what things humans do in the flower garden to alter the abiotic elements of the ecosystem?

Answers

Answer 1
Humans often use pesticides to destroy undesirable organisms that live in flower gardens, such as insects, weeds, or fungi. The use of such chemical will reduce biodiversity. Humans also plant many of the same plants in gardens, which reduces biodiversity.

Related Questions

what do you think would happen if you introduced an additional predator, such as a coyote, which requires fewer rabbits to reproduce?

Answers

Answer:

Rabbits will decrease in number

energy is released from atp when question 8 options: a. a phosphate group is added. b. adenine bonds to ribose. c. atp is exposed to sunlight. d. a phosphate group is removed.

Answers

The correct answer is option (D). a phosphate group is removed. Thus energy is released from ATP when a phosphate group is removed.

By adding a phosphate group to another molecule, ATP can drive biological operations (a process called phosphorylation). For the transfer special enzymes are responsible, and to release energy from ATP the cellular process connects. Energy is needed to add a phosphate group to a molecule. Since phosphate groups are negatively charged and are organized in series in ADP and ATP, they repel one another. The ADP and ATP molecules are intrinsically unstable due to this attraction. In order to release energy, the bond between the first and second phosphates is broken. In order to release energy, the bond between the sugar and adenine is broken.

To learn more about ATP please click on the given link: https://brainly.com/question/28303881

#SPJ4

 The correct answer is option (D). a phosphate group is removed.Subsequently energy is let out of ATP when a phosphate group is taken out.

Energy is released when an ATP molecule transfers a phosphate group to a different molecule, because the new bonds are stronger than the old bonds.

In every chemical change , exchanging one set of bonds for an additional ,

Energy is employed to break the old bonds.

Energy is released when the new bonds are formed.

If a reaction is endothermic, more energy is employed than is released. This suggests the old bonds were stronger than the new ones are.

to know more about chemical change visit here:

https://brainly.com/question/1222323

#Abcd

Unlike a typical animal cell, this plant cell has an angular shape. The shape of a plant cell is due, mostly, to the presence of the

Answers

due to the presence of the cell wall.
The shape of a plant cell is due to the presence of the cell wall. The cell wall is a rigid structure that keeps the contents of the plants inside

The field of biology that studies the diversity of organisms and
their evolutionary relationships is called systematics.
Select one:
True
False
.......................................................

Answers

Answer:

True.

Explanation:

Hope this helps!

What is the string used for in the light/transpiration experiment?

Answers

Water is necessary for plants but only a small amount of water taken up by the roots is used for growth and metabolism.

Water moves through a plant during transpiration, where it evaporates from aerial parts like leaves, stems, and flowers. Although water is essential to plants, only a small portion of the water absorbed by the roots is utilised for growth and metabolism.

a water jug. it's a capillary tube. To join the capillary tube to the leafy shoot's stem, use rubber tubing. a scale for calculating the distance a bubble in a capillary tube has travelled.

Due to transpiration, cobalt chloride paper turns from blue to pink in colour. In order to illustrate transpiration and the various rates of transpiration on the surface of the leaves, cobalt chloride paper is employed.

To learn more about metabolism visit

https://brainly.com/question/29763323

#SPJ4

Which of the following presents the best argument as to the role of the cow in this cycle?

Answers

Answer:

Cow dung helps in balancing the environment and kills germs

Explanation:

Cow dung is used for fertility of the soil. It is also used for the control of pest in the plants. When heated cow dung can be used to cook food where there are lack of wood available. Also when it is heated it releases the gases which kills germs present in the air.

Answer:

The cow eats plants and produces carbon dioxide through cellular respiration. The plants, which gain energy from the sun, then take carbon dioxide from the atmosphere and use it in photosynthesis.

Explanation:

I did the test

What type of scientist would be the best qualified to perform genetic engineering to pro- duce seed that are more productive in agriculture? A. biochemist B. geologist C. molecular biologist D. paleontologist

Answers

The type of scientist best qualified to perform genetic engineering to produce more productive seeds in agriculture would be a molecular biologist, the correct option is C.

