What kinds of behaviors exhibited by elementary-age students can
be indicators that they are dealing with literacy challenges?
Explain.
DO NOT COPY AND PASTE!!! WRITE IN YOUR OWN WORDS AND IT MUST BE

Answers

Answer 1

Elementary-age students dealing with literacy challenges may exhibit certain behaviors that can serve as indicators. These behaviors include struggling with reading fluency, difficulty comprehending texts, limited vocabulary usage, avoidance of reading or writing tasks, and showing frustration or lack of confidence in literacy-related activities.

When elementary-age students are facing literacy challenges, their behaviors can provide clues to their struggles. One common indicator is a difficulty with reading fluency, where students may read slowly, stumble over words, or have trouble decoding unfamiliar words. Comprehension difficulties can manifest as an inability to understand the main idea, draw inferences, or answer questions about the text. Limited vocabulary usage is another sign, as students may struggle to find and use appropriate words to express themselves.

Avoidance of reading or writing tasks, such as reluctance to participate in class discussions or complete written assignments, can also suggest literacy challenges. Additionally, students may show frustration, lack of confidence, or low self-esteem when engaging in literacy-related activities, further highlighting their struggles. These behaviors can serve as valuable indicators for educators and parents to identify and address literacy challenges in elementary-age students.

To learn more about fluency click here :

brainly.com/question/23761870

#SPJ11


Related Questions

Which sentence expresses the most common criticism of reality TV?

⇒ It teaches younger viewers that privacy is not something they should value.
⇒ Its non-actors often aspire to become real actors, so they are overly dramatic.
⇒ Its format actually prevents the cast from representing reality in an authentic way.
⇒ It represents a narrow segment of society rather than the diversity of human life.

Answers

The option with the most common criticism of reality TV is C, "Its format actually prevents the cast from representing reality in an authentic way."

What is reality TV?

The term reality TV is used to refer to shows where events are supposedly not rehearsed or planned. Participants are not supposed to be actors playing a role, but ordinary people showing their true colors, feelings, and behavior.

However, that is not what we normally get. The most common criticism about reality TV is that it is not real at all. The shows have a specific format that keep people from acting the way they normally would. Producers often force conversations, issues, and situations to happen. Finally, what we see on the screen in a heavily-edited product.

With that in mind, we can safely select option C as the right answer for this question. Reality TV is frequently not real at all.

Learn more about reality TV here:

https://brainly.com/question/21110407

#SPJ1

White a poem with the 8 main types of speech.

Answers

My love is a red, red rose, I tell you that. "The moon was a spectral galleon tossing on foggy waters. Across the purple moor, the road was a ribbon of moonlight. "The fog moves in tiny cat-like steps.

The eight most common figures of speech are what?

The following are examples of figures of speech used in English grammar: simile, metaphor, personification, apostrophe, alliteration, assonance,  hyperbole and Euphemism.

What is an eight-stanza poem?

Octave. eight iambic pentameter lines, or lines with ten syllable beats each, make up a stanza. Many different rhyme and metre patterns can be found in stanzas with more lines.

To know more about figures of speech.visit:

https://brainly.com/question/12645975

#SPJ1

What’s the gist???? Plz helppp...10pointss

Whats the gist???? Plz helppp...10pointss

Answers

Answer:

Gist- the substance or essence of a speech or text.

Hope this helps : )       good luck!

NEED HELP NOW Which items indicate that a
source is not effective? Select
the two correct answers.
(1 point)
O
It comes from
experts in the field.
You can find other
O sources with the
same information.
O It is relevant.
It gives information
on a different topic.
It is based on
opinion.

Answers

Answer:

D.) It gives information on a different topic.

E.) It is based on opinion.

Explanation:

In order for a source to be effective, it must be reliable, relevant, and supported with credible evidence. In this case, the answers above don't represent a viable source and may be untrustworthy. I hope this helps! ^-^

If It gives information on a different topic and if it is based on opinion, then the source is not effective.

A source must be trustworthy, pertinent, and backed up by verifiable facts in order to be successful. The answers given above in this situation don't reflect a reliable source and might not be reliable.

Therefore, the source is not effective and reliable if it gives information on a different topic and if it is based on an individual's opinion.

Hence, something that originates, occurs, or is acquired is called source: For example, the start or starting point of a stream or river. a source of knowledge, such as a book, statement, person, etc. the entity or person who is paying dividends or interest.

