What is the length of JN? Please help!

What Is The Length Of JN? Please Help!

Answers

Answer 1

Answer:

Answer is 6 and 2/3. That’s it

Step-by-step explanation:

Answer 2

The length of JN of the second triangle is  \(6\frac{2}{3}\).

Triangle SimilarityWhat is similarity of triangles?

If two triangles have an equal number of corresponding sides and an equal number of corresponding angles, then they are comparable.

Similar figures are described as items with the same shape but varying sizes, such as two or more figures.

Calculation for the length JN:

As the two triangles BTL and PJN are similar because the corresponding two angles are given equal in the question.

Thus, the ratios of the side are equal.

\(\frac{BT}{JP} = \frac{LT}{JN}\)

\(\frac{6}{8} =\frac{5}{JN}\)

\(JN =\frac{20}{3}\)

\(JN= 6\frac{2}{3}\)

Therefore, the length JN of the triangle comes out to be \(6\frac{2}{3}\).

To know about the use of SSS, SAS, ASA, or AAS congruence, here

https://brainly.com/question/3999145

#SPJ2


Related Questions

Cinco múltiplos del 12

Answers

Answer:

60 Sana po makatulong pa brainlest please

The cost of hosting a dinner in a particular restaurant is given by y = 18.5x + 250, where x is the number of people at the dinner and y is dollars. What is the y-intercept of this function? What does it mean in the context of the problem?

Answers

Answer:

The y-intercept is at (0, 250)

It means that there is a flat fee of $250 when hosting a dinner

Step-by-step explanation:

The y-intercept is 250 because in the equation y = mx +b, b is the y-int

It represents a $250 flat fee because it is automatically charged, no matter how many attend the dinner

I need help with multiplying fractions ​

Answers

Answer:

\(\frac{4}{5}\)

Step-by-step explanation:

Key skills needed --> Division of fractions, Multiplication of fractions

1) 2/4 over 5/8 is the same thing as division ---> \(\frac{2}{4}\) ÷ \(\frac{5}{8}\) = \(\frac{2}{4}\) × \(\frac{8}{5}\) = \(\frac{16}{20}\) = \(\frac{4}{5}\)

2) Dividing by a fraction is the same thing as multiplying by its reciprocal.

Basically if you are dividing by \(\frac{3}{4}\), you are multiplying by \(\frac{4}{3}\). A reciprocal is when the fraction's numerator becomes the denominator, and the fraction's denominator becomes the numerator. \(\frac{1}{2}\) --> reciprocal is \(\frac{2}{1}\) (or 2)

Hope you understood and have a nice day!! :D

Please answer this correctly

Please answer this correctly

Answers

Answer:

P(odd) = 50%

Step-by-step explanation:

Odd numbers in the spinner:

1, 3, 5, 7 - 4 numbers

There are a total of 8 numbers, therefore:

\(\frac{odd}{total} = \frac{4}{8} = \frac{1}{2} =\)

Convert fraction to percentage:

(1 ÷ 2) × 100 = 50%.

P(odd), the probability of an odd number, is 50%.

50 % is the answer bro

coz the odd is exactly half of the total element

) Quantifier negation.
Form the negation of the following statements. Then apply De Morgan’s law and/or conditional law, when
applicable. Negation should appear only within predicates, i.e., no negation should be outside a quantifier
or an expression involving logical connectives. Show all steps.
a) ∀x (P(x) ∧ R(x))
b) ∀y∃z(¬P(y) → Q(z))
c) ∃x (P(x) ∨ (∀z (¬R(z) → ¬Q(z))))

Answers

The negations of the given statements with the application of De Morgan's law and/or conditional law.

a) ∃x (¬P(x) ∨ ¬R(x))

De Morgan's law:

∃y ∀z(¬P(y) ∧ ¬Q(z))

b) ∃y ∀z(¬P(y) ∧ ¬Q(z))

The double negation:

∃y ¬∃z(P(y) ∨ Q(z))

c) ¬∃x (P(x) ∨ (∀z (¬R(z)) → (∀z ¬Q(z))))

The conditional law:

¬∃x (P(x) ∨ (∀z (¬R(z)) → (∀z ¬Q(z))))

