxin in black widow spider venom, also effects acetylcholine (ach) stimulation of muscle. interestingly, organisms injected with α-latrotoxin exhibit uncontrollable muscle cramps and spasms, which after some time is then followed by complete flaccid (relaxed) muscle paralysis. considering what you know about the botulinum neurotoxin, hypothesize how α-latrotoxin may modulate exocytosis of ach.

Answers

α-latrotoxin, a neurotoxin in black widow spider venom, affects acetylcholine (ACh) stimulation of muscle. When organisms are injected with α-latrotoxin, they experience uncontrollable muscle cramps and spasms, followed by complete flaccid muscle paralysis. To hypothesize how α-latrotoxin may modulate exocytosis of ACh, we can consider the effects of botulinum neurotoxin.

Botulinum neurotoxin inhibits the release of ACh from nerve endings by cleaving SNARE proteins involved in vesicle fusion. This prevents the exocytosis of ACh and leads to muscle paralysis. Hypothetically, α-latrotoxin may also modulate exocytosis of ACh by targeting similar components of the exocytotic machinery.

It is possible that α-latrotoxin interacts with SNARE proteins or other proteins involved in ACh release, leading to a dysregulation of exocytosis. This dysregulation could result in excessive release of ACh, causing the muscle cramps and spasms observed initially. Subsequently, α-latrotoxin may impair exocytosis to the extent that ACh release is completely halted, leading to muscle paralysis.

To know more about vesicle visit:

https://brainly.com/question/8805810

#SPJ11

Ari drew a diagram to show organisms in an ecosystem. What did Ari draw?

Answers

Answer:

food web

Explanation:

Food web is an interconnection and assimilation of different good chains. Many food chains are interlinked a hence a food web is created. This represents what is eaten by which organism. The diagram that Ari had drawn is a diagram of a food chain. The grass is the primary source of food in the food web. Rabbit, Mouse, and grasshopper are the animals that eat the grass. The grasshopper is eaten by a shrew and a mouse. The rabbit and shrew are then eaten by the fox. A mouse is eaten by a snake and a fox. This is the diagrammatic representation of a food web.

Ari drew a diagram to show organisms in an ecosystem. What did Ari draw?

Answer:

food web

Explanation:

transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC

Answers

Answer:

RNA: UACGCUUUACGAGACCCAAUC

Explanation:

During transcription, a specific DNA sequence is used as template to synthesize a specific RNA sequence, usually a messenger RNA (mRNA). During this process (transcription), Uracil (U) bases replace Thymine (T) bases. Transcription has three stages: initiation, elongation and termination. Subsequently, the resulting mRNA is used to synthesize a protein, in a process known as translation.

Answer:

RNA: UACGCUUUACGAGACCCAAUC

Explanation:

A particular gene has two alleles, a dominant allele A and a recessive allele a. The frequency of allele A is 0.55 . If the population is in Hardy-Weinberg equilibrium with respect to the gene, then what is the expected frequency of genotype Aa?

Answers

Answer:

0.495

Explanation:

because i did the question

What is the secondary messenger made by adenylyl cyclase during the activation of liver cells by epinephrine

Answers

The secondary messenger made by adenylyl cyclase during the activation of liver cells by epinephrine is cyclic AMP (cAMP).

The activation of liver cells by epinephrine is a key process in biological bodily regulations. When epinephrine attaches to its receptors on the cell surface, it creates an intracellular environment in which adenylyl cyclase is activated.

Adenylyl cyclase is an enzyme that helps form a second messenger called cyclic adenosine monophosphate (cAMP). cAMP is responsible for mediating the downstream effects of epinephrine on the cell. cAMP is a small, symmetrical molecule that diffuses rapidly across cell membranes and activates many different cellular functions.

know more about liver cells here

https://brainly.com/question/7601256#

#SPJ11

What must you first determine before filling in any Punnett
square? The phenotypic ratio The gametes contributed by each
parent The genotypic ratio

Answers

Before filling in a Punnett square, the first thing you must determine is the gametes contributed by each parent.

A Punnett square is a visual tool used in genetics to predict the possible outcomes of a genetic cross between two individuals. It helps determine the potential genotypes and phenotypes of offspring based on the alleles contributed by each parent.