To learn more about Sources, click on the given link:
https://brainly.com/question/25578076

#SPJ13

Which version of the underlined text in sentence 8 (reproduced below) provides commentary that logically connects to the evidence in the paragraph?

Governments can forge alliances between countries, but the particular officials charged with doing so vary from country to country.

Answers

The version of the underlined text in sentence 8 which provides commentary that logically connects to the evidence in the paragraph is that these acts do not necessarily encourage feelings of closeness between the countries' citizens.

How to illustrate the information?

It was stated that governments can form alliances between countries, although the authorities in charge of doing so differ by country. People's capacity to travel overseas to genuinely comprehend what it's like in other countries is sometimes hampered by economic considerations.

So, the version of sentence 8 that logically connects to the information from the paragraph is Governments can form alliances between countries, but these activities do not always foster emotions of closeness among the populations of the countries.

This indicates that, despite the fact that both cities are sister cities and have a political and cultural collaboration, the residents of those countries do not feel any connection or closeness to the citizens of the other city. This must be built in a different way than through good ties amongst diplomats.

Learn more about government on:

https://brainly.com/question/1078669

#SPJ1

Complete question

Which version of the underlined text in sentence 8 (reproduced below) provides commentary that logically connects to the evidence in the paragraph? Governments can forge alliances between countries, but the particular officials charged with doing so vary from country to country. (as it is now) people often have to travel abroad to truly understand what it is like in other countries their ability to do so can be constrained by economic conditions and other factors these acts do not necessarily encourage feelings of closeness between the countries' citizens the strength of those alliances can be dependent on interactions among the countries' diplomats

5 Glass Menagerie Questions. Please help!



Which word best describes both Tom and Amanda?


Controlling


Frail


Aggressive


Gentle



In Amanda's view, her nagging behavior toward her children is motivated by?


Dreams


Religion


Illusion


Love



Amanda pretends that Laura has made dinner when Jim visits so that


Jim will not mention his engagement to Betty


Amanda can pretend that Laura is a good cook


Laura looks like she would make a good wife


Jim will not know how shy Amanda is




Jim feels _______ about his future


Unsure


Optimistic


Puzzled


Indifferent




How does Tom feel about his sister?


Disrespectful


Resentful


Loving


Unrealistic

Answers

In "The Glass Menagerie," the answers to the questions are as follows:

Which word best describes both Tom and Amanda?

The word that best describes both Tom and Amanda is "frail." Both characters exhibit a sense of vulnerability and fragility in their lives.

In Amanda's view, her nagging behavior toward her children is motivated by?

Amanda's nagging behavior toward her children is motivated by "love." She believes that her constant nagging and interference is a way to protect and guide her children, even though it may come across as overbearing and controlling.

Amanda pretends that Laura has made dinner when Jim visits so that

Amanda pretends that Laura has made dinner when Jim visits so that "Jim will not know how shy Amanda is." Amanda tries to create an illusion of normalcy and domestic competence by making it seem like Laura has prepared the dinner, hiding her own insecurities and shyness.

Jim feels _______ about his future

Jim feels "unsure" about his future. He is uncertain about his career prospects and personal ambitions, which contributes to his sense of uncertainty and indecisiveness.

How does Tom feel about his sister?

Tom feels "loving" towards his sister. Although he sometimes expresses frustration and resentment towards his family situation, there is an underlying bond of love and responsibility that he feels towards his sister, Laura.

HOLLYWOOD DREAMS OF WEALTH, YOUTH, AND BEAUTY

Answers

Answer: facts ong

Explanation: facts ong

Answer: omg

Explanation:yes

What does the word vintage mean in paragraph 2?

What does the word vintage mean in paragraph 2?

Answers

Answer:

when something is old, but in high quality

for example "Be careful! that vase is vintage!"

Explanation:

It's really easy

I hope this helps <3

vintage is just a word for like old fashioned and that means that the apartment is in an old fashioned town

BRAINLIEST FOR FIRST CORRECT ANSWER
Lost City of Z:
Who may have been responsible for the spilling of the blood that the ring had supposedly been bathed in?

Answers

Legends describing her vampiric tendencies, such as the tale that she bathed in the blood of virgins to continue her youth, were commonly recorded years after her loss of life and are viewed unreliable.

Which queen bathed in blood?

Báthory is often proclaimed the most prolific female serial killer of all time, accused of slaying greater than 600 young women inside her lavish castles. According to legend, she believed bathing in their virginal blood would furnish her eternal youth. Instead, it guaranteed she lived long in infamy.

Does the Queen have distinctive blood?