Let's form the negation of the given statements and apply De Morgan's law and/or conditional law, when applicable:

a) ∀x (P(x) ∧ R(x))

The negation of this statement is:

∃x ¬(P(x) ∧ R(x))

Now let's apply De Morgan's law:

∃x (¬P(x) ∨ ¬R(x))

b) ∀y∃z(¬P(y) → Q(z))

The negation of this statement is:

∃y ¬∃z(¬P(y) → Q(z))

Using the conditional law, we can rewrite the negation as:

∃y ¬∃z(¬¬P(y) ∨ Q(z))

c) ∃x (P(x) ∨ (∀z (¬R(z) → ¬Q(z))))

The negation of this statement is:

¬∃x (P(x) ∨ (∀z (¬R(z) → ¬Q(z))))

Using the conditional law, we can rewrite the negation as:

¬∃x (P(x) ∨ (∀z (R(z) ∨ ¬Q(z))))

Applying De Morgan's law:

¬∃x (P(x) ∨ (∀z ¬(¬R(z) ∧ Q(z))))

Simplifying the double negation:

¬∃x (P(x) ∨ (∀z ¬(R(z) ∧ Q(z))))

Using De Morgan's law again:

¬∃x (P(x) ∨ (∀z (¬R(z) ∨ ¬Q(z))))

For similar questions on De Morgan's law

https://brainly.com/question/28735989

#SPJ8

Ms lee can make at most teams with the same number sixth graders and the the same number of seventh graders on each team

Answers

Ms Lee can make 2 teams,Each team has 9 of 6th graders and 14 of 7th graders.

Factor 18 = 1, 2, 3, 6, 9, and 18.

Factor 28 = 1, 2, 4, 7, 14, and 28.

GCF of 18 and 28 is 2

6th graders for each team= 18/2= 9 students

7th graders for each team= 28/2= 14 students

Greatest Common Factor

GCF stands for Greatest Common Factor. A factor is a number that divides evenly into a number.

Example:

Factors of the number 6

6 : 1 = 6

6 : 2 = 3

6 : 3 = 2

6 : 6 = 1

Then, the factors of 6 are 1, 2, 3, and 6

Factors of the number 12

12 : 1 = 12

12 : 2 = 6

12 : 3 = 4

12 : 4 = 3

12 : 6 = 2

12 : 12 = 1

Then, the factors of 12 are 1, 2, 3, 4, 6, and 12

GCF are the same factors of two or more numbers which has the greatest value. Numbers 6 and 12 have the same factors (common factors), namely 1, 2, 3, and 6. The common factor with the greatest value is 6. So, the GCF of 6 and 12 is 6.

Your question is incomplete but most probably your full question was:

Greatest Common Factor (GCF)-Instruction-Level F

The chess club teacher, Ms. Lee, is making teams with her students. She has 18 sixth graders

and 28 seventh graders. To be fair, Ms. Lee wants there to be the same number of sixth grade

students and the same number of seventh grade students on each team.

How many sixth graders and seventh graders will each team have?

Each team will have

sixth graders and ? seventh graders.

Learn more about GCF at https://brainly.com/question/11444998

#SPJ1

you use a line of best fit for a set of data to make a prediction about an unknown value

Answers

A straightforward linear regression study of two or more independent variables will provide a straight line. A curved line may occasionally result from a multiple regression involving a number of linked variables.

What is line of best fit?

The term "line of best fit" describes a line that passes across a scatter plot of data points and best captures their connection. The geometric equation for the line is often calculated manually or using software using the least squares approach, also referred to as ordinary least squares, or OLS.

A straight line that minimizes the gap between it and some data is called a line of best fit.In a scatter plot containing various data points, a relationship is expressed using the line of best fit.It is a result of regression analysis and a tool for forecasting indicators and price changes.The line of best fit is a tool used in finance to find patterns or correlations

To learn more about regression line, click on below link:

https://brainly.com/question/1686678

#SPJ4

Bank account A starts with $5,000 and grows by $1,000 each week. Bank account B starts with $1 and doubles each week.
1.which account has more money after one week?After two weeks?

Answers

Answer:

A

Step-by-step explanation:

If bank A keeps adding on 1,000 and bank B is only doubling by 2 then A is much greater than B.

The account that has more money after one week is account A.

