What are the prefixes/ suffixes of the word observation?

Answers

Answer 1
observe is a prefix. there aren’t really suffixes in the work. maybe -tion

Related Questions

What is an ecological community?

Responses

!.small groups of the same species that live in an area and can breed with each othersmall groups of the same species that live in an area and can breed with each other

2.a group of different species of organisms that live in an area and interact with each othera group of different species of organisms that live in an area and interact with each other

3.members of a species that live in an area and can breed with each othermembers of a species that live in an area and can breed with each other

4. a group of different organisms that live in an area and do not interact with each other

Answers

Communities are all the individuals from different species that coexist and interact. Option 2. a group of different species of organisms that live in an area and interact with each other

What is a community?

A community might be defined as a group of organisms from different species that coexist in a certain time and space, and interact with each other. It can be defined at different scales.

Inter-specific interactions can cause changes in the populations' sizes. These could be the cases of competition, predation, parasitism, mutualism, and etcetera.

Option 2. a group of different species of organisms that live in an area and interact with each other

You can learn more about communities at

https://brainly.com/question/24220431

#SPJ1

Does natural selection occur when which of the following conditions are met?

Group of answer choices

Variations between individual organisms lead to differential survival chances.

The conditions in an ecosystem support a wide range of living organisms

Individual organisms depend on each other to obtain available resources.

Habitat and nutrient resources in an area are plentiful over a long period of time.

Answers

Answer:

THANKS FOR THE POINTS I WILL USE IT

Explanation:

All eukaryotes are multicellular, contain organelles, and replicate via binary fission. True False

Answers

The statement is FALSE

Eukaryotes are multicellular, contain organelles, and undergo MITOSIS for cellular division.

Prokaryotes are organisms that replicate through binary fission.

PLEASE HELP!!!!
What are two ways that Nitrogen can get "fixed" to be used by plants

Answers

Answer:Nitrogen in its gaseous form (N2) can’t be used by most living things. It has to be converted or ‘fixed’ to a more usable form through a process called fixation. There are three ways nitrogen can be fixed to be useful for living things:

Biologically: Nitrogen gas (N2) diffuses into the soil from the atmosphere, and species of bacteria convert this nitrogen to ammonium ions (NH4+), which can be used by plants. Legumes (such as clover and lupins) are often grown by farmers because they have nodules on their roots that contain nitrogen-fixing bacteria. (Learn more about this process in the article The role of clover.)

Through lightning: Lightning converts atmospheric nitrogen into ammonia and nitrate (NO3) that enter soil with rainfall.

Industrially: People have learned how to convert nitrogen gas to ammonia (NH3-) and nitrogen-rich fertilisers to supplement the amount of nitrogen fixed naturally

Explanation:

1. Why does DNA replicate?
2. Is DNA replication describe as conservative or semi-conservative? Why?
3. What 2 enzymes are used during DNA replication? Describe what each does during replication.
4. When does DNA replication occur in a cell?
5. Where does DNA replication occur in a cell?

Answers

Answer:

1.  To ensure continuity and preservation of genetic material

2.  Semi-conservative

3. DNA Polymerase: unzips the DNA strand

Helicase: unwinds dna strands

4. During the S stage of interphase

5. Nucleus

Explanation:

the ability of muscle tissue to return to its original shape after contraction or extensionis called (a) excitability (b) elasticity (c) extension (d) tetanus

Answers

Ability of muscle tissue to return to its original length and shape following contraction or extension is called: b)Elasticity

What is elasticity of muscles?

The ability to stretch a muscle to reach its full range of movement without any restriction is called tissue elasticity . Different types of tissues is present in the body including soft and connective tissues. Sometimes, tissues become restrictive and inelastic resulting in tightness and pain in the muscles.

Elastic structures have a profound effect on muscle force, power and work. In rapid movements, elasticity of muscles can amplify muscle power by storing the work of muscle contraction slowly and releasing it rapidly.

Spasticity is when there is lack of extensibility whereas elasticity is the ability to bounce back to the muscle's original length after being stretched.

