what is a phosphorelated nucleoside?

Answers

Answer 1

Answer:

Nucleosides can be phosphorylated by a displacement reaction between phosphate and an electrophilic carbon of a nucleoside. To render a carbon electrophilic, the hydroxyl group must be converted into a leaving group of some kind (e.g., a halogen or sulfonate ester)

Explanation:


Related Questions

What evidence supports a conservation law?
Energy from sunlight becomes glucose during photosynthesis.
Carbon dioxide becomes glucose and oxygen during photosynthesis.
O Hydrogen is made from the breakdown of carbon dioxide during photosynthesis.
O Glucose and
oxygen become carbon dioxide and water during photosynthesis.

Answers

Answer:

yes

Explanation:

Answer:

its a

Explanation:

why is the interaction of the respiratory and circulatory systems necessary for the frog survival please refer to oxygen and carbon dioxide?​

Answers

The circulatory system circulates blood around the body. The blood passes through the lungs, where it loses carbon dioxide and gains oxygen. All cells need oxygen to function and carbon dioxide is a form of waste produced in the cells. The digestive system breaks down food and absorbs.

In the circulatory system there is the distribution of oxygen to the body and in the respiratory system the gas exchange.

How is the respiratory and circulatory system of amphibians?

Amphibians have three structures for breathing:

The lungsThe mucous membranes of the pharynx and mouthand The skin.

The lungs are made up of two bags with no internal division. When still in the larval stage, they breathe through gills.

How does the circulatory system of amphibians work?

Amphibians have a dual circulation, meaning the blood passes through the heart twice to complete the cycle. The blood reaches the heart, travels towards the lungs, returns to the heart and only then is carried to the body.

Whit this information, we can conclude that In the circulatory system there is the distribution of oxygen to the body and in the respiratory system the gas exchange.

Learn more about Amphibians in brainly.com/question/13744586

Define the following ecological term biosphere​

Answers

Biosphere, relatively thin life-supporting stratum of Earth's surface, extending from a few kilometres into the atmosphere to the deep-sea vents of the ocean.

A control disc, usually containing water, has no antibiotic properties.
O True
O False

Answers

The claim that a control disc, which typically contains water, has no antibiotic effects is True.

What ideal characteristics should an antibiotic have?

An ideal antibiotic is an antibacterial drug that, regardless of the site of infection, eradicates or prevents the growth of all pathogenic bacteria in the host while having no adverse effects on the host's healthy gut flora or beneficial gut microbes.

What characteristics do antibacterial agents have?

Antibacterial medications' interactions with their target bacteria can be either bacteriostatic or bactericidal. Bacteriostatic medications cause a reversible growth inhibition; once the treatment is removed, bacterial growth resumes. The target microorganisms are killed by bactericidal medications, in contrast.

To know more about antibiotic visit:-

https://brainly.com/question/17988226

#SPJ1

2. For each of the genotypes below determine what phenotypes would be
possible.
Purple flowers are dominant to white flowers. Brown eyes are dominant to blue eyes
FF
BB
Ff
Bb
ff
bb
Round seeds are dominant to wrinkled seeds. Bobtails in cats are recessive to long tail
TT
Tt
tt
RR
Rr
rr
3. For each phenotype below, list the genotypes (remember to use the letter of
the dominant trait)
Straight hair is dominant to curly.
straight
straight
curly
Pointed heads are dominant to round heads.
pointed
pointed
round

Answers

Answer:

Explanation:

FF: Only purple flowers are possible.

BB: Only brown eyes are possible.

Ff: Both purple and white flowers are possible, but only brown eyes are possible.

Bb: Both brown and blue eyes are possible, but only purple flowers are possible.

ff: Only white flowers are possible.

bb: Only blue eyes are possible.

TT: Only round seeds are possible.

Tt: Both round and wrinkled seeds are possible.

tt: Only wrinkled seeds are possible.

RR: Only pointed heads are possible.

Rr: Both pointed and round heads are possible.

rr: Only round heads are possible.

Phenotype: Straight hair

Possible genotypes: SS, Ss

Phenotype: Pointed heads

Possible genotypes: RR, Rr

Why is respiration essential for all organisms?​

Answers

Explanation:

to obtain energy..........

Respiration provides oxygen to cells to allow them to carry out their metabolic functions.

Ch4+2O2-CO2+2H2O
Carbon number of atoms before reaction

Answers

Answer: Number of products: 4 H, 1 C, 4 O. So, one carbon atom is on the reactant side of this equation.