The account that has more money after two weeks is account A

What is an expression?

An expression is a way of writing a statement with more than two variables or numbers with operations such as addition, subtraction, multiplication, and division.

Example: 2 + 3x + 4y = 7 is an expression.

We have,

Account A:

Balance = $5000

Each week increase = $1000

Amount after one week.

= 5000 + 1000

= 6000

Amount after 2 weeks.

= 6000 + 1000

= 7000

Account B:

Balance = $1

Each week's increase = doubles the amount

Amount after 1 week.

= $2

Amount after 2 weeks.

= $4

Thus,

Account A has more money after one week.

Account A has more money after two weeks.

Learn more about expressions here:

https://brainly.com/question/3118662

#SPJ2

You are contracted to fabricate a gate with specifications shown below. As you start, you realize making a jig for the bottom spacing would make life easier. What is the spacing between bars?
5.85"

6"

5.95"

5.7"

You are contracted to fabricate a gate with specifications shown below. As you start, you realize making

Answers

Answer:

Let x be the measure of the spacing between the bars.

6.25" + 5x = 36"

5x = 29.75"

x = 5.95"

plz help i beg u
lara made a scale drawing of a famous monument. she used a scale factor of 1 inch = 1.6 feet. if the height of the monument in drawing is 17.4 inches, compute the actual height of the monument.

Answers

Answer:

27.84?

Step-by-step explanation:

17.4*1.6

which of the following describes the behavior of the function below as x appoches positive or negative infinity

which of the following describes the behavior of the function below as x appoches positive or negative

Answers

We have the following:

\(f(x)=-|x-h|+k\)

now,

\(\begin{gathered} f(x)=-|\infty-h|+k \\ f(x)=-\infty \end{gathered}\)

Therefore, the answer is f(x) approaches negative infinity

which of the following representations show y as a function of x

which of the following representations show y as a function of x

Answers

The option that is a representation that shows y as a function of x is the graph in option 2. The answer is B.

What is a Function?

A function is any relation or table of values which may be represented in a graph that has only one possible y value that is assigned to each x-value.

The first option is not a function because x-value 0 has two corresponding y-values, 4 and 9.

In the third option, we also have two y-values, 5 and -5, that is assigned to one x-value, 0. So, it is not a function.

The graph in option 2 represents y as a function of x, because no two y-values is assigned to the same x-value.

The answer is: B.

Learn more about function on:

https://brainly.com/question/10439235

#SPJ1

the speed (or rate) josiah travels to work is inversely proportion to time it takes to get there. if he travels 35 miles per hour it will take him 2.5 hours to get to work.

Answers

Josiah will take 1.5 hours to travel to work at the speed of 55 miles per hour.

As the speed and time are inversely proportional to each other, we can represent it as -

speed(i)/speed(f) = time(f)/time(i), where I represents initial and f represents final. Now, keep the values in formula to find the time (final).

35/55 = time(f)/2.5

Rewriting the equation according to variable time(f).

time(f) = (35×2.5)/55

Performing multiplication on Right Hand Side of the equation

time(f) = 87.5/55

Performing division on Right Hand Side of the equation

time(f) = 1.59 hours

Hence, it will take 1.59 hours.

Learn more about speed -

https://brainly.com/question/13943409

#SPJ4

The complete question is -

The speed (or rate) Josiah travels to work is inversely proportional to time it

takes to get there. If he travels 35 miles per hour it will take him 2.5 hours to get to work. How long will it take him if he travels 55 miles per hour?

Select the correct answer from each drop-down menu.
Three students used factoring to solve a quadratic equation.
12 + 171 + 72 = 12
Jordan's Solution
Keith's Solution
Randall's Solution
12 +177 + 72 = 12
(* +8)(x + 9) = 12
12 + 173 + 72 = 12
12 +177 +60 = 0
(1 +5)(+12) = 0
12 +177 + 72 = 12
12 + 171 = -60
*(x +17) = -60
= -60
1 +8 = 12
and
I +9 = 12
+5 = 0
and
1 +12 = 0
and
1 +17
-60
The equation was solved correctly by
. The solutions of the equation are

Select the correct answer from each drop-down menu.Three students used factoring to solve a quadratic

Answers

Answer:

Keith solve the equation correctly

Step-by-step explanation:

x² + 17x + 72 = 12 ( subtract 12 from both sides )

x² + 17x + 60 = 0 ← in standard form

Consider the factors of the constant term (+ 60) which sum to give the coefficient of the x- term (+ 17)

The factors are + 12 and + 5 , since

12 × 5 = 60 and 12 + 5 = 17 , then

(x + 12)(x + 5) = 0 ← in factored form

Equate each factor to zero and solve for x

x + 12 = 0 ⇒ x = - 12

x + 5 = 0 ⇒ x = - 5

The solutions of the equation are x = - 12, x = - 5

The function T(d)=10d + 20 gives the temperature in deegrees celcius inside the earth as a function if d, the depth in kilometers ,Find the temperature at.​

Answers

Answer:

Step-by-step explanation:

The question is incomoplete. Here is the complete question.

The function T(d)=10d + 20 gives the temperature in deegrees celcius inside the earth as a function if d, the depth in kilometers ,Find the temperature at 5km, 20km and 100km

T(d)=10d + 20

T(5)=10(5) + 20

T(5)=  50+ 20

T(5) = 70

Hence the temperature is 70 when d = 5km

when d = 20km

T(20)=10(20) + 20

T(20)=  200+ 20

T(20) = 220

Hence the temperature is 220 when d = 20km

when T = 100km

T(100)=10(100) + 20

T(100)=  1000+ 20

T(100) = 1020

Hence the temperature is 1020 when d = 100km

The temperatures at 5km, 20km and 100km are; 70°C, 220°C, and 1020°C respectively.

The complete question requires that we find the temperature at 5km, 20km and 100km.

The temperature function is; T(d)=10d + 20

For 5km;

T(5)=10(5) + 20

T(5) = 70°C

For 20km;

T(20) = 10(20) + 20

T(20) = 220°C

For 100km;

T(100)=10(100) + 20

T(100) = 1020°C

Read more;

https://brainly.com/question/15308045

The American Population is living longer. Along with the longevity of life comes additional challenges with both medical and Psychiatric problems. Your patient is about to be discharged from a short-tern rehab center. You overhear the daughter confiding in the nursing student that she cannot handle her mother and will be looking for a Memory care unit to put her mother in. You also hear the student nurse who was raised in a foreign country state, " I would NEVER put my mother in a home. I would take care of her woth my two sisters junti she dies.

what considerations might you make withthis students. Address the cultural differneces in elder care and adress the conself od "Role Strain" in caring for special populations.

Answers

Cultural sensitivity is crucial in elder care. Cultural beliefs impact elderly care. A foreign-raised nursing student desires to care for her mother and sisters until her mother's passing.

What is the cultural Strain?

Consider cultural values: Students from certain backgrounds may see caring for their elderly parents as a moral duty. Respecting elder beliefs is critical in discussing care options. Have open, non-judgmental communication with the nursing student. Show empathy and listen to her perspective.

Educate the nursing student about caring for a loved one with medical and psychiatric problems. Explain physical, emotional, and financial consequences, including effects on relationships and responsibilities.

Learn more about  Role Strain from

https://brainly.com/question/14283116

#SPJ1

102x5 multiply with expanded form

Answers

Answer:

ok well I usually just add 105, 5 times and I get the answer.

Step-by-step explanation:

105 + 105= 210

210 + 105= 315

315+ 105= 420

420 + 105 = 525

The answer is 525

There is another way to do it ok soo if we multiply 100 x 5 = 500

and 5 x 5 equals 25 and then we add them  together we get 525

Answer:

maybe 20

Step-by-step explanation:

or find it out yourself

Please anyone that can help me

Please anyone that can help me

Answers

Answer:

\(|\frac{x}{y} |\)

Step-by-step explanation:

Pre-Solving

We are given the following expression: \(\sqrt\frac{x^3y^5}{xy^7}\), where x > 0 and y > 0.

We want to simplify it.

To do that, we can first simplify what is under the radical, then take the square root of what is left.

Recall that when simplifying exponents, we don't want any negative or non-integer radicals left.

Solving

To simplify what is under the radical, we can remember the rule where \(\frac{a^n}{a^m} = a^{n-m}\).