Molecular biologists specialize in studying the structure, function, and interactions of molecules within biological systems, including DNA and genes. Genetic engineering involves manipulating the genetic material of organisms, which requires a deep understanding of molecular biology principles.

Molecular biologists have the expertise to identify and isolate specific genes responsible for desired traits in crop plants, such as increased productivity or resistance to pests or diseases. They can then modify or introduce these genes into target plants to achieve the desired outcomes, the correct option is C.

To learn more about genetic follow the link:

https://brainly.com/question/28980835

#SPJ4

Pathogens are microorganisms that can make you sick if you eat them. True or false

Answers

The answer is: True

A major perturbation of the carbon cycle by human activity is associated with:

Answers

Answer:

A major perturbation of the carbon cycle by human activity is associated with: The release of carbon from fossil fuel deposits

Explanation:

I hope this helps!

Before receiving FDA approval, the tTAV protein had to be tested for any potential toxicities to other native animals. Why would this be part of the approval

Answers

The reason testing the tTAV protein for potential toxicities to other native animals is part of the FDA approval process is to ensure that the protein does not pose any unintended harm to the ecosystem or biodiversity.

Before receiving FDA approval, the tTAV protein had to be tested for potential toxicities to other native animals because it is important to assess the safety of the protein for the environment and other organisms that may come into contact with it.

The tTAV protein is a genetic tool used in biotechnology to control pests and invasive species. It works by modifying the DNA of the targeted species, which can have potential ecological consequences if the modified organisms were to escape from the intended habitat or interact with non-targeted species.

Therefore, the FDA and other regulatory agencies require thorough testing to ensure that the use of tTAV protein does not cause harm to non-targeted species, including other animals and plants. Toxicity testing involves exposing various species to the protein to assess its potential adverse effects on them.

These tests can help to identify any potential risks associated with the use of tTAV protein and to develop appropriate measures to minimize those risks. The goal is to ensure that the use of tTAV protein is safe and environmentally sustainable.

Learn more about FDA approval here :
https://brainly.com/question/10711375

#SPJ11

Please answer as soon as possible​

Please answer as soon as possible

Answers

Answer:

1.sensory organs

4.evaporation

12.wire

How energy flows into and out of the ecosystems

Answers

Answer:

energy is flowing out of the ecosystem as you move up trophic levels

A cloned mammal is made by removing the DNA from the unfertilized egg of an egg donor, replacing it with DNA from a cell of a mature animal, and then implanting that cell into the uterus of a surrogate mother. The cell then divides and behaves as if it were a regular embryo. Answer the following question(s) regarding a clone.Of whom is the baby a clone?

Answers

Answer:

The mature animal

Explanation:

The baby would be a clone of the mature animal whose DNA was placed in the unfertilized egg before being implanted into the uterus of a surrogate mother.

The DNA of the egg donor has been removed and replaced with the DNA of the mature animal. The surrogate mother is just a mere carrier and has no biological relationship with the clone. The only organism with biological relationship with the clone would be the one that donates its DNA, which in this case is the mature animal.

Explain the process and bonds involved in the ability of RNA to fold into complex 3-D shapes, similar to those of tertiary proteins.

Answers

RNA molecules fold into complex 3-D structures when base pairing occurs between nitrogen base pairs. The bonds forned are hydrogen bonds.

What are RNA molecules?

RNA molecules refers to nucleic acids which are built from ribose sugar molecules instead of deoxyribose as in DNA molecules.

RNA molecules as in DNA are composed of a sugar backbone, a nitrogenous base, and phosphodiester linkages.

The nucleotides found in RNA molecules are:

uraciladeninecytosine andguanine

RNA is able to form complex 3-D structures even though they are single-stranded because of base pairing that occurs between adenine and uracil, and guanine to cytosine.

The bonds present in thebase pairs are hydogen bonds.