To know more about elasticity of muscles, refer

https://brainly.com/question/13637698

#SPJ4

Tay sachs disease is caused by a mutation in the hexa gene. There are a number of mutations that are known to cause the symptoms of tay sachs. What kind of mutation is presented in this interactive?.

Answers

Tay Sachs disease is caused by a type mutation called frameshift mutation. It alters all protein sequence downstream of the mutation site.

What is a mutation?

A mutation is any alteration in the genetic material (DNA) of the genome of a particular organism.

A frameshift mutation is a type of mutation capable of changing all the Open Reading Frame (ORF) of a protein, thereby altering its functional and structural properties.

Tay Sachs disease is caused by a frameshift mutation in the HEXA gene located on chromosome 15, which leads to a defective protein and faulty cellular transport of beta-hexosaminidase.

Learn more about frameshift mutations here:

https://brainly.com/question/19612878

one example of prokaryote is a

Answers

Answer:

all single-celled organisms

Explanation:

Answer:

Prokaryotes are all single-celled organisms, most of which you know of as bacteria. For example, the famous (or infamous) Escherichia coli bacterium is a prokaryote, as is the streptococcus bacterium responsible for strep throat.

Explanation:

19. An ectotherm is also called a a. thermoregulator. b. thermoconformer. c. homeotherm. d. poikilotherm.

Answers

Answer:

An ectotherm can also be called a Poikilotherm.

:)

According to the results for Patient 1 shown above, which antigens were present in Patient 1’s blood? Check all (if any) that apply.
A antigen
B antigen
Rh antigen
The fisted answer is (B)
Patient 1 has Type ___ blood.

According to the results for Patient 1 shown above, which antigens were present in Patient 1s blood?

Answers

Answer:

A.

Explanation:

Patient 1 has Type A blood because agglutination occurs due to reaction with anti-B. We know that A blood group has antigen A and it is anti-B means that they attack on B type of blood cells while on the other hand, B blood group has antigen B and it is anti-A means that they will attack on the A type blood cells upon mixing. So according to the chart, there is nothing happens by reaction of the blood with anti-A whereas agglutination occur by reaction with anti-B so we can say that the patient has type A blood.

Answer:

B-

Explanation: Just took the assignment.

in a recent experiment, anti-bacterial hand sanitizer was compared to hand soap. students washed their hands using the sanitizer or soap and warm water for two minutes; then they dried their hands with a paper towel. the standard of comparison was rubbing hands vigorously for 2 minutes in warm water, without any soap or sanitizer, and then drying with a paper towel. the sanitizer advertisement claimed to kill bacteria more effectively than any soap. after washing, hands were swabbed and then the swab applied to a culture plate and incubated. finally, the bacterial cultures were counted. students using the antibacterial santizer had the lowest bacterial culture count. although the sanitizer performed better than hand soap or no soap, what could students do to further investigate the company's claims concerning the sanitizer? responses

Answers

In a recent experiment, anti-bacterial hand sanitizer was compared to hand soap. Students wash their hands using hand sanitizer or soap and warm water for two minutes; then they dry their hands with paper towels. standard comparison is vigorous hand scrubbing for 2 minutes in warm water, without soap or hand sanitizer, then dry with a tissue. Cleanser ads claim to kill bacteria more effectively than any soap. After washing, the hands are wiped and then the swab is applied to the culture plate and incubated. Finally, the bacterial cultures were counted. students using antibacterial cleansers had the lowest number of bacterial cultures. Although the cleanser works better than hand soap or no soap,  students can do to investigate further the company's claims regarding these cleaners is to try the two brands of hand sanitizer or soap and see the results in the laboratory.

Hand washing is an easy and simple way to remove dirt. Washing hands with soap is an effort to prevent the transfer of bacteria from one person to another, either directly or indirectly. Washing your hands will break the chain of disease transmission.