Lamin A is a signaling protein embedded in the cell membrane. The locus of the lamin A gene is 1q22. On which human chromosome, arm, and position can the recipe for this protein be found?

Lamin A is a signaling protein embedded in the cell membrane. The locus of the lamin A gene is 1q22.

Answers

Generally , these proteins are located in the nuclear lamina.

What is Lamin A ?

Instructions for creating a number of slightly different proteins known as lamins are provided by the LMNA gene. Most of the cells in the body make lamin A and lamin C, the two main proteins produced by this gene. These proteins are constructed from a pattern of virtually identical protein building units (amino acids). Lamin A is longer than lamin C due to the minute variation in the sequence.

These proteins are specifically found in the nuclear lamina, a layer of intermediate filaments and other proteins that is connected to the nuclear envelope's inner membrane. The nuclear envelope controls how molecules enter and exit the nucleus.

Learn more about nuclear lamina from given link

https://brainly.com/question/14986847

#SPJ13

Storm winds knock down trees in part of a forest. Which of these effects of
the storm winds is a negative consequence?
A. A new clearing attracts new animals.
B. The fallen trees become food for decomposers.
C. Organisms living in the fallen trees lose shelter.
D. More light reaches shorter plants.

Answers

Answer:

C. Organism living in the fallen trees lose shelter.

Explanation:

talking about the effects of storm winds falling trees, it creates more light to reach shorter plant which will help the plants to do photosynthesis well, which will even facilitate their fast growth; that's positive.

Fallen trees becoming food for decomposers can also be positive cause this will help the soil or earth of that forest have fertility

New Clearing attracting animals such as man can lead to extinction of forest which to conservators they feel like no-no-no-no that's they'd see it as a negative consequence of the wind storm effect, yes this can lead to de-sheltering of organisms inhabiting that niche(trees)

C

Explanation:key words negative effect
Organisms living in fallen trees lose shelter thin about birds and their offsprings to come wouldn’t it affect them?Yes

the scottish fold is a breed of cat with a mutation in a gene involved in cartilage development. the result is that each ear of the cat has a crease, so the ears fall forward and lie against the head instead of standing up like the ears of most small cats. the mutation is a dominant allele.

a cat that is heterozygous for the fold allele mates with a cat that is homozygous for the fold allele.

what are the expected percents of offspring that will have each characteristic?

Answers

In complete dominance, the presence of at least one dominant allele in the genotype is enougth to express the dominant phenotype. 100% of the offspring will have mutated creased ear, while 0% of the will have normal standing ear.

What is complete dominance?

Complete dominance is the inheritance pattern in which the dominant allele completely masks the recessive allele.

This interaction between alleles is observed in individuals who are heterozygous for a particular gene. They carry both alleles but only express the dominant trait. The dominant allele is hiding the expression of the recessive allele.

In the exposed example,

E is the dominant allele and codes for the mutated creased ear,e is the recessive allele and codes for the normal standing ear.

Cross: a cat that is heterozygous with a cat that is homozygous for the fold allele.

Parentals) Ee   x   EE

Gametes) E   e     E   E

Punnett square)   E    e

                     E    EE    Ee

                     E    EE    Ee

F1) 50% of the progeny is expected to be heterozygous

     50% of the progeny is expected to be homozygous dominant

     100% of the progeny is expected to have ears with a crease.

The expected percents of offspring that will have each characteristic are,

100% of the animals will have mutated creased ear,0% of the animals will have normal standing ear.

You can learn more about complete dominance at

https://brainly.com/question/30640875

#SPJ1

What happens to cells during differentiation
A. They gain the ability to build entire organisms
B. They develop specific structures and organelles
C. They become stem cells and divide into Zygotes

Answers

Answer:

B

Explanation:

the plant can change its form

During a(n) _____________________, the sun can produce excessive radiation to heat the lower atmosphere and Earth's surface.

Group of answer choices

Answers

could it be a solar flare?

correct answers only please

correct answers only please

Answers

If cells only would enter into interphase and they would bypass the cell division process then it would lead to unbalanced cells and many duplications in the genetic material which eventually would lead to cell death.

What is the real importance of the cell cycle for a multicellular organism?

The real importance of the cell cycle for a multicellular organism is based on the fact that it allows to the cell maintain constant its genetic material as well as other structural components in the cell, which is a fundamental issue to carrying out normal metabolic functions since unbalanced genomes may lead to faulty gene expression patterns.