To construct a Punnett square, you need to know the possible gametes that each parent can contribute. Gametes are the reproductive cells (sperm and eggs) that contain half the genetic material of an individual. Each parent carries two alleles for a particular gene, and these alleles segregate during gamete formation.

By determining the gametes contributed by each parent, you can identify the possible combinations of alleles in the offspring. This information is crucial for filling in the Punnett square and predicting the genotypic and phenotypic ratios of the offspring.

Once the gametes are determined, they are placed in the appropriate cells of the Punnett square to represent all possible combinations. By analyzing the square, you can determine the genotypic and phenotypic ratios, which provide insights into the inheritance patterns and traits expressed in the offspring.

In summary, before filling in any Punnett square, it is essential to determine the gametes contributed by each parent, as this information forms the basis for predicting the genotypic and phenotypic ratios of the offspring.

Learn more about genotypes visit:

brainly.com/question/30784786

#SPJ11

A gastroenterologist is a doctor who treats problems of the esophagus, stomach, and intestines. Which organ system is cared for by this type of doctor?.

Answers

Answer:

gastrointestinal system

it is most reasonable to hypothesize that, in the breakdown of glucose, substance x is

Answers

In the breakdown of glucose, substance X is likely to be a byproduct or intermediate compound formed during the metabolic process.

Glucose undergoes a series of biochemical reactions during its breakdown, primarily through the process of cellular respiration. This metabolic pathway involves several enzymatic reactions that convert glucose into usable energy in the form of adenosine triphosphate (ATP). Along this pathway, various intermediate compounds and byproducts are formed.

Substance X, mentioned in the hypothesis, could represent one of these intermediate compounds or byproducts generated during glucose breakdown. These compounds play important roles in energy production and regulation within the cell.

For instance, during glycolysis, glucose is initially converted into two molecules of pyruvate, which can then enter different metabolic pathways depending on the presence or absence of oxygen. In the presence of oxygen, pyruvate can undergo further reactions in the mitochondria to produce additional ATP through the citric acid cycle and oxidative phosphorylation. In this process, intermediate compounds such as acetyl-CoA, NADH, and FADH2 are generated.

Learn more about metabolic process here:

https://brainly.com/question/1764560

#SPJ11

Which of the following is not true about arid deserts

Answers

What are the options

Answer:

what are  the options?

Explanation:

Our heart cells differ from our liver cells because... Group of answer choices they have different DNA of differential gene expression they have different mechanisms of translation they have all the same proteins but they act differently

Answers

Our heart cells differ from our liver cells because they have different DNA of differential gene expression.

Although all cells in our body contain the same DNA, different cell types express specific sets of genes that define their function and structure. In heart cells, genes related to muscle contraction and heart function are expressed, while liver cells express genes associated with detoxification, metabolism, and other liver-specific functions.

Differential gene expression is regulated through various mechanisms such as transcription factors, epigenetic modifications, and non-coding RNAs, which work together to ensure that the appropriate genes are expressed in the right cell type. This selective expression of genes allows cells to perform specialized tasks and maintain their unique characteristics, contributing to the overall functionality and organization of our body. In summary, heart and liver cells are different because they express distinct sets of genes that are crucial for their specific roles in maintaining our health.

Learn more about Differential gene expression here: https://brainly.com/question/30691574

#SPJ11

Nitrate in groundwater can be increased by infiltration of runoff from
Select one:
A. manure from cattle feedlots.
B. fields treated with synthetic fertilizers containing nitrogen.
C. rain runoff with dissolved nutrient
D. All of the above.

Answers

Nitrate in groundwater can be increased by the infiltration of runoff from various sources, including manure from cattle feedlots, fields treated with synthetic fertilizers containing nitrogen, and rain runoff with dissolved nutrients.

Hence, the correct option is D.

Nitrate in groundwater can be increased by the infiltration of runoff from various sources, including manure from cattle feedlots, fields treated with synthetic fertilizers containing nitrogen, and rain runoff with dissolved nutrients. These sources can contribute to the contamination of groundwater with nitrates.

Manure from cattle feedlots often contains high levels of nitrogen, which can leach into the soil and eventually reach groundwater.

Similarly, synthetic fertilizers used in agricultural fields contain nitrogen compounds that can also be washed into the soil and groundwater through runoff. Additionally, rainwater carrying dissolved nutrients can infiltrate the ground and contribute to nitrate contamination.