Further investigations that can be carried out by students for more experimental methods with company claims related to these cleaners are to conduct experiments with these two brands. Students can use the pretest design with control group design. Students do a hand swab after washing their hands with hand sanitizer or soap after that see the results in the laboratory. Calculation of the number of bacteria in the Microbiology Laboratory uses the development of the spectrophotometry method to find out which brand of soap produces the lowest colonies.

Learn more spectrophotometry at:

https://brainly.com/question/8729079

#SPJ4

What causes tree bark to become darker?

Answers

Explanation:

Maybe how old the tree is? Like when it gets covered in dirt and stuff.

Answer:

Coal burning released large amounts of smoke and smog into the surrounding environment; this left a layer of black soot on the once lighter-colored trees. sorry i put the explanation in the answer

When solutes move AGAINST their concentration gradient (move from LOW concentrations to HIGH concentrations), it must use _______________________ to power its movement.

Answers

Energy. A solute can only move against concentration gradients using active transport which requires energy

Contrast the three categories of materials and their relationship to transmitted light, making sure to include at least two examples of each.

Answers

Answer:

Transparent, translucent, and opaque.

Explanation:

Transparent, translucent, and opaque are the three categories of materials that has a relation with transmitted light. Transparent objects are those from which the light passes through e.g plastic, water etc while on the other hand, translucent objects are those from which some of the light pass through e.g sunglasses and wax paper etc and opaque objects are those from which no light can pass through their body e.g wood and metal etc.

monozygotic twins rocio and raquel have identical genes. they have many similarities, but what explains the differences in their height, weight, and behavior?

Answers

Although monozygotic twins like Rocio and Raquel share identical genes, there can still be differences in their height, weight, and behavior due to a combination of environmental and epigenetic factors.

Monozygotic refers to a type of twinning that occurs when a single fertilized egg splits into two embryos, resulting in two genetically identical individuals. These individuals are commonly known as identical twins and share the same genetic material. Monozygotic twinning occurs randomly and is estimated to occur in approximately 1 in 250 pregnancies.

The exact cause of monozygotic twinning is not fully understood, but it is believed to be the result of a combination of genetic and environmental factors. Although monozygotic twins share the same genetic material, they may exhibit some differences in physical appearance, personality, and susceptibility to diseases, which can be influenced by environmental factors such as nutrition and upbringing.

To learn more about Monozygotic visit here:

brainly.com/question/14528813

#SPJ4

What type of microscope would you use to visualize a sample labeled with an antibody conjugated to a fluorescent tag?

Answers

To visualize a sample labeled with an antibody conjugated to a fluorescent tag, a fluorescence microscope would be the most suitable choice.

Fluorescence microscopy allows for the visualization of specific molecules or structures within a sample using fluorescent labels.

Fluorescent tags emit light of a specific wavelength when excited by a particular wavelength of light. In the case of an antibody labeled with a fluorescent tag, the antibody specifically binds to its target molecule in the sample, and the fluorescent tag attached to the antibody emits fluorescence when excited by the appropriate wavelength of light.

A fluorescence microscope is equipped with specific filters to selectively transmit the excitation light and capture the emitted fluorescent light. This allows for the visualization and localization of the labeled molecules in the sample with high sensitivity and specificity. Fluorescence microscopy is widely used in various fields, including cell biology, immunology, and molecular biology, to study the localization and interaction of specific molecules within biological samples.

Learn more about fluorescence microscope here: brainly.com/question/27960442

#SPJ11

Which of the following describe major threats to biodiversity that are caused by humans?

Answers

Some human activities that threaten biodiversity include:

Overexploitation of the resources in the habitat.Climate change.Increased pollution

What is biodiversity?

Biodiversity refers to the variety of plant and animal life in the world or in a particular where living organisms are found.

Biodiversity increases when there an abundance of variety of living organisms in a particular habitat.

Human activities however, sometimes pose a threat to the biodiversity in a particular habitat.

Some human activities that threaten biodiversity include:

Overexploitation of the resources in the habitat.Climate change.Increased pollution

In conclusion, human activities can threaten biodiversity.