Therefore, with this data, we can see the real importance of the cell cycle for a multicellular organism is to maintain normal conditions and the survival of the cell since unbalanced gene expression would lead to cell death.

Learn more about the cell cycle here:

https://brainly.com/question/5034994

#SPJ1

A process that may return carbon to
the soil is

A. "locking" carbon.

B. decomposition.

C. respiration.

Answers

Answer:

B. Decomposition

Is your answer

The process of returning carbon to soil is referred to as decomposition. The correct option is C.

What is decomposition?

Decomposition, also known as rot, is the breakdown of dead organic matter into relatively simple organic or inorganic matter including such carbon dioxide, water, simple sugars, and mineral salts.

It is the way to transfer carbon back to the soil. Water is also decomposed into hydrogen and oxygen.

Thus, the correct option is B.

For more details regarding decomposition, visit:

https://brainly.com/question/8009068

#SPJ2

PLZ HELP Translate this segment of RNA into the corresponding amino acids.
mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA
*Remember to begin with the Start Codon "AUG"

Answers

Answer:

Lysine - Isoleucine - Arginine - Histidine - Alanine - Valine - Asparagine - Alanine - Leucine - Glycine - Val

Explanation:

Translation is the second process of gene expression in which a mRNA sequence is used as template to synthesize an amino acid sequence. This process, which occurs in the ribosome, reads the nucleotides of the mRNA sequence in three's called CODON. Each codon represents an amino acid, which is then added to the growing peptide chain.

According to this question, the following mRNA sequence is given: AAA AUU CGG CAU GCC GUU AAU GCC CUC GGG GUG A. Using the genetic code, the following amino acid sequence is produced:

Lysine - Isoleucine - Arginine - Histidine - Alanine - Valine - Asparagine - Alanine - Leucine - Glycine - Val

how one’s sense of maleness or femaleness develops

Answers

Answer:

It is through Gender socialization

Explanation:

Hope this helps!

I need help answering this

I need help answering this

Answers

The purpose of the lab is to identify the structures of the digestive and circulatory systems in a rat.

How to explain the information

The digestive system of a rat is similar to that of other mammals. It consists of the mouth, esophagus, stomach, small intestine, large intestine, and rectum. The mouth is where food is chewed and mixed with saliva.

The esophagus is a muscular tube that carries food from the mouth to the stomach. The stomach is a muscular sac that churns food and mixes it with gastric juices. The small intestine is a long, coiled tube that absorbs nutrients from food. The large intestine absorbs water from food and stores waste products. The rectum is a muscular tube that carries waste products from the large intestine to the anus.

The gallbladder is absent in rats because they have a different diet than other mammals. Rats eat mostly plant matter, which does not require as much bile for digestion as a diet that is high in protein. Bile is a fluid that is produced by the liver and stored in the gallbladder. It helps to break down fats in food.

Learn more about digestive system on

https://brainly.com/question/956634

#SPJ1

Suppose rising sea levels again separate the continents of North and South America. Choose one of Earth's spheres, and explain how it might interact differently with another of Earth's spheres because of this change.

Answers

The separation of North and South America by rising sea levels would result in changes in the interaction between the biosphere and the hydrosphere. Disrupted migration patterns, altered nutrient distribution, and changes in habitat availability would affect the biodiversity and ecological dynamics in the marine ecosystem.

If rising sea levels were to separate the continents of North and South America, one sphere that would interact differently with another sphere is the biosphere and the hydrosphere.

The biosphere refers to all living organisms and their interactions with the environment, while the hydrosphere encompasses all water bodies on Earth, including oceans, lakes, rivers, and groundwater. The separation of North and South America by rising sea levels would result in significant changes in the distribution and connectivity of marine habitats, impacting the biodiversity and ecological dynamics in both spheres.

With the separation of the continents, marine species that depend on migratory patterns, such as marine mammals, fish, and sea turtles, may face challenges in their natural movement and breeding cycles. Disrupted migration routes and barriers created by the rising sea levels could lead to isolation or fragmentation of populations, affecting their genetic diversity and long-term survival.

Furthermore, the change in the physical geography due to the separation could alter oceanic currents and water circulation patterns. This, in turn, would affect nutrient distribution and primary productivity in the water column, influencing the food webs and species interactions within the marine ecosystem. The availability of specific habitats, such as coastal wetlands and coral reefs, could also be affected, impacting the biodiversity and ecological services they provide.