So, that means that \(\frac{x^3}{x} = x^2\) and \(\frac{y^5}{y^7} = y^{-2}\) .

Under the radical, we now have:

\(\sqrt{x^2y^{-2}}\)

Now, we take the square root of both exponents to get:

\(|xy^{-1}|\)

The reason why we need the absolute value signs is because we know that x > 0 and y > 0, but when we take the square root of of \(x^2\) and \(y^{-2}\) , the values of x and y can be either positive or negative, so by taking the absolute value, we ensure that the value is positive.

However, we aren't done yet; remember that we don't want any radicals to be negative, and the integer of y is negative.

Recall that if \(a^{-n}\), that is equal to \(\frac{1}{a^n}\).

So, by using that,

\(|x * \frac{1}{y} |\)

This can be simplified to:

\(|\frac{x}{y} |\)


Find each percent decrease. Round to the nearest percent.
From 39 seconds to 13 seconds
O 53%
0 67%
057%
O 63%

Find each percent decrease. Round to the nearest percent.From 39 seconds to 13 secondsO 53%0 67%057%O

Answers

Answer:

67%

Step-by-step explanation:

First of all, we must find the decrease;

39 - 13

=26

Then we can find the percentage decrease

26/13 ×100 =66.666..which can be written as 67.

A company rents bicycles to customers. The company charges an initial fee plus an hourly rate. This table shows the total cost to rent a bicycle for different amounts of time.
What is the initial fee, in dollars, that the company charges to rent a bicycle?

A company rents bicycles to customers. The company charges an initial fee plus an hourly rate. This table

Answers

Answer:

4, 3.3, and 3.2 the answer would be $10.05

Step-by-step explanation:

The initial fee that the company charges is equivalent to $2.

What is a mathematical equation and expression?In mathematics, a function from a set X to a set Y assigns to each element of X exactly one element of Y. The set X is called the domain of the function and the set Y is called the codomain of the function.Equation modelling is the process of writing a mathematical verbal expression in the form of a mathematical expression for correct analysis, observations and results of the given problem.A mathematical expression is made up of terms (constants and variables) separated by mathematical operators.A mathematical equation is used to equate two expressions.

Given is that a company rents bicycles to customers. The company charges an initial fee plus an hourly rate. This table shown in the question gives the total cost to rent a bicycle for different amounts of time.

Assume that the initial fee is equivalent to $x. Then we can write the charge function as -

C(x) = mx + c

Now -

C(x) = {(20 - 8)/(6 - 2)}x + c

C(x) = (12/4)x + c

C(x) = 3x + c

For (2, 8) , we can write -

8 = 3 x 2 + c

c = 8 - 6

c = 2

Therefore, the initial fee that the company charges is equivalent to $2.

To solve more questions on functions, expressions and polynomials, visit the link below -

brainly.com/question/17421223

#SPJ2

A boat can travel 20 miles on 10 gallons of gasoline. How much gasoline will it need to go 34 miles?​

Answers

Answer:

20 divided by 10 is 2 so for every 2 miles it travels it uses 1 gallon of gasoline. 20 + 14 is 34 so you divide 14 by 2 to get 7. then you add 10+7 to get 17. it will take 17 gallons of gasoline to go 34 miles

Step-by-step explanation:

Choose as many answers as apply.
According to the lesson, things you can do to help you decide on a bank include:
compare interest rates
determine which bank has the most attractive buildings
ask friends where they bank
visit two or three branch office

Answers

Some things you can do to help you decide on a bank include:

Ask friends where they bankVisit two or three branch officesCompare interest rates

Why are these important?

When trying to locate a bank that offers competitive returns on savings and favorable borrowing costs, consider comparing interest rates.

To gather additional information about certain banks, why not solicit feedback from acquaintances? People who have personal experience with a particular bank can provide valuable insights into their satisfaction levels with regards to customer service, for example.

Finally, taking the time to visit branch offices can offer valuable clues regarding convenience level and overall atmosphere.

Learn about interest rate here https://brainly.com/question/30512587

#SPJ9

5 zombies start attacking humanity. Each zombie can turn 3 humans per day. If the population of the earth is 6,975,000,000 how long would it take for the zombies to turn all humans?