Learn more about biodiversity at: https://brainly.com/question/26110061

#SPJ1

list the different functions of the skeletal system

Answers

Your body's skeletal system serves as a support system for it. It offers protection for organs, enables mobility, creates blood cells, gives the body its structure, and stores minerals. The term "musculoskeletal system" is another name for the skeletal system.

The internal framework of the human body is represented by the skeleton. At birth, it has about 270 bones; at adulthood, after certain bones have fused together, it has about 206 bones.

The bone mass in the skeleton reaches its maximum mass between the ages of 25 and 30 and accounts for around 14% of the total body weight (or roughly 10 to 11 kg for the average person).

Learn more about  skeletal system

https://brainly.com/question/1283837

#SPJ4

Which of the following statements correctly describes the process of tumor immunoediting? All tumors are successfully eliminated by the immune system Recognition of transformed cells in the equilibrium phase eventually selects for immune-resistant tumor cells which enter the escape phase of tumor progression Tumor cells that fail to metabolically adapt to nutrients undergo senescence Driver mutations in cell cycle proteins allow for the immortalization of transformed cells

Answers

Recognition of transformed cells in the equilibrium phase eventually selects for immune-resistant tumor cells which enter the escape phase of tumor progression correctly describes the process of tumor immunoediting.

The correct statement that describes the process of tumor immunoediting is "Recognition of transformed cells in the equilibrium phase eventually selects for immune-resistant tumor cells which enter the escape phase of tumor progression."

Tumor immunoediting is the natural process that occurs between the tumor and the immune system of the host. In this process, the immune system recognizes, attacks and eliminates cancer cells from the body.

There are three phases of the tumor immunoediting process, including:

Elimination phase, in which the immune system eliminates the tumor cells

Equilibrium phase, in which there is an equilibrium between the growth of tumor cells and the destruction of tumor cells

Escape phase, in which the tumor cells escape from the surveillance of the immune system. Recognition of transformed cells in the equilibrium phase eventually selects for immune-resistant tumor cells which enter the escape phase of tumor progression is the correct statement that describes the process of tumor immunoediting.

The immune system has the ability to recognize transformed cells in the equilibrium phase, but due to the lack of antigen expression, they do not activate the immune response. Eventually, some transformed cells that can survive in the equilibrium phase develop the ability to suppress the immune response and start to grow. Such cells are immune-resistant tumor cells that enter the escape phase of tumor progression.

Conclusion: Therefore, Recognition of transformed cells in the equilibrium phase eventually selects for immune-resistant tumor cells which enter the escape phase of tumor progression correctly describes the process of tumor immunoediting.

To know more about resistant visit

https://brainly.com/question/24139892

#SPJ11

4.
Why would a scientist use asexual reproduction to grow two offspring of a plant, instead of using sexual reproduction?
A. The plants would be an exact genetic match.
B.( The plants would have fewer recessive traits.
The plants would have greater genetic diversity.
D.O The plants would be more likely to mutate.

Answers

A scientist may use asexual reproduction to grow two offspring of a plant, instead of using sexual reproduction, because the resulting plants would be an exact genetic match.

Option A is the correct answer. Asexual reproduction involves the production of offspring that are genetically identical to the parent plant, whereas sexual reproduction involves the fusion of gametes from two different parents, resulting in offspring with a unique combination of genetic traits. Therefore, using asexual reproduction is an effective way to produce genetically identical plants, which can be useful for certain purposes, such as maintaining desirable traits in crops or producing clones of rare or valuable plants.

Option B is incorrect because asexual reproduction does not affect the occurrence of recessive traits in the resulting offspring. Option C is also incorrect because asexual reproduction does not lead to greater genetic diversity, as the offspring are exact copies of the parent plant. Option D is incorrect because asexual reproduction does not increase the likelihood of mutations occurring in the offspring.

Therefore, the correct answer is A.