Therefore, all of the given options can contribute to the increase of nitrate in groundwater through runoff infiltration.

Hence, the correct option is D.

To know more about groundwater here

https://brainly.com/question/32373608

#SPJ4

Match the sentences in the following chart
A- Recombinant bacterial plasmid is used to produce genetically modified plants.
B- Recombinant bacterial plasmid is used to produce human insulin.
C- Recombinant viral DNA is used to treat some diseases like cystic fibrosis.
D- Random DNA sequences that are different from
one person to another.

1-DNA fingerprint
2-GMO
3-Human proteins production
4-Gene therapy

Answers

Matching the sentences in the chart:

A - 2-GMO (Recombinant bacterial plasmid is used to produce genetically modified plants)

B - 3-Human proteins production (Recombinant bacterial plasmid is used to produce human insulin)

C - 4-Gene therapy (Recombinant viral DNA is used to treat some diseases like cystic fibrosis)

D - 1-DNA fingerprint (Random DNA sequences that are different from one person to another)

What are the kinds of symmetry for these animals

What are the kinds of symmetry for these animals

Answers

Answer:

Snail: bilateral symmetry

Sea star: Radial symmetry

Sea jelly: Asymmetrical

Angelfish: Bilateral symmetry

Sea anemone: Radial symmetry

Frog: Bilateral symmetry

Sponge: Asymmetrical

Spider: Radial symmetry

Butterfly: Bilateral symmetry

Lobster: Bilateral symmetry

Explanation

PLEASE HELP!!!!! How are a hypothesis, theory, and scientific law related?

Answers

Answer:

They are all steps taken to perform the scientific method.

Explanation:

Hypothesis is an educated guess made from observations, a theory is a hypothesis test with a significant amount of data, and scientific law is a theory that is consistent with generations of data.  They are all different.  However, they are all apart of a process called the scientific method.

Describe what the body needs to survive. Include the 3 major categories, in detail, their primary function(s), and their metabolism. Then explain 1 issues that would result if the body's metabolic requirements are not met. What role do metabolites have with fluid regulation?

Answers

The body needs various nutrients and substances to survive. These nutrients can be classified into three categories: carbohydrates, proteins, and fats.

Below is a detailed description of the three major categories and their metabolism.

Carbohydrates: Carbohydrates are one of the essential nutrients needed by the body to survive. Carbohydrates are stored in the body as glycogen and are primarily used as a source of energy. Carbohydrates are metabolized into glucose, which is then transported throughout the body by the blood. Carbohydrates are metabolized through glycolysis, a process that occurs in the cytoplasm of the cells. If the body's metabolic requirements for carbohydrates are not met, it can result in hypoglycemia.

Proteins: Proteins are another essential nutrient needed by the body to survive. Proteins are primarily used for building and repairing body tissues and organs. Proteins are metabolized into amino acids, which are then transported throughout the body by the blood. Proteins are metabolized through a process called protein synthesis, which occurs in the ribosomes of the cells. If the body's metabolic requirements for proteins are not met, it can result in muscle atrophy and other health issues.

Fats: Fats are a necessary nutrient needed by the body to survive. Fats are stored in the body as adipose tissue and are primarily used for energy storage. Fats are metabolized into fatty acids, which are then transported throughout the body by the blood. Fats are metabolized through a process called beta-oxidation, which occurs in the mitochondria of the cells.

If the body's metabolic requirements for fats are not met, it can result in a deficiency of essential fatty acids.

Metabolites have an important role in fluid regulation. Metabolites are the byproducts of metabolic processes, and they play a crucial role in regulating fluid balance in the body. Metabolites such as urea and ammonia are excreted from the body through urine, which helps to regulate fluid levels in the body. Additionally, metabolites such as lactic acid and carbon dioxide help to regulate the pH levels of the body's fluids, which is important for maintaining optimal health.

To know more about metabolism visit the link

https://brainly.com/question/29763323

#SPJ11

How can the water potential of a plant cell in equilibrium with pure water be zero when the plant cell contains solute?.

Answers

The plant cell's cell wall is exerting positive pressure (pressure potential) on the cell, increasing the water potential to zero. The correct option is A.

What is water potential?

Plants use water potential to transport water to their leaves, allowing photosynthesis to occur. Water potential is the difference between the potential energy in water and the potential energy in pure water.