Answers

It would take 1118 days for the zombies to turn all the humans.

What is an exponential function?

Mathematical functions with exponents include exponential functions. f(x) = bˣ, where b > 0 and b 1, is a fundamental exponential function.

Given:

5 zombies start attacking humanity.

Each zombie can turn 3 humans per day.

The function that can represent the situation is,

y = 5(3)ˣ, where x be the number of days.

If the population of the earth is 6,975,000,000,

then it would take,

6,975,000,000 = 5(3)ˣ

(3)ˣ = 1395000000

x = ∛1395000000

x = 1117.36 days.

x ≈ 1118 days.

Therefore, the required time is 1118 days.

To learn more about exponential function;

https://brainly.com/question/14344314

#SPJ1

The midpoint of JK is point L at (–1, 8). One endpoint is J(4, –15). Which equations can be solved to determine the coordinates of the other endpoint, K? Select two options. = –1 = 4 –15 + y1 =16 = y1

Answers

Using the formula of midpoint of a line, the coordinate of the endpoint k is (-6, 31)

What is Midpoint of a Line

The midpoint of a line is the point that is halfway between the two end points of the line. It can be found by taking the average (mean) of the x-values and the average (mean) of the y-values of the two endpoints.

The formula of midpoint of a line is given as;

M(x, y) = (x₂ + x₁) / 2, (y₂ + y₁) / 2

Since we have the midpoint and one endpoint, we can use the coordinate to find the missing coordinate.

The x - coordinate is calculated as;

-1 = (4 + x₁) / 2

-2  = 4 + x₁

x₁ = -2 - 4

x₁ = -6

The y - coordinates is calculated as;

8 = (-15 + y₁) / 2

16 = -15 + y₁

y₁ = 16 + 15

y₁ = 31

The coordinates of k is (-6, 31)

Learn more on midpoint of a line here;

https://brainly.com/question/5566419

#SPJ1

5. Given the right triangle JKL, identify the locations of sides j, k, and I in relation to angle L
in terms of opposite, adjacent, and hypotenuse.
HELP

5. Given the right triangle JKL, identify the locations of sides j, k, and I in relation to angle Lin

Answers

In relation to the angle L of the right triangle the sides are as follows:

l = opposite sidek = hypotenusej = adjacent

How to name the side of a right triangle?

A right angle triangle is a triangle that has one of its angles as 90 degrees.  The sides of a right angle triangle can be named according to the position of the angles in the right angle triangle.

The sides of a right triangle can also be solved by using Pythagoras's theorem or trigonometric ratios.

Let's identify the sides  j,  k, and I in relation to angle L in terms of opposite, adjacent, and hypotenuse.

Therefore,

l = opposite sidek = hypotenusej = adjacent

The hypotenuse side is the longest side of a right triangle.

learn more on right triangle here: https://brainly.com/question/17810121

#SPJ1

-4 + × = -27 solve for x

Answers

I think that the answer is

-4+x=-27

or,x=27-4

or,x=23

I HOPE IT WILL HELP YOU A LOT

Answer:

x=-23

Step-by-step explanation:

-4 + x =-27

x = -27 - (-4)

= -23

check:

-4 + (-23) = -27

What is the square root of -1

Answers

Answer:

i

Step-by-step explanation:

It's imaginary, or it can also be referred to as i.

Imaginary number or i

Prove that if an integer n is the sum of two squares (n = a2+ b2 for a, b Z) then n = 4q or n= 4q+1 or n= 4q + 2 for some qЄ Z. Deduce that 1234567 cannot be written as the sum of two squares.

Answers

The number 1234567 cannot be written as a sum of two squares.

Let q = x^2+y^2,

Let a and b be two even numbers, such that

a= 2x and b = 2y

then

n = (2x)^2 + (2y)^2 = 4 (x^2+y^2)

implies n = 4q

Let a and b be two odd numbers, such that

a = 2x+1 and b = 2y+1

then

n = (2x+1)^2 + (2y+1)^2 = 4x^2+4y^2+1 = 4q+2

Let a be an even number and b be an odd number, such that

a= 2x and b = 2y+1

then

n = (2x)^2 + (2y+1)^2 = 4q+1

But, the given number 1234567 = (4×308641)+3 which is of the form 4q+3, hence it cannot be written as the sum of two squares.