Hydrogen bonds are bonds which are formed between hydrogen and a highly electronegative atom such oxygen, nitrogen, chlorine, and fluorine.

In the RNA molecule, hydrogen bonds form betweenthe oxygen and nitrogen atoms of the either uracil, adenine, cytosine, or uracil.

These hydrogen bonds results in three-dimensional structures of RNA.

In conclusion, RNA molecules are single-stranded nucleic acids materials.

Learn more about RNA molecules at: https://brainly.com/question/1060727

If a homozygous white horse cwcw and a homozygous black horse cbcb are bred together, what is the likelihood that their offspring will be roan with both colors represented in their hair if this gene follows a codominant inheritance pattern?.

Answers

If the genes follow a codominant inheritance pattern, there is a 100% chance that the offspring will be roan.

What is co-dominance with an example?Co-dominance is a form of inheritance in which alleles of a pair of genes are fully expressed in heterozygotes. As a result, the child's phenotype is a combination of the parent's phenotypes. Hence, the trait possess neither dominance nor recessive. In genetics terms, codominance refers to a pattern of inheritance in which two versions (alleles) of the same gene are expressed separately to produce different traits in an individual.If a person has both her IA and IB antigens on his surface, that person's blood type is his AB. In human, the AB blood type is an illustration of codominance. In blood group AB, phenotypic effects of both IA and IB alleles are observed.What is the difference between dominant and codominant?

In perfect dominance, only one allele of the genotype is present in the phenotype. In codominant cases, both alleles of a genotype are present in the phenotype. In imperfect dominance, the phenotype exhibits a mixture of genotypic alleles.

To learn more about codominant inheritance pattern visit:

https://brainly.com/question/28931569

#SPJ1

select the correct answer from each drop down menu. The punnet square illustrates a cross color of the flower. Based on the phenotypes and genotypes of these offspring, it is clear that purple flower color allele is _____ and the parents are ___________ .

select the correct answer from each drop down menu. The punnet square illustrates a cross color of the

Answers

P | PP | Pp | P | Pp |

The Punnett square allows us to see that:

The genotype Pp, which corresponds to the heterozygous condition and the purple flower colour phenotype, will be present in 50% of the progeny.

The homozygous recessive genotype pp, which results in the white flower colour phenotype, will be present in 50% of the progeny.If two of the progeny are the homozygous dominant ones then the parents are definitely the heterozygous  and dominant ones.

The purple flower colour allele (P) is therefore dominant, and the parents are homozygous recessive (pp) and heterozygous (Pp), based on the phenotypes and genotypes of the progeny.

Learn more about heterozygous  at :

https://brainly.com/question/30156782

#SPJ1

i need quick help to get a essay done about reforestation about shawnee forest

Answers

Here are some quick tips on how to write an essay about reforestation in Shawnee Forest.

How to write an essay?

Introduction: Begin your essay with an introduction that explains the importance of reforestation, and introduce the topic of Shawnee Forest. You may also want to include a thesis statement that outlines the main points you will be discussing in your essay.

Background information: Provide some background information about Shawnee Forest, such as its location, size, and ecological significance.

Importance of reforestation: Explain why reforestation is important in Shawnee Forest. For example, you could discuss the benefits of reforestation for biodiversity, ecosystem services, and carbon sequestration.

Reforestation efforts in Shawnee Forest: Describe the reforestation efforts that are currently underway in Shawnee Forest. This could include information about the types of trees being planted, the methods used for planting, and the organizations or individuals involved in the reforestation efforts.

Challenges and solutions: Discuss some of the challenges that are faced in reforesting Shawnee Forest, such as invasive species, climate change, and funding constraints. You can also suggest some possible solutions to these challenges, such as using native plant species, implementing sustainable forest management practices, and seeking out alternative funding sources.

Conclusion: Summarize the main points of your essay, and reiterate the importance of reforestation in Shawnee Forest. You can also provide some recommendations for further research or action on this topic.