For more such information on: biosphere

https://brainly.com/question/12467010

#SPJ8

Explain why you should never eat mushrooms you find in the woods unless you know for certain which type of mushrooms they are.

Answers

Answer:

Because some of them are posinous/venomous and aren't edible

The opossum is a new arrival in southern Ontario. Its niche is similar to that of the raccoon. An opossum has a long, bare, rat-like tail. A raccoon has a long, bushy tail. How is this a selective advantage for the raccoon?

Answers

The long, bushy tail of the raccoon may be a selective advantage for this species because the bushy tail helps keep the face warm during a snowstorm (Option d). In addition, it may serve as camouflage and also may act to communicate with other members of the population.

What is an evolutionary selective advantage?

An evolutionary selective advantage is a feature in a species that confer an advantage to survive and reproduce in a particular environmental condition, which may be associated such as in this case to the tail in raccoons.

Therefore, with this data, we can see that an evolutionary selective advantage is any phenotypic feature that enhances the survival and or reproductive rate of individuals in a population or species.

Complete question:

The opossum is a new arrival in southern Ontario. Its niche is similar to that of the raccoon. An opossum has a long, bare, rat-like tail. A raccoon has a long, bushy tail. How is this a selective advantage for the raccoon?

selective advantage only applies to populations

the opossum  tail can grab onto a tree for balance

tail fur does not have an impact on survival

the bushy tail helps keep the face warm during a snowstorm

Learn more about evolutionary selective advantages here:

https://brainly.com/question/18881465

#SPJ1

what's the term for ribsome

Answers

A ribosome performs protein synthesis

The image above shows a fossit that was discovered in a particular rock layer. Using the Rule of Superposition, approximately how
old is the fossil shown above?
A) 50 million years
B) 70 million years
C) 190 million years
D) 250 million years

The image above shows a fossit that was discovered in a particular rock layer. Using the Rule of Superposition,

Answers

B) 70 million years
Because it is a little below 60 million years meaning it is a little older than 60 million years

Answer:70 million years

Explanation: USA test prep, K12

all of the following cranial nerves have somatic motor neuron (lower motor neurons) components innervating skeletal muscles, except:

Answers

The vestibulocochlear (VIII) nerve

The vestibulocochlear nerve, also known as cranial nerve VIII, is responsible for transmitting auditory and vestibular information from the inner ear to the brain. The vestibular part of the nerve provides information about the position and movement of the head, while the cochlear part of the nerve transmits auditory information to the brain for processing.

The vestibulocochlear nerve is one of the twelve pairs of cranial nerves in the human body. It has two branches: the vestibular nerve and the cochlear nerve. The vestibular nerve carries sensory information related to the sense of balance and the orientation of the head in space, while the cochlear nerve carries auditory information about the sounds that we hear.

The vestibular system, which is located in the inner ear, contains several fluid-filled structures called the semicircular canals and the utricle and saccule. These structures respond to the acceleration and movements of the head, and the information they collect is transmitted to the brain via the vestibular nerve. This information is used by the brain to maintain balance and coordination and to make adjustments in eye movements and body position to maintain stability.

You can read more about  cranial nerves at https://brainly.com/question/5865278

#SPJ4

which of the following is not a type of force? a) electrical b) contact c) magnetic d) reversible​

Answers

I think the answer is A

Name the missing level of classifica�on.

Answers

The Swedish botanist Carolus Linnaeus gave the system of classification of organisms. This classification is done under the branch of taxonomy.  

The classification of organisms is also referred to as taxonomical hierarchy.

According to this classification, there are seven levels:

1. Kingdom

2. Phylum

3. Class

4. Order

5. Family

6. Genus

7. Species

Kingdom is the highest level of classification, whereas species is the lowest level.

There are five kingdoms - Monera, Protista, Fungi, Animalia and Plantae.

Species is unique for a group of organisms having similar characteristics genotypically and phenotypically.

Learn more about classification in:

https://brainly.com/question/29840273

#SPJ1



Describe the major differences between the ecological niches of humans and cockroaches. (b) Are these two species in competition? If so, how do they manage to coexist? TECNO SPARK​

Answers

Overall, the relationship between humans and cockroaches is complex and can vary depending on the specific circumstances.

What is environment?