Speaking to Yahoo's The Royal Box, royal specialist Duncan Larcombe said: "If it's the Queen on tour, the royal doctor is with them with a bag full of their own blood."

Learn more about blood here;

https://brainly.com/question/872638

#SPJ1

the official latin motto of the nato alliance translates into what in english?

Answers

At the farewell address of a leaving NATO official or a country representative, the motto "animus in consulendo libre" is frequently cited which is translated into: "In conversation, a free mind"  in English.

The North Atlantic Treaty of April 4, 1949, which aimed to provide a counterbalance to Soviet soldiers stationed in central and eastern Europe following World War II, resulted in the formation of the North Atlantic Treaty Organization (NATO), a military alliance. 30 nations from North America and Europe are its members.

The motto stayed on conference room 16, displayed on its wall until 1987 when construction forced its removal. The NATO motto is displayed on the wall of the Council Room at the new NATO Headquarters due to its enduring appeal.

To learn more about NATO, refer to:

https://brainly.com/question/29553298

#SPJ4

please help me if youre good w english instructions:
Write an essay explaining one way people can work together to make a difference. Today write a 4 square, and
the introduction paragraph. Make sure your thesis is specific and an argument. Work on a hook and place your
thesis as the last sentence of the introduction paragraph.

Answers

Answer:

In today's world, a lot can be said about making a difference. People who believe that they can make a difference are the people who shape our society today. Those individuals have helped us in bettering the world we have today.

Making a difference was just as important over a hundred years ago as it is today. It is important to keep in mind that one person can and has made a difference. Take for example Rosa Parks and Martin Luther King in the Civil Rights movement. I want to make an impact on the world much like theirs and change the views of our society.

I have, for the majority of my life, lived a sheltered life, and have never realized how corrupt our society really was. Our nation has, in some ways, proved to be without moral. In fact, the entire world is based on "the rich get richer" theory.

Explanation:

Which revision in a technical document would help make the document clearer and more concise?

A.
changing the sentences from active voice to passive voice
B.
using terms specific to the subject or industry
C.
substituting formal words with simpler ones
D.
including “to be” verbs wherever possible

Answers

Answer:

B

Explanation:

By using terms specific to the subject, the author shows a greater understanding of the topic and the audience will know what the author is trying to talk about.

Without using terms, you would sound like you dont quite know what youre writing about.

FILL IN THE BLANK. during the 19th century, charles dickens ______ one of the most famous british novelists

Answers

During the 19th century, Charles Dickens became one of the most famous British novelists.

A novelist is a person who writes novels. The key to success as a romantic novelist is absolute belief in your story. Author Ian Watt, and numerous others for that matter, generally credit Daniel Defoe as being the author of the first English novel.

One of the most- read authors of the puritanical period, Charles Dickens wrote over a dozen novels in his career, as well as short stories, plays and nonfiction. He's presumably best known for his memorable cast of characters, including Ebenezer Scrooge, Oliver Twist and David Copperfield.

To learn more about Charles Dickens here

brainly.com/question/13748995

#SPJ4

Which THREE lines in this excerpt from "Song of Myself" by Walt Whitman indicate that all human beings are equal in the poet's eyes?

Which THREE lines in this excerpt from "Song of Myself" by Walt Whitman indicate that all human beings

Answers

I am a poet who believes that women are just as important as men, and I believe that nothing is more important than a woman's role as a mother to her children.

What does Whitman have to say about humans in Song of Myself?

According to him, the only right way to live is to treat everyone equally and as if they were all children of the same God. Whitman thought that everything in life was flawless, regardless of what it was or where it was, and that each element was special in its own way.

People have voices that Whitman can hear?

Whitman argues that avarice, want, moaning and complaining about one's circumstances, discontent, hypocrisy, and self-centeredness are examples of human vices.

To know more about "Song of Myself"  visit:-

https://brainly.com/question/10708575

#SPJ1

Which traits best describe Chief Joseph and Eli? A obedient and shy. B loyal and honest. C intelligent and funny. D brave and kind.

Answers

Answer: D

Explanation: The theme the story is that even if you run or hide or help your enemy it still takes bravery to do that and also there kind cause they did not want to hurt there enemy. Afterwards my teacher checked my answer and said it was correct.  

Answer:

D

Explanation:

Which sentence in this excerpt from "Common Sense" by Thomas Paine proposes that the American colonies should be neutral in their relationships with foreign nations?