Use reliable sources to support your arguments and cite them properly in your essay.

Learn more on essay writing here: https://brainly.com/question/25607827

#SPJ1

Differentiate between parasitic and saprophytic plants with examples.

Answers

Answer:

A parasitic plant is a plant that derives some or all of its nutritional requirement from another living plant.

Answer:An organism, especially a fungus or bacterium, that grows on and derives its nourishment from dead or decaying organic matter. Example: parasitic plants: viscous album, cuscuta campestris, Orobanche ramosa etc . Example: Mushrooms and moulds, Indian pipe, Corallorhiza orchids, and Mycorrhizal fungi etc.

disease that affects the kidney

Answers

Answer:Diabetes is the most common cause of kidney disease

Hope this helps..

Answer: Diabetes and Yellow fever

Diabetes

Diabetic kidneys cannot process as much sugar as a healthy kidney. Some diabetes is temporary, when a mother is pregnant, it can cause them to have diabetes. (NOTE: A pregnant woman should always have a diabetes test while they are carrying) Pregnancy diabetes will go away shortly after the child is born.

Yellow fever

Yellow fever is much more harmful than diabetes, and can sometimes, without proper health care, be fatal. A kidney infected with yellow fever will not filter out all the bacteria and waste properly, making the outside of people and animals have a yellow tint, which is most visible in the eye. Yellow fever is passed on from mosquitos.

you see a bear in the woods and are immediately afraid. what area of the brain detected this fear?

Answers

When you see a bear in the woods and are immediately afraid, it is your amygdala that detects this fear. The amygdala is a small, almond-shaped structure located deep in the brain's temporal lobe.

It plays a crucial role in processing emotions, particularly fear and anxiety. As soon as you see the bear, the amygdala sends a signal to your hypothalamus, which triggers the release of adrenaline and other stress hormones. These hormones prepare your body for the "fight or flight" response, which allows you to respond to the danger quickly and effectively. The amygdala's ability to process fear quickly and efficiently is essential for our survival. Without it, we would not be able to react to threats in time to avoid harm. However, sometimes the amygdala can be overactive, leading to excessive fear and anxiety. This can be a symptom of anxiety disorders such as PTSD, phobias, and panic attacks. In conclusion, the amygdala is the area of the brain that detects fear when you see a bear in the woods, triggering the "fight or flight" response that prepares your body to respond to danger.

To know more about the hypothalamus

https://brainly.com/question/11352172

#SPJ11

Which phrase BEST describes the role of beetles in the decomposition of human remains?

omnivorous feeders
predatory
necrophagous scavengers
semi-aquatic

Answers

Necrophagous Scavengers is the phrase that best describes the role of beetles in the decomposition of human remains.

What do you mean by Decomposers?

Decomposers may be defined as those microorganisms that break down dead organic material partially or completely.

Necrophagous scavengers are the group of decomposers that involves the decomposition of human remains. These organisms feed on the corpse of humans and break down the organic matter.

Therefore, the correct option for this question is C.

To learn more about Decomposers, refer to the link:

https://brainly.com/question/380333

#SPJ1

state four activities that can cause hazards at work places ​

Answers

Answer:

cords in walkway , horseplay, not locking and tagging out broke machines, tools not put away in proper place

Example #4 A round red ball. This is an example of a Justify your answer for example #4. Tell how you know it is a physical or chemical property or change. Use complete sentences and put it in your own words.

Answers

Answer:

State change refers to physical while change in composition refers to chemical change.

Explanation:

If the change is reversible so this is called a physical change such as change state of water from solid into liquid. In this change only physical state changes, the chemical composition remain the same whereas if the change is irreversible so we can called it a chemical change such as burning of wood etc. In chemical change, a new substance is formed by the combination of two or more molecules. So if only state is changed then it is physical change or if the chemical composition changes, it will be a chemical change.

the wet bulb temperature is 10 C the Dry bulb temperature is 14 C what is the relative humidity?