Environment refers to the physical, biological, and social components that surround and interact with living organisms, including humans. It encompasses both natural and human-made elements, such as air, water, soil, plants, animals, buildings, and infrastructure. The environment plays a critical role in supporting life on Earth and provides essential resources, including food, water, air, and shelter. Environmental factors can also have a significant impact on the health and well-being of individuals and communities, as well as on the functioning of ecosystems and the planet as a whole.

Here,

The ecological niches of humans and cockroaches are quite different. Humans are omnivores and have a diverse diet that includes both plants and animals. They are also capable of adapting to a wide range of environments, from tropical rainforests to arctic tundra. In contrast, cockroaches are primarily scavengers and feed on decaying organic matter. They prefer warm, humid environments and are adapted to living in cracks and crevices in human-made structures.

While humans and cockroaches may occupy similar habitats, they are not necessarily in direct competition. Humans do not typically rely on the same food sources as cockroaches and do not directly compete with them for resources. However, cockroaches may become a nuisance in human environments, and humans may take steps to control or eliminate cockroach populations.

In some cases, humans and cockroaches may coexist in a symbiotic relationship. For example, cockroaches may feed on human waste and debris, while humans may benefit from the cockroaches' ability to decompose organic matter. In other cases, humans may use pesticides or other methods to control cockroach populations, reducing their impact on human environments.

To know more about environment,

https://brainly.com/question/29885760

#SPJ1

- Why are cars and trucks today powered by petroleum products?
- What are different economic, social, legal, and environmental factors that
make us use petroleum products?

Answers

Answer:

Due to structure of engine.

Explanation:

Cars and trucks today powered by petroleum products because of their engine which only works when the petroleum products are used. When the petroleum products are burn in the engine, it produces small blasts which moves the piston and as a result the wheels of the car also start movement. Petroleum products are economically cheap due to its higher availability on the earth, easily available to the people, can be easily transported are the factors that make us use of petroleum products.

Where does warm water accumulate in the Pacific Ocean during El Niño

Answers

Answer:

east

Explanation:

Describe how instructional notes in both the Alphabetic Index and the Tabular List guide coders when selecting ICD-10-CM codes.

Answers

Instructional notes in the Alphabetic Index and Tabular List of ICD-10-CM provide essential guidance for coders in selecting accurate codes by clarifying coding conventions, rules, and specific instructions.

Instructional notes in both the Alphabetic Index and the Tabular List of ICD-10-CM provide guidance to coders when selecting appropriate codes. These notes serve as important references that clarify coding conventions, rules, and specific coding instructions.

In the Alphabetic Index, instructional notes can be found alongside the listed terms or conditions. They provide additional information on code selection, such as code inclusion or exclusion criteria, code sequencing rules, and any specific coding guidelines applicable to certain conditions or circumstances. For example, the index may indicate the need to refer to another term or provide cross-references to guide coders to the most appropriate code. These notes help coders navigate through the index and select the correct codes based on the documented diagnoses or conditions.

Similarly, the Tabular List contains instructional notes that further assist coders in code selection. These notes are typically located at the beginning of a chapter, section, or category and provide overarching guidelines and specific coding conventions. They may include instructions on the use of combination codes, manifestation codes, or codes for related conditions. Additionally, the Tabular List may contain additional instructions within code descriptions to guide coders in selecting the most precise and accurate code for a given diagnosis.

Overall, the instructional notes in both the Alphabetic Index and the Tabular List play a crucial role in guiding coders during the code selection process. They provide essential information on coding conventions, rules, and specific instructions, ensuring that the assigned codes accurately represent the documented diagnoses or conditions.

For more such information on: Alphabetic Index

https://brainly.com/question/11174890

#SPJ8

Final answer:

Instructional notes in both the Alphabetic Index and the Tabular List are essential for guiding coders in selecting ICD-10-CM codes.

Explanation:

In the ICD-10-CM coding system, both the Alphabetic Index and the Tabular List provide instructional notes to guide coders in selecting codes. These notes are important for ensuring accurate coding and adherence to coding guidelines.

In the Alphabetic Index, instructional notes can provide additional specificity or exclusions for certain code entries. For example, an instructional note may specify that a particular code should only be used for a certain condition or age group.

In the Tabular List, there are also instructional notes that provide guidance on code sequencing, combination codes, and other important coding rules. These notes help coders determine the correct code based on specific conditions or circumstances.