To know more about the even numbers

https://brainly.com/question/2289438

#SPJ4

Simplify 2x-x+4x pls help me out​

Answers

Answer:

Step-by-step explanation:

2x-x = x

x+4x = 5x

5x is the answer

Answer:

5x

Step-by-step explanation:

2x - x + 4x =

x + 4x =

5x

Q9 HELPPPPPPPPPppppppp

Q9 HELPPPPPPPPPppppppp

Answers

Answer:

Hey]

I got uu

Sorry for late reply

Step-by-step explanation:

It's

Dialiation

Other Questions
Prior to sample loading onto an SDS-PAGE gel, four proteins are treated with the gel-loading buffer and reducing agent followed by boiling. Which of the following proteins is expected to migrate the fastest in the SDS- PAGE gel? A monomeric protein of MW 12,000 Dalton O A monomeric protein of MW of 120,000 Dalton O A dimeric protein of MW 8,000 Dalton per subunit O A dimeric protein of MW 75,000 Dalton per subunit Two primers are designed to amplify the Smad2 gene for the purpose of cloning. They are compatible in the PCR reaction? Forward primer : TATGAATTCTGATGTCGTCCATCTTGCCATTCACT (Tm=60C) Reverse primer : TAACTCGAGCTTACGACATGCTTGAGCATCGCA (TM=59C) O Yes No a browser is an example of a Read the excerpt from "The Oblong Box"He had married," he said, "for love and for love only and his bride was far more than worthy of his love wentthought of these expressions on the part of my friend, I confess that I felt indescribably puzzleWhat is the meaning of the word expressions as it is used in the text?A specific words or phrasesB combinations of mathematical symbolsClooks on people's faces that convey feelingsD. pronouncements about thoughts or feelings in 2013 January there were 360 pupils in school the ratio of boots to girls was 5:4 in February 18 boys were admitted in school how many boys were there in February The range for y=x2+9 is which of the following? Show the stack with all activation record instances, including static and dynamic chains, when execution reaches position 1 in the following skel- etal program. Assume bigsub is at level 1. function bigsub () { var mysum; function a() { var x; function b(sum) var y, z; c(z); 1 // end of b b(x); } // end of a function c (plums) - -- --- - -- // end of var 1; a end ol bigsub including static an Need a paragraph A reason why I should visit Mexico? according to the loanable funds model, when government spending increases but taxes are not raised, interest rates: If the reaction of h2 and o2 to produce water vapour releases 285.4 kj of energy to the surroundings; write four different methods that can be used to communicate this information In your opinion, what is similar and/or different about the experiences of immigrants to the U.S. during this time period compared to immigrants to the U.S. today? if apple invests in iphone dealerships in asia but does not engage in distribution in the united states (apples host country), then apples asian investment would be considered a(n) . why was the op-amp unable to source 1 ma current to the 22 k load? chemistry hw due in 2 hours... HELP!!! A fifth-grade science class puts half of a white tablet in a test tube with 10 milliliters (mL) of water at 21C (70F). The tablet bubbles rapidly for three minutes until it is gone. Students record the final temperaturo at 20C (637)Which choice best identifies evidence that a chemical reaction occurred?tablet was whitetablet broke in halltablet dissolved in the waterchange in water temperature Karl marx asserted that the means of societal change existed in the tension between. A university class has 21 students: 11 are art majors, 4 are nursing majors, and 6 are business majors. (Each student has only one of these majors.) The professor is planning to select two of the students for a demonstration. The first student will be selected at random, and then the second student will be selected at random from the remaining students. What is the probability that the first student selected is a nursing major and the second student is a business major MONDAY You are shopping for your holiday feast. The price for a turkey at Walmart is $12.62 for 10.7 pounds. The cost for a turkey at Kroger is 8.45 for 8.5 pounds Which store has the best unit price for Turkey? I NEED HELP. I need step-by- step on how I solved this. And the answer for the equation... A heat engine operating on a Carnot Cycle rejects 519 kJ of heat to a low-temperature sink at 304 K per cycle. The high-temperature source is at 653C. Determine the thermal efficiency of the Carnot engine in percent. serves as a long-term storage area for water or nutrients.