I challenge the warmest advocate for reconciliation, to shew, a single advantage that this continent can reap, by being connected with Great Britain. I repeat the challenge, not a single advantage is derived. (Our corn will fetch its price in any market in Europe, and our imported goods must be paid for, buy them where we will.)

But the injuries and disadvantages we sustain by that connection, are without number; and our duty to mankind at large, as well as to ourselves, instruct us to renounce the alliance: Because, any submission to, or dependence on Great Britain, tends directly to involve this continent in European wars and quarrels; and sets us at variance with nations, who would otherwise seek our friendship, and against whom, we have neither anger nor complaint. (As Europe is our market for trade, we ought to form no partial connection with any part of it.) It is the true interest of America to steer clear of European contentions, which she never can do, while by her dependence on Britain, she is made the make-weight in the scale of British politics.

Europe is too thickly planted with kingdoms to be long at peace, and whenever a war breaks out between England and any foreign power, the trade of America goes to ruin, BECAUSE OF HER CONNECTION WITH ENGLAND. (The next war may not turn out like the last, and should it not, the advocates for reconciliation now, will be wishing for separation then, because, neutrality in that case, would be a safer convoy than a man of war.) Every thing that is right or natural pleads for separation. The blood of the slain, the weeping voice of nature cries, 'TIS TIME TO PART. Even the distance at which the Almighty hath placed England and America, is a strong and natural proof, that the authority of the one, over the other, was never the design of Heaven. (The time likewise at which the continent was discovered, adds weight to the argument, and the manner in which it was peopled increases the force of it.) The reformation was preceded by the discovery of America, as if the Almighty graciously meant to open a sanctuary to the Persecuted in future years, when home should afford neither friendship nor safety.

Answers

Answer:

 As Europe is our market for trade, we ought to form no partial connection with any part of it.

1.2.3 Quiz: Understand Setting, Character, and Dialogue
Question 7 of 10
Read this sentence:
Squeezing his eyes shut, Ted clutched the armrest as he
waited for the dentist to arrive.
What method of characterization does the sentence use to describe the
character?
A. Appearance
B. Thoughts
C. Dialogue
D. Action

Answers

Answer:The method of characterization used in the sentence is D

Explanation:

. Action. The description of the character Ted squeezing his eyes shut and clutching the armrest conveys his emotional state and physical reaction to the situation, which helps to build his character.

A paragraph about Martin Luther King Jr

Answers

Answer:

Martin Luther King Jr. (January 15 1929-April 4, 1968) Brief Summary (of who MLK Jr. is): Martin Luther King Jr. was a Baptist minister and an activist who led the civil rights movement in the 1950. He was a fundamental force behind the civil rights movement that ended legal segregation. He was awarded the Nobel Peace Prize in 1964.

Explanation:

Answer:

As the leader of the nonviolent Civil Rights Movement of the 1950s and 1960s, Martin Luther King Jr. traversed the country in his quest for freedom. His involvement in the movement began during the bus boycotts of 1955 and was ended by an assassin's bullet in 1968.

Explanation:

Put the word utility in a sentance

Answers

Answer: The utility of the product can solve most of your problems.

Explanation: The word utility means usefulness.

In the sentence, the product's usefulness is described as having the capacity to solve most of the problems.

Find an image, like an advertisement or a piece of art, that you think takes a position on something. Describe the content of the image. What position does the image take? What reasons or evidence are provided for the position? How does the image connect to audience values? What do you think the creators of the image are trying to accomplish? Do you think the image is effective? Why or why not? Be sure to include a link to your image in your response.

Answers

The image found is the new Coca-Cola company ad, titled "Open that Coca-Cola". The content of the image shows two young men in an office, wearing headphones, sitting in gamer chairs and drinking a Coke.

In the image, it is not possible to identify whether young people are working or using computers for leisure, but the construction of the ad symbolizes the new digital reality and the connection of drinking in the current scenario.

This ad was created to highlight the soft drink as an icon of pleasure in terms of taste and consumption experience.

The creators of the image are trying to portray that Coca-Cola despite being a classic drink, is:

JovialAdaptableInnovativeModern

Therefore, the image reaches the target audience, as the advertising highlights the positive characteristics of the product in line with the reality and tastes of its audience.

Learn more here:

https://brainly.com/question/24967768

Find an image, like an advertisement or a piece of art, that you think takes a position on something.

what is a destination you would never visit, and why?​

Answers

France. I have never hated a country as much as France. They are so Islamophobic and banned the hijab and nikab. How can I visit a country where I can't wear my own scarf.

i don't want it sold to children! that's an infamia. in my city, we would keep the traffic in the dark people, the coloreds.