Answers

The relative humidity is approximately 22.9% based on the given wet bulb temperature of 10°C and dry bulb temperature of 14°C.

Relative humidity

Wet bulb temperature: 10°C = 50°F

Dry bulb temperature: 14°C = 57.2°F

SVP at wet bulb temperature: 0.284 * \(e^(17.27 * 10 / (10 + 237.3))\)= 0.284 * \(e^(-7.09)\) = 0.284 * 0.000828 = 0.0002356 psi

SVP at dry bulb temperature: 0.284 *\(e^(17.27 * 14 / (14 + 237.3))\) = 0.284 * e^(-5.97) = 0.284 * 0.002562 = 0.0007296 psi

AVP = 0.0002356 - (0.00066 * (57.2 - 50) * 14.7) = 0.0002356 - (0.00066 * 7.2 * 14.7) = 0.0002356 - 0.0686 = 0.000167 psi

RH = (AVP / SVP at dry bulb temperature) * 100

RH = (0.000167 / 0.0007296) * 100 = 0.229 * 100 = 22.9%

Learn more about relative humidity:https://brainly.com/question/30415486

#SPJ1

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

What causes plaque buildup in arteries?

blood clots

LDL cholesterol

red blood cells

hormones

Answers

LDL cholesterol causes plaque buildup in the arteries (option B).

What causes build-up of plaque in the artery?

Plaque is an abnormal accumulation of material in or on an organ of the body.

High blood levels of cholesterol encourage the formation and growth of vascular plaques that put you at risk for heart attack and stroke.

Plaque forms when cholesterol lodges in the wall of the artery. To fight back, the body sends white blood cells to trap the cholesterol, which then turn into foamy cells that ooze more fat and cause more inflammation.

Learn more about plaque at: https://brainly.com/question/30479660

#SPJ1

Provide a detailed explanation of why meiosis is important in creating genetic variation in a population. Include details on how daughter cells receive genetic information and how they differ from parent cells.

Answers

Answer:

The correct answer is - crossing over, mutations caused during crossing over, and independent assortment.

Explanation:

Meiosis is important as it helps that all organisms form via sexual reproduction contains the correct number of chromosomes in the offspring. Meiosis also produces genetic variation in various ways that are crossing over, mutations caused during crossing over, and independent assortment.

Independent assortment helps in getting half number of chromosomes. In meiosis, crossing over takes place in prophase 1 which results in recombination by an exchange in the arms of chromosomes.

Glycogen in the________________is broken down and released when blood glucose is low.

Answers

Answer:

a

Explanation:

what factors are responsible for increasing the size of a population?

Answers

Answer:

Economic development

Explanation:

There are several factors that can contribute to the growth of a population. These include:

1. Natural increase: This refers to the difference between the number of births and the number of deaths in a population. If the number of births is greater than the number of deaths, the population will grow.
2. Immigration: If people move into a population from other areas, it can contribute to population growth.
3. High fertility rates: A high fertility rate, or the average number of children a woman has during her reproductive years, can also contribute to population growth.
4. Increased life expectancy: If people are living longer due to advances in medicine and public health, the population will grow.
5. Changes in social norms: Changes in social norms, such as the acceptance of smaller families, can also impact population growth.

It's worth noting that population growth is not always a positive thing, as it can put strain on resources and the environment. Some countries have implemented policies to encourage smaller families and slow population growth.

Pls award brainliest!

Which is NOT true about cells?


Question 5 options:


(A)Cells are in all living things



(B)Every type of cell performs the same function



(C)Cells can reproduce



(D)Cells take in food and use energy

Answers

B is not true

Hope this helps!