It is also a measure of how freely water molecules can move in a specific environment or system.

Water potential is reduced as a result of transpiration from the leaves, which is aided by the cohesive forces between water molecules, causing water to be under tension, i.e., under negative pressure.

The cell wall of the plant cell exerts positive pressure (pressure potential) on the cell, lowering the water potential to zero.

Thus, the correct option is A.

For more details regarding water potential, visit:

https://brainly.com/question/23855783

#SPJ1

Your question seems incomplete, the complete question is:

How can the water potential of a plant cell in equilibrium with pure water be zero when the plant cell contains solute? see section 35.1 ( page 729) . how can the water potential of a plant cell in equilibrium with pure water be zero when the plant cell contains solute? see section 35.1 ( page 729) . the plant cell's cell wall is exerting positive pressure (pressure potential) on the cell, increasing the water potential to zero. the plant cell's cell wall is exerting negative pressure (pressure potential) on the cell, increasing the water potential to zero. the plant cell's cell wall is exerting negative pressure (pressure potential) on the cell, decreasing the water potential to zero. the plant cell's cell wall is exerting positive pressure (pressure potential) on the cell, decreasing the water potential to zero?

__________ are small objects that are suspended within the atmosphere. A) Fumaroles B) Particulates C) Plankton D) Asbestos E) Angiosperms

Answers

Answer:

B) Particulates

Explanation:

_____Particulates_____ are small objects that are suspended within the atmosphere

mapa mental sobre El origen de las especies

Answers

El origen de las especies, cuya primera edición apareció en 1859, es el libro más conocido de El biólogo británico Charles Darwin. En el libro, Darwin expone su teoría de la evolución:

Afirma que toda la vida en la Tierra tiene un ancestro común. Que la selección natural es el mecanismo principal para la evolución de las especies.

El libro está considerado como una de las obras científicas más importantes de la historia. Causó revuelo en el momento de su publicación porque atribuyó la riqueza de la forma de vida en la Tierra a un proceso mecánico más que a una inteligencia sobrenatural. Es cierto que otros habían sugerido previamente que podría haber cosas como la evolución o la selección natural, pero "El origen de las especies" es el primer trabajo que extrae la mayor consecuencia de estos conceptos.

Aprende más acerca de este tema en https://brainly.com/question/16994577.

Give reason diffrent types of plant are available in riverside, lakeside​

Answers

Answer:

because it contain moist environment or land filled with different minerals. Such type of climate is favourable for mostly all kinds of plants.

Different types of plant are available in riverside, lakeside​ because of the

presence of nutrients and resources in them.

Plants are regarded as primary producers which produce their food through

the process of photosynthesis. Photosynthesis involves reaction between

carbondioxide and water to form glucose.

The availability of water favors photosynthetic processes which is why plants are present in such areas to increase food production.

Read more on https://brainly.com/question/9498584

Fish that live in marine environments and ascend creeks and streams to breed are calledanadromousLake Troutrochordata

Answers

The correct term for fish that live in marine environments and ascend creeks and streams to breed is "anadromous."

Fish that live in marine environments and ascend creeks and streams to breed are called anadromous fish. These fish are born in freshwater, spend most of their lives in saltwater, and return to freshwater to breed. This is in contrast to catadromous fish, which live in freshwater and migrate to the sea to breed.

Anadromous fish are an important part of many aquatic ecosystems, as they transport nutrients from the ocean to freshwater habitats. Examples of anadromous fish include salmon, sturgeon, shad, lamprey, and eel.

Salmon are perhaps the most well-known anadromous fish, as they are commercially valuable and widely distributed throughout the world. Salmon are born in freshwater streams and rivers, and after spending several years in the ocean, return to their natal streams to spawn. This migration is often an arduous journey, as salmon must swim upstream against strong currents and leap over waterfalls to reach their spawning grounds.

Click the below link, to learn more about Anadromous fish:

https://brainly.com/question/31605272

#SPJ11

What is the arrow pointing to?


A. A covalent bond

B. An ionic bond

C. A triple bond

D. A hydrogen bond

What is the arrow pointing to?A. A covalent bondB. An ionic bondC. A triple bondD. A hydrogen bond

Answers

Answer:

Hydrogen Bond

Explanation:

The molecules above have two positives molecules of the same size. One larger molecule that is negative. All other bonds are notated using a solid line. Hydrogen bonds are dotted lines because there are partial charges on the molecules.