Answers

Answer:

specify the question pls

Why is educational reimbursement a valuable benefit for employees?

Answers

Educational reimbursement is a valuable benefit for employees because it helps them improve their skills and knowledge. With this benefit, employees can receive financial support to pursue education or training that is relevant to their current job or future career goals. This can help employees expand their skill set, increase their marketability, and advance their careers. Additionally, educational reimbursement shows employees that their employer values their professional growth and is invested in their success. This can lead to increased job satisfaction, loyalty, and motivation among employees. Overall, educational reimbursement is a win-win for both employees and employers, as it benefits both parties and contributes to the success and growth of the organization.

(1) One morning, when Gregor Samsa woke from troubled dreams, he found himself transformed in his bed into a horrible vermin. He lay on his armour-like back, and if he
ufted his head a little he could see his brown belly, slightly domed and divided by arches into stiff sections. The bedding was hardly able to cover it and seemed ready to slide
off any moment. His many legs, pitifully thin compared with the size of the rest of him, waved about helplessly as he looked.
(2) "What's happened to me?" he thought. It wasn't a dream. His room, a proper human room although a little too small, lay peacefully between its four familiar walls. A
collection of textile samples lay spread out on the table-Samsa was a travelling salesman--and above it there hung a picture that he had recently cut out of an illustrated
magazine and housed in a nice, gilded frame. It showed a lady fitted out with a tur hat and tur bon who sat upright, raising a heavy fur mult that covered the whole of her lower
arm towards the viewer
(3) Gregor then turned to look out the window at the dull weather. Drops of rain could be heard hitting the pane, which made him foel quite sad. "How about if I sleep a little bit
longer and forget all this nonsense," he thought, but that was something he was unable to do because he was used to sleeping on his right, and in his present state couldn't
get into that position. However hard he threw himself onto his right, he always rolled back to where he was. He must have tried it a hundred times, shut his eyes so that he
wouldn't have to look at the floundering legs, and only stopped when he began to feel a mild, dull pain there that he had never felt before,
Read the sentence from the passage and answey the question that follows:
His room, a proper human room although a little too small, lay peacefully between its four famillar walls.
What does the word "proper In this passage suggest about Gregor's room?
It has a window and a door to allow light in.
O it is a decorous and trendy room for entertaining.
It is a normal room, functioning as a bedroom
It is room where Immorality takes place

Answers

Answer the excerpt from "The Most Dangerous Game,” by Richard Connell.

His foot touched the protruding bough that was the trigger. Even as he touched it, the general sensed his danger and leaped back with the agility of an ape. But he was not quite quick enough; the dead tree, delicately adjusted to rest on the cut living one, crashed down and struck the general a glancing blow on the shoulder as it fell; but for his alertness, he must have been smashed beneath it. He staggered, but he did not fall; nor did he drop his revolver. He stood there, rubbing his injured shoulder, and Rainsford, with fear again gripping his heart, heard the general's mocking laugh ring through the jungle.

Which analysis best explains the effect of adding the female character

Explanation:

01:45:10
Which conclusion about the picture below is probably true?
El Azizia, Libya
a
b
The temperature at night is cold.
This place gets very little rain each year.
The temperature can rise to more than 100° F


all of the above
d
Next
Suban
Save and Exit
Mark this and return
look

01:45:10Which conclusion about the picture below is probably true?El Azizia, LibyaabThe temperature at

Answers

Answer:

Pretty sure it is D, all of the above.

Explanation:

At night it would get cold because there is little cover.

It is in a desert so it is hot outside.

Also it is in a desert so there is little rain.

I hope this helps, and brainliest would be nice.

Answer:

alll

Explanation:

ya girl smart

Which revision of this sentence uses commas correctly?A)Looking fearfully over his shoulder, Francis slowly opened the book that he had been expressly forbidden to read by his English teacher.B)Looking fearfully over his shoulder, Francis slowly opened the book that he had been expressly forbidden to read, by his English teacher.C)Looking fearfully over his shoulder, Francis slowly opened, the book that he had been expressly forbidden to read by his English teacher.D) looking fearfully over his shoulder, Francis slowly opened, the book that he had been expressly forbidden to read, by his English teacher

Answers

Answer:

The answer is A

Explanation: I just had this question on USA Test Prep and got it.





Many companies in the United States went out of business during the Great Depression. Which type of business would have been likely to have felt the LEAST economic impact from the Great Depression?