Answer: B

Explanation: Theres different type of cells that perform variety functions in the body

Other Questions
An expectant mother is eight months pregnant. She has no other children. You see the mother smoking marijuana every day and you are concerned about the unborn child. Does this meet the legal criteria for DCFS to investigate abuse or neglect? A local magazine, available by subscription and at newsstands, mailed a comment card to each of its subscribers. it asked the readers how satisfied they were with the magazine's coverage of local events and interests. based on the information received from the comment cards, the magazine created a television ad saying that 97% of its readers were extremely satisfied with the content of the magazine. why might this sample be biased? Suree is studying to be a clinical psychologist from an accredited program. She will learn that, with respect to bias in diagnosing clients, ____. 10 americans consumers get of all their calories from food outside the home, 30 percent 25 percent 10 percent 75 percent mark this and return save and exit next A company is evaluating which of two alternatives should be used to produce a product that will sell for $35 per unit. the following cost information describes the two alternatives: process a process b fixed cost $500,000 fcb variable cost per unit $25 $23 what must be the fixed cost for process b, fcb, so that the breakeven for process b is 10% larger than for process a Solve for x. Leave your answer as a fraction.4x-2/5 = 2/7 What is 3/100 - 1/50 equal? your patient is considerably overweight. as you measure the patient's body weight, what should you do? Which of the following compounds is held together by covalent bonds?KBrCaoLIFSO Which of the following is not true of Christian art after the Edict of Milan? A. The art included Christian symbols, such as the cross and the Good Shepard b. Mosaics freely covered church walls and ceilings. C. Sculptures rarer than paintings d Artists used bright colors and shading myths about the constitution can a. become revered and should never be challenged.b. broaden the scope of the constitution.c. aid in the interpretation of the constitution.d. cloud the proper interpretation of the document. Please help me, I need to turn this in soon! Experts estimate that when levees break in the aftermath of a hurricane, water can flow into a city at a peak rate of 8 billion gallons per day. There are 7.5 gallons in 1 cubic foot. Find the flow rate in units of cubic feet per second (cfs). Compare this flow rate to a river with an average flow rate of 25000cfs. The flow rate is ___ cfs, which is approximately _____% of the flow rate of the river. (Round to the nearest whole number as needed.) a store marks up their merchandise by 70%. a customer buys a lampshade for $17.00, a rug for $88.40, a sculpture for $47.60, and he has a 20% off entire purchase coupon. how much profit did the store make from this customer? to move means to copy a selected item to the clipboard, leaving the item in its original location. Conditional probabilities. Suppose that P(A) = 0.5, P(B) = 0.3, and P{B \ A) = 0.2. Find the probability that both A and B occur. Use a Venn diagram to explain your calculation. What is the probability of the event that B occurs and A does not? Find the probabilities. Suppose that the probability that A occurs is 0.6 and the probability that A and B occur is 0.5. Find the probability that B occurs given that A occurs. Illustrate your calculations in part (a) using a Venn diagram. Wholemark is an Internet order business that sells one popular New Year greeting card once a year. The cost of the paper on which the card is printed is $0.40 per card, and the cost of printing is $0.10 per card. The company receives $3.75 per card sold. Since the cards have the current year printed on them, unsold cards have no salvage value. Their customers are from the four areas: Los Angeles, Santa Monica, Hollywood, and Pasadena. Based on past data, the number of customers from each of the four regions is normally distributed with mean 2,300 and standard deviation 200. (Assume these four are independent.)What is the optimal production quantity for the card? the nurse is assessing the throat of a client with throat pain. in asking the client to stick out the tongue, the nurse is also assessing which cranial nerve? consider the reaction 5br(aq) bro3(aq) 6h (aq)3br2(aq) 3h2o(l)5br(aq) bro3(aq) 6h (aq)3br2(aq) 3h2o(l) the average rate of consumption of brbr is 2.06104 m/sm/s over the first two minutes. what is the average rate of formation of br2br2 during the same time interval? express your answer with the appropriate units. A researcher in a personal submarine begins at the surface of the Ocean. The submarine descends 20.6 meters and then ascends 5 7/10 meters. What is the depth of the personal submarine? mariana is giving an informative speech about the experiences of undocumented immigrants living in the united states. from the following options, pick the two statements that best build marianas speaker credibility?