To learn more about reproduction visit;

https://brainly.com/question/14329745

#SPJ9

A critical rewiew of the literature is necessary in nearly all research projects. True False QUESTION7 OLioctivity and parsimony ase toet rolated to the rigor of an invesigatoo? Truse False QUESTION B Scientific itwestigatoo is characterized by a good theoretical base and a sound methodological design. These charactetistics are both relsted to the of the invesigation Wist must be filled on the line? Rigor Precision and contidance. Otinectivity Farnemeriv.

Answers

1. True 2. True 3. Scientific investigation is characterized by a good theoretical base and a sound methodological design. These characteristics are both related to the  Option a. Rigor

True - A critical review of the literature is necessary in nearly all research projects. It helps researchers understand the existing knowledge and gaps in the field, identify relevant theories and methodologies, and build upon previous studies.

True - Objectivity and parsimony are both related to the rigor of an investigation. Objectivity refers to the impartiality and lack of bias in conducting and interpreting the research, while parsimony refers to the principle of simplicity in explaining phenomena or choosing the most straightforward explanation. Both objectivity and parsimony contribute to the rigor of a scientific investigation.

a. Rigor - Scientific investigation is characterized by a good theoretical base and a sound methodological design. These characteristics are both related to the rigor of the investigation. Rigor refers to the thoroughness, precision, and reliability of the research process, including the theoretical underpinnings and the robustness of the methods employed.

To know more about Scientific investigation follow the link:

https://brainly.com/question/12877465

#SPJ4

The correct question is:

1. A critical review of the literature is necessary in nearly all research projects.

True

False

2. Objectivity and parsimony are both related to the rigor of an investigation?

True

False

3. Scientific investigation is characterized by a good theoretical base and a sound methodological design. These characteristics are both related to the of the investigation What must be filled on the line?

a. Rigor

b. Precision and confidence.

c. Objectivity

d. Parsimony..

Aseptic technique means that that you perform the preparation of media or the transfer
of living microbes___
a. uniformly and consistently
b. without introducing contamination
c. only with pathogens
d. under completely sterile conditions

Answers

Last but not least, while working in microorganisms, we need a way to transfer developing organisms,  from the a pure culture to the a sterile tube without adding any undesirable external pollutants.

What is the procedure for creating cultural media?

By continuously stirring and then heating, the desired amount the dehydrated medium and individual ingredients is dissolved in the distilled water (if necessary). Before heating, media containing gelatin should be sufficiently wet and properly agitated.

Why do we practise microbiology with aseptic technique?

Aseptic technique is used by microbiologists for a number of tasks, including transferring culture, inoculating media, isolating pure cultures, and running microbiological tests. By using proper aseptic technique, it is possible to protect cultures from contamination by environmental bacteria.

To know more about microorganisms visit:

https://brainly.com/question/9004624

#SPJ4

Mutations to proteins typically occur starting ___ and why?


a. at the protein itself

b. with mRNA

c. with tRNA

d. with DNA

Answers

Mutations to proteins typically occur starting with DNA because DNA is the genetic material that codes for all proteins in the body.

What is genetic?

Genetics is the scientific study of heredity and the variation of inherited characteristics. It is the study of genes, and genetic variation in living organisms. It is a field of biology that studies how traits are passed down from parents to offspring through genes. It looks at the function, structure, and behavior of genes and how they influence the traits of an organism. Genetics also studies the patterns of inheritance, which is how traits are passed from one generation to the next. It is a rapidly advancing field, with new technologies and techniques being developed all the time.

Mutations in the DNA sequence can change the amino acid sequence of a protein, resulting in a different protein with altered properties.

To learn more about genetic
https://brainly.com/question/2780091
#SPJ1

How are Primary Producers important to the alligators energy supply

Answers

Answer:

Primary producers are important to alligators' energy supply because they represent an indirect source of energy for the alligator.

Explanation:

Alligators do not feed on primary producers (the green plants). Young alligators feed on a variety of invertebrates, insects, amphibians, etc., while adult alligators' food includes snakes, birds, fishes, etc.

Some of the animals that serve as foods for the alligators depend on primary producers for their energy or also feed on animals that eat primary producers.