A) banks

B) hotels

C) car dealerships

Eliminate

D) electric companies

Answers

Answer:D

Explanation:

You still have to pay bills

i think not sure

Answer:

electirc companies

Explanation:

i took the test and got an 100

With which statement would the artist and the author be most likely to agree?

In times of darkness, look for a light.
Sometimes freedom is worth fighting for.
Show appreciation to those who help protect others.
Independence is necessary to thrive.

With which statement would the artist and the author be most likely to agree?In times of darkness, look

Answers

Answer:

I think I'll go with the first one that is in times of Darkness look for the light

The statement "in times of darkness, look for a light" artist and the author would be most likely to agree. The correct option is 1.

Who is an artist?

An artist is someone who creates works of art such as paintings, sculptures, music, literature, or film.

Artists frequently use their work to express themselves or to communicate their ideas, emotions, or experiences to others.

Both the artist and the author are likely to agree with the statement "In times of darkness, look for a light" because their work frequently expresses themes of hope and finding light in dark times.

The artist may convey this message through the use of bright colours or images of nature, whereas the author may convey this message through literary devices such as symbolism or imagery.

Additionally, both the artist and author might believe that finding a source of light or hope is necessary for individuals to overcome challenging times and find meaning in their lives.

Thus, the correct option is 1.

For more details regarding an artist, visit:

https://brainly.com/question/28804451

#SPJ2

How does Rainsford finally escape from Zaroff?
a. Rainsford jumps into the ocean and swims out to sea.
b. Rainsford jumps into the ocean and swims back to Zaroff’s mansion.
c. Rainsford stabs Zaroff while out in the jungle.
d. Rainsford tricks the dogs into attacking Zaroff.

Answers

Rainsford jumps into the ocean and swims out to sea to escape from Jaroff. So the option a is correct.

In a desperate attempt to escape the menacing Zaroff, Rainsford bravely decided to dive into the water. In an effort to elude Zaroff, he took advantage of the night's darkness by jumping into the water and swimming out to sea. He was aware that if he wanted to survive, he had to travel far.

Rainsford struggled mightily to escape Zaroff as he swam throughout the night, pushing himself beyond his physical and mental limits. The ocean's depths were unexplored and unknown, and Rainsford was unsure of the perils he would encounter there. He persisted, swimming for hours on end, until he was sufficiently removed from his pursuer for him to feel secure. So the option a is correct.

To learn more about Rainsford link is here

brainly.com/question/17166470

#SPJ4

Complete the conversation. Use the present simple or present continuous of the verbs in the box be do film finish fly leave meet not do start A: B: A: B: A: B: A: B: A: B: Hi, Jo. This is David. Do you want to meet for lunch today? I can't. I have an audition this afternoon. They (34) ………………………………………. A scene for a TV series in town next week and they need extras. Wow! And what time (35) ………………………………………. The audition? It (36) ………………………………………. At twelve o'clock, but I don't know exactly when it (37) ………………………………………. Well, (38) ………………………………… you ……………………………… anything tonight? I (39) ………………………………………. Some friends tonight, actually. What about tomorrow? I (40) ………………………………………. To Munich tomorrow. Don't you remember? Of course. What time (41) ………………………. Your flight ………………………….? At two. But I (42) ………………………………………. Anything in the morning. You could help me pack my bags!

Answers

Answer:

A: Hi, Jo. This is David. Do you want to meet for lunch today?

B:  I can't. I have an audition this afternoon. They (34) are filming A scene for a TV series in town next week and they need extras.

A: Wow! And what time (35) is The audition?

B:  It (36) starts  At twelve o'clock, but I don't know exactly when it (37) finishes

A: Well, (38) are you doing anything tonight?

B: I (39) am meeting Some friends tonight, actually. What about tomorrow?

A: I (40) am flying To Munich tomorrow. Don't you remember?

B: Of course. What time (41) does Your flight leave?

A:  At two. But I (42)am not doing Anything in the morning. You could help me pack my bags!

Explanation:

We use the present simple to talk about habits, facts and arranged timetables like the train or flight schedules.

To write affirmative sentences in present simple:

He/she/it + verb +s

For example, He eats lunch at noon every day.

We/you/they/you +verb

For example, We eat lunch at noon every day.

Note that the verb is without the s.

To write negative sentences in present simple:

He/she/it + does not / doesn't + verb

For example, He doesn't like broccoli.

We/you/they/you + do not / don't +verb

For example, We don't like broccoli.