Learn more about ICD-10-CM coding here:

https://brainly.com/question/33722615

#SPJ11

90% H₂O
10%
solute
85% H₂O
15% solute
45% H₂O
65%
solute
75% H₂O
25% solute
30% H₂O
10%
solute
90% H₂O
10% solute
2
5.
8.
40% H₂O
60%
solute
90% H₂O
10% solute
90% H₂O
10%
solute
63% H₂O
37% solute
82% H₂O
18%
solute
25% H₂O
75% solute
3.
6.
9.
75% H₂O
25%
solute
80% H₂O
20% solute
50% H₂O
50%
solute
50% H₂O
50% solute
90% H₂O
10%
solute
80% H₂O
20% solute

Answers

A hypotonic solution is one in which there is more water than solutes, such as when there are 10% solutes and 85% water. When there are more solutes than water, it is called a hypertonic solution, such as 40% water and 60% solutes, whereas in an isotonic solution, the concentration is the same.

What is the significance of the different solutes in the concentration?

There are different solutions based upon the solutes and the solvent ratios, such as when the cell is placed in the hypertonic solutions, the cell removes water to the outside, and when placed in the isotonic solutions, the size of the cell remains the same.

Hence, a hypotonic solution is one in which there is more water than solutes, such as when there are 10% solutes and 85% water. When there are more solutes than water, it is called a hypertonic solution, such as 40% water and 60% solutes, whereas in an isotonic solution, the concentration is the same.

Learn more about the solutes in the concentration here.

https://brainly.com/question/10720472

#SPJ1

Other Questions
what allows for interoperability between devices that lets nurses and providers have consistency in the delivery of information? The path of a large arrow fired from a catapult can be modeled by y= -0.0044x^2+1.68x, where x is the distance the arrow traveled (in yards) and y is the height of the arrow (yards). Give the height of the castle wall, find the safest distance from the wall to launch an arrow over the wall.1. the height of the wall is 120 yards2. the height of the wall is 100 feet. Consider AABC, where tan B=A15sin (A) =(Sketch triangle)158BC I NEED HELP ASAP PLZ What is the WACC for Snuggly Baby Corp. if the tax rate is 24.00% and the firm has 6,130,000.00 shares of common equity priced at $16.00 each with an expected return of 20.18% and an expected real return of 14.61%; 1,006,000.00 shares of preferred equity priced at $30.00 each with an expected return of 16.34% and an expected real return of 11.16%; and 81,400.00 bonds that are priced at $925.00 each, and have a current yield of 11.22%, a yield-to-maturity of 12.36%, and a coupon rate of 10.38% a 40.0 ml sample of 0.33 m hclo4 is titrated with 0.50 m naoh. what is the ph after the addition of 15.0 ml of titrant? In dogs, dark coat color (D) is dominant over albino (d), and short hair (S) is dominant over long hair (s). In a cross, one parent was dark, long and the other was albino, short. They had 2 dark, short puppies; 3 dark, long puppies; 3 albino, short puppies and 2 albino, long puppies. Determine the genotypes of the parents. Group of answer choices DDss X ddSs DDSs X ddSs Ddss X ddSs Ddss X ddSS 30 points for anyone who solves this T or F - Neutron stars emit radio waves. Typically, most of the nucleotide variability that occurs within a genetic locus does not affect the phenotype. Explain why. Please help me with thisPs: no part b Solve for X-3(x - 2) = 4(x + 1) Heather makes $10 per hour working at the mall. Whichequation represents the total amount of money, d, Heathermakes in h hours?Ah = 10+ 0Bd = 10hC) h = 10-dD d = 10+hActivate WindowsGo to PC settings to ad In a major study of leadership effectiveness, the Forum Corporation reports on the characteristics of successful leaders at middle to senior levels of responsibility. Identify a key finding of the study.A) Positions and titles are directly related to leadership performance.B) Organizational leadership involves individualism more than interdependence.C) An organization's environment plays an insignificant role in developing plans to meet organizational challenges.D) Leaders inspire others to take on the tasks of leadership. Why do you need to use a solvent mixture such as hexane-isopropanol to extract lipids? what is the additve inverse of 9/10 Why is yellow journalism not a reliable news source? What do people do on Feast of the Virgin of Guadalupe? Helpppppppp me plzzzz Rewrite the polynomial in the form ax+by+cax+by+c and then identify the values of a,a, b,b, and cc. 7x-y/4+4