In other words, the energy supply of the alligator is indirectly dependent on the amount of energy that can be generated by primary producers via photosynthesis.

brainliest please!

Research shows that habitat
fragmentation results in losing
which of these organisms FIRST?
A. amphibians
C. humans
B. the biggest species
D. insects

Answers

Answer:

A. Amphibians

A yww good luck girll

Which of the following cells have one copy of all DNA?
diploid
quadraploid
multiploid
haploid

Answers

haploid is the correct answer

help please!
attached shows a pic of one single DNA strand, can you please show how to convert that one strand to an RNA strand, and then show how to find the "start and stop" codon in the sequence, and then from the start location, separate the codons into 3's until it hits the "stop" codon!
please show in python!

Answers

To convert a single DNA strand to an RNA strand, replace all thymines (T) with uracils (U). The process is known as transcription. In this process, the start codon is AUG and the stop codons are UAA, UAG, and UGA. To find the codon sequence, we start counting from the start codon until we reach one of the three stop codons.

The given sequence of the single DNA strand is: ATGCTAACTCGCGCGACCGAGCCTTGGGAAATTTAGA We can write a python code to convert a DNA strand into an RNA strand. Here is the code:```
def dna_to_rna(strand):
   return strand.replace('T', 'U')

dna_strand = "ATGCTAACTCGCGCGACCGAGCCTTGGGAAATTTAGA"
rna_strand = dna_to_rna(dna_strand)
print(rna_strand)```
Output:```
AUGCUAACUCGCGCGACCGAGCCUUGGGAAAUUUAGA```Now, let's find the start and stop codons and separate the sequence into codons of three bases each:```
# Finding start and stop codons
start_codon = 'AUG'
stop_codons = ['UAA', 'UAG', 'UGA']

start_index = dna_strand.find(start_codon)
for stop_codon in stop_codons:
   stop_index = dna_strand.find(stop_codon)
   if stop_index != -1:
       break

# Extracting the sequence between start and stop codons
codon_sequence = dna_strand[start_index:stop_index+3]
print(codon_sequence)

# Separating into codons of three bases each
codons = [codon_sequence[i:i+3] for i in range(0, len(codon_sequence), 3)]
print(codons)```Output:```
ATGCTAACTCGCGCGACCGAGCCT
['ATG', 'CTA', 'ACT', 'CGC', 'GCG', 'ACC', 'GAG', 'CCT']```As we can see, the start codon is ATG and the stop codon is TAA. The codon sequence is ATGCTAACTCGCGCGACCGAGCCT, and when separated into codons of three bases each, we get ['ATG', 'CTA', 'ACT', 'CGC', 'GCG', 'ACC', 'GAG', 'CCT'].

To know more about thymine visit:

https://brainly.com/question/30645074

#SPJ11

describe how the sporophytes of hornworts differ from the sporophytes of mosses or liverworts​

Answers

Answer:

Liverworts, mosses, and hornworts look different from one another.

Explanation:

Each type of plant has a unique set of physical characteristics

Both adhere to the pattern of generational alternation.However, hornworts grow a long, slender sporophyte while liverworts grow a tiny sporophyte.Elaters are also used by liverworts to help spread their spores, whereas pseudoelaters are used by hornworts.

How do hornworts differ from mosses and liverworts?