To write questions in present simple:

Does + he/she/it + verb ?

For example, Does he like chocolate?

Do + we/you/they/you + verb?

For example, do you like chocolate?

36, 37, and 41 use the present simple to talk about timetables and schedules regarding the audition and flights.

We use the present continuous to talk about ongoing actions at the moment or arranged plans for the future.

To write affirmative sentences in present continuous:

He/she/it + is +verb +ing

For example, He is cooking dinner at the moment.

We/you/they/you + are + verb +ing

For example, We are leaving tomorrow.

To write negative sentences in present continuous:

He/she/it + is not / isn't +verb +ing

For example, he isn't cooking dinner at the moment.

We/you/they/you + are not/ aren't + verb +ing

For example, We aren't leaving tomorrow.

To write questions in present continuous:

Is + he/she/it +verb +ing?

For example, Is he cooking dinner at the moment?

Are + we/you/they/you + verb +ing?

For example, are you leaving tomorrow?

34, 35, 38, 39, 40, and 42 use the present continuous to talk about plans for the future. The main difference with the present simple in this aspect is that even though we can use both tenses to talk about the future, the present simple is for timetables and the present continuous, for plans or arranged dates that we or others make.

 

Other Questions
Consider the role of photosynthetic protists as producers in aquatic ecosystems. (Review the discussion in Concept 28.6.) What factors in addition to light availability are likely to limit primary production in the oceans? Don't scam for points ...Read the excerpt from The Diary of Anne Frank.Miep. I made up the beds . . . the way Mr. Frank and Mr. Kraler said. (She starts out.) Forgive me. I have to hurry. I've got to go to the other side of town to get some ration books for you.Mrs. Van Daan. Ration books? If they see our names on ration books, they'll know we're here.Mr. Kraler. There isn't anything . . .Miep. Don't worry. Your names won't be on them. (As she hurries out) I'll be up later.Why is it important that the Van Daan and Frank family names do not appear on the ration books?The families do not believe in the ration books system, because it is unfair.The families are getting extra rations, and they do not want anyone to know.The families are in hiding, so no one can know they are receiving rations.The families do not understand the ration system, so they do not want to be a part of it. How do T.J.s relationships develop the theme of friendship in this chapter of Roll of Thunder, Hear My Cry? T.J.s relationships show that what a friend says is more important than how a friend acts. T.J.s relationships show the difference between true friendship and false friendship. T.J.s relationships show that it is easy to make friends with many different people. T.J.s relationships show what true friendships and false friendships have in common. Archaeologist Serena Ensoli asserts that the lost namesake of the Roman Colosseum-a statue called theColossus Neronis-might have fallen prey to a historic makeover. She believes the Colossus Neronis,which represented the Emperor Nero as a sun god, may actually lie camouflaged inside a gigantic bronzesculpture dedicated to the emperor Constantine the Great. The only remains of the Constantine sculpture,on display at the Capitoline museums in Rome, are three fragments: the head, the left hand, and a sphere.In ancient Rome, it was normal practice for older statues to be altered to reflect the current emperor.Ensoli believes this is what happened to Neronis, and she cites chronology to support her conclusion.Constantine's features would have appeared last because Constantine lived after Nero, from A.D. 285-337.QuestionThe purpose of the passage is toO compare and contrast sculptures of Nero and Constantinedescribe an archeological theory of Serena EnsoliO explain why the ancient Romans altered statues of their former emperorsO determine how a statue of Constantine became fragmented He proceeded as if I (can not) If temperature is held constant and we decrease the volume from a hypothetical 105 mL to 65 mL our pressurewould increase or decrease) from 11.5 atm to what atmospheric pressure? the two internal dimensions represented on the axes of the space matrix are WILL GIVE BRAINLESTWater waves in a small tank are 6.0 cm long. They pass at a given point at a rate of 4.8 waves per second. What is the speed of the wave? Sara puts $4,000 into an investment yielding 5% annual simple interest; she left the money in for five years and 6 months. How much interest does Sara get at the end of those five years and 6 months? midi (musical instrument digital interface) allows ________ to interact with computers. When this pet hamster is placed on a digital scale, the scale reads 1.5. What unit of measurement can be used? * Question 8 Status: Answer saved | Points possible: 1.00 Would the pH at the equivalence point be acidic, basic, or neutral for each given titration? HC104 with Ba(OH)2 Acidic CH, CH, OH with Sr(OH)2 Basic HCl with NH3 Acidic What aspects of modern law, such as that practice in the United States, began in classical Rome? In late 2020, the Nicklaus