What are two behavioral adaptations of an elephants?

Answers

Elephants are highly intelligent creatures that have been observed to possess a wide range of adaptations that allow them to thrive in their natural habitat. Here are two behavioral adaptations of elephants:1. Social behaviorElephants live in groups known as herds, and they exhibit a range of social behaviors.

The social structure of elephant herds is matriarchal, with a dominant female known as the matriarch leading the group. The matriarch is responsible for making important decisions regarding the herd's movements, such as where to find food, water, or shelter.

Elephants are also known to exhibit a range of complex social behaviors, such as comforting each other when they are distressed and communicating with each other using a range of vocalizations.2. Tool useElephants have been observed using a variety of tools to help them survive in their environment.

To know more about intelligent visit:

https://brainly.com/question/28139268

#SPJ11

Other Questions
i need help please help Which of the following was not one of Aristotle's four elements that made up the world?O LavaO WaterAirO Fire In his science notebook, Gregory records physical properties of 1 kg of frozen water (ice). An hour later, after the ice melts to liquid, he records physical properties of the water. When he compares the frozen water (ice) and melted water (liquid), what physical property will be similar?A) temperature B) volume C) shape D) mass A catalyst accelerates the rate of a chemical reaction by A. raising the enthalpy of the products. B. lowering the enthalpy of the products. C. lowering the activation energy. D. raising the activation energy. What is the area of a rectangle with a lenght of 9. 75cm and a width of 635m The _______ prohibits price discrimination in sales to wholesalers, retailers, or other producers. This unit of DNA carries the name of a single, entire protein:genenucleotidechromosomecodon Naomi plotted the graph below to show the relationship between the temperature of her city and the number of popsicles she sold daily:A scatter plot is shown with the title Naomis Popsicle Stand. The x axis is labeled High Temperature, and the y-axis is labeled Number of Popsicles Sold. Data points are located at 90 and 20, 85 and 17, 70 and 14, 75 and 20, 60 and 16, 50 and 14, 60 and 12, 40 and 10, 50 and 12, 80 and 8.Part A: In your own words, describe the relationship between the temperature of the city and the number of popsicles sold. (2 points)Part B: Describe how you can make the line of best fit. Write the approximate slope and y-intercept of the line of best fit. Show your work, including the points that you use to calculate the slope and y-intercept. I need help with knowing what is the ray? help please The mean of a sample a. is always equal to the mean of the population. b. is always smaller than the mean of the population. c. is computed by summing all the data values and dividing the sum by the number of items. d. is computed by summing the data values and dividing the sum by (n - 1). Explain one historical example that reflects the relative significance of the causes of imperialism from c. 1750- c. 1900. While reading a news article, Bethany noticed that the word "senselessness" had a lot of repeating letters. Bethany wondered about the probabilities of randomly drawing certain letters if each letter in "senselessness" were written on an index card and put into a bag. Which letter would have the greatest probability of being selected? What would be the probability of that selection? Which letter would have the least probability of being selected? What would be the probability of that selection? Cylinder a has a radius of 2 meters and a height of 4 meters. cylinder b has a radius of 4 mefers and a height of 2 meters. Solve 6X ^ 2 +5X -6 =0algebraically for the exact values of X Which of the following is not a determinant of the price elasticity of demand for a good?a. the time horizonb. the steepness or flatness of the supply curve for the goodc. the definition of the market for the goodd. the availability of substitutes for the good a) If = 2i + 3j + 4k and 5 = i- j + k,Find(b) x 5(ii) Sine of the angle between these vectors.(iii) Unit vector perpendicular to each vector A tank can be filled by one pipe in 20 minutes and by another in 30 minutes. How long will it take both pipes together to fill the tank what type of job involves working at client sites on specific assignments for extended periods of time?(1 point)home-basedoffice-basedproject-basedfield-based When Caitlin starts running towards Asha, Asha is 100 meters from Caitlin. As Caitlin runs, Asha moves directly away from Caitlin at one-third of Caitlin's speed. How many meters has Caitlin run when she first catches up to Asha Match each of these periods of ancient Greek art with the technique that wasdeveloped during that period.Hellenistic?Black-figure pottery?Frieze carvingClassicalLinear perspectiveArchaic please helppp