Corporation was formed. The corporate charter authorizes the issuance of 6,000,000 shares of common stock carrying a $1 par value, and 2,000,000 shares of $5 par value, noncumulative, nonparticipating preferred stock. On January 2, 2021, 4,000,000 shares of the common stock are issued in exchange for cash at an average price of $10 per share. Also on January 2, all 2,000,000 shares of preferred stock are issued at $20 per share.Required:1. Prepare journal entries to record these transactions.2. Prepare the shareholders' equity section of the Nicklaus balance sheet as of March 31, 2021. (Assume net income for the first quarter 2021 was $1,750,000.)Part BDuring 2021, the Nicklaus Corporation participated in three treasury stock transactions:On June 30, 2021, the corporation reacquires 250,000 shares for the treasury at a price of $12 per share.On July 31, 2021, 25,000 treasury shares are reissued at $15 per share.On September 30, 2021, 25,000 treasury shares are reissued at $10 per share.Required:1. Prepare journal entries to record these transactions.2. Prepare the Nicklaus Corporation shareholders' equity section as it would appear in a balance sheet prepared at September 30, 2021. (Assume net income for the second and third quarter was $3,250,000.)Part COn October 1, 2021, Nicklaus Corporation receives permission to replace its $1 par value common stock (6,000,000 shares authorized, 4,000,000 shares issued, and 3,800,000 shares outstanding) with a new common stock issue having a $0.50 par value. Since the new par value is one-half the amount of the old, this represents a 2-for-1 stock split. That is, the shareholders will receive two shares of the $0.50 par stock in exchange for each share of the $1 par stock they own. The $1 par stock will be collected and destroyed by the issuing corporation.On November 1, 2021, the Nicklaus Corporation declares a $0.18 per share cash dividend on common stock and a $0.35 per share cash dividend on preferred stock. Payment is scheduled for December 1, 2021, to shareholders of record on November 15, 2021.On December 2, 2021, the Nicklaus Corporation declares a 1% stock dividend payable on December 28, 2021, to shareholders of record on December 14. At the date of declaration, the common stock was selling in the open market at $10 per share. The dividend will result in 76,000 (0.01 7,600,000) additional shares being issued to shareholders.Required:1. Prepare journal entries to record the declaration and payment of these stock and cash dividends.2. Prepare the December 31, 2021, shareholders' equity section of the balance sheet for the Nicklaus Corporation. (Assume net income for the fourth quarter was $2,750,000.)3. Prepare a statement of shareholders' equity for Nicklaus Corporation for 2021. If a factor of a polynomial is x-5, what is the zero? WILL GIVE BRANLIEST !Case #28104Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.Part TwoCopy the DNA sequences for each suspect into a Word document.Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.Repeat step 1 with the DNA samples for Suspects B and C.Suspect ATCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGASuspect BTCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGASuspect CTTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGAProbeAGGTQuestionsAnswer these following questions in the essay box below.1. Which suspect most likely committed the robbery?2. How do you know? Alli Babu Sdn Bhd has sales of RM 1,400,000, cost of goods sold of RM454,200, and a net profit margin of 5.5 percent. The balance sheet shows common stock of RM360,000 with a par value of RM6 a share, retained earnings of RM689,500 and its sales per share is RM23.33. What is the price-sales ratio if the market price is RM50 per share? According to random-walk theory, what are the odds that a stock will increase in price after having increased on two consecutive days of trading? A) 0% B) 25% C) 50% D) 100% According to the information presented in the lesson, some middle school students see the value of homework but believe that __________. A.it is more valuable for elementary school students B.parents should be more involved in helping them complete their work C.it should only involve multiple choice worksheets D.teachers should work together to make sure students do not receive an excessive amount Required information Breach of Contract and Remedies When one party fails to perform as agreed, the Uniform Commercial Code (UCC) defines that fallure as a breach of contract and makes a distinction between a total breach and a partial breach. The UCC also provides recourse for the nonbreaching party to recover damages. The alternative recourses are known as remedies and certain relief is available for specific types of breaches. Roll over the item to read a hint about what type of damages best matches the item. Then click and drag each item to its correct category of damages. Prevents unjust enrichment Compensatory Fixed amount of damages Consequential Prevents unjust enrichment Restitution Actual damages suffered by nonbreaching party Liquidated Foreseeable indirect losses Fixed amount of damages Actual damages suffered by nonbreaching party Foreseeable indirect losses