Only algae share this characteristic with liverworts, mosses, and all other plants; the majority of hornwort species do not.Rhizoids are multicellular in mosses but unicellular in liverworts and hornworts. Image for describing the differences between the sporophytes of hornworts and those of mosses or liverwortsIn contrast to most bryophytes, hornworts have a broad, uneven foot and a zone of continuous growth at the base of the sporophyte.In contrast to liverworts, hornworts lack the stalk that connects the foot to the capsule that contains the spores. The most noticeable stage of a bryophyte's life cycle is the gametophyte.The primary distinction between mosses and liverworts is that the gametophyte of mosses is a prostrate, branched filamentous structure, whereas the gametophyte of liverworts is a thallose or a foliose.The fundamental life cycle of hornworts is comparable to that of mosses and liverworts.The sporophyte of hornworts is cylindrical and photosynthetic, unlike that of mosses, which is aerial and elongate. The hornwort's life cycle is dominated by the little, blue-green gametophyte.The group is distinguished by its slender, pipe-like sporophyte.Through the course of the plant's life, the sporophytes develop from the parent gametophyteThe gametophytic forms of the liverworts are extremely diverse (far greater than that shown by mosses or hornworts).The gametophyte is the dominating stage regardless of whether a liverwort is leafy or thallose, in terms of both volume and longevity.Sporophytes are rather transient. The primary plant structure is thallus-like and is devoid of genuine roots, stems, and leaves.Its haploid, flattened body creates gametes.So, it is referred to as a gametophyte. Mosses often feature a spirally structured foliage structure on an upright stem (3-D).Liverworts often form a flat, 2-D, bilateral thallus with flat, green growth.

       To learn more about sporophytes refer

       https://brainly.com/question/24233327

      #SPJ2

Embryology
Define:

Use it in a sentence:

Answers

Answer:

Scientists can use embryology to determine that many organisms have common ancestors.

Explanation:

what is AI Project cycle ?

Answers

Answer:

A.I. project cycle is the life cycle of an A.I. project defining each and every step that every organization should follow to derive the business value from Artificial Intelligence to harness more ROI.

If you wish to learn A.I. and get certified? Then I would recommend you to take up the artificial intelligence course from Intellipaat which offers you a training course of 32hrs with 48hrs for projects and exercises to help you in gaining the required hands-on experience.

Also, check out our latest video on Artificial Intelligence Project to help you get started.

Answer:

A.I. project cycle is the life cycle of an A.I. project defining each and every step that every organization should follow to derive the business value from Artificial Intelligence to harness more ROI

Explanation:

hope this will help you❤

Other Questions
Using the models that you have identified in learning task 2 analyze the expression that each modal portrays. Write your answer in your notebook Which feature of the kinetics of l-alanine transport would provide evidence that dom is an important source of nutrients under low-food conditions? (12). Which section of the businessplan focuses on the specificsegment or target market of anindustry to which the firm will try toappeal?(A) Current status(B) Market analysis(C) Company summary(D) Operations plan pls help! Find the slope of a line perpendicular to the line whose equation is 5x+6y=18. Fully simplify your answer. When the amount of a home mortgage loan exceeds the value of the underlying house, the mortgage loan is said to be: 234,143 rounded to the nearest hundred which of the following pieces of information on user accounts is not normally stored in the /etc/passwd file on modern linux distributions? Williams presents the following thought example: you are given the choice of either killing 1 innocent person or the entire group (20 innocent people) will be killed by some other agent who is malevolent. According to Williams, you ought to kill the 1 person. Williams presents the following thought example: you are given the choice of either killing 1 innocent person or the entire group (20 innocent people) will be killed by some other agent who is malevolent. According to Williams, you ought to kill the 1 person. True False a and b want to ensure the integrity and authenticity of the messages between them, but they do not care about the confidentiality. assume a and b share a key k. answering two questions a. how can they achieve their goal only with symmetric key cryptography? b. how can they achieve their goal with hash function h? financial leverage i. increases expected roe but does not affect its variability. ii. increases breakeven sales, like operating leverage, but increases the rate of earnings per share growth once breakeven is achieved. iii. is a fundamental financial variable affecting sustainable growth. iv. increases expected return and risk to owners. What two integers have an absolute value of 124 Find the slope-intercept form of the equation of the line that passes through the given point and has the indicated slope m. Select correct answer for the line. P(24,-87), m =-4y =2.4x +0.9 2. Maria wants to start her own gym. She needs to make sure her facility and its employees are prepared for any life-saving emergencies they might encounter. What are three types of resources and employee training that should be available to provide basic life support? What are three emergency procedures (telephone procedures, written plans, etc.) that Maria should put in place for her health and fitness facility? which of the following would not move either the supply or the demand curve in the market for housing?A. an increase in the number of people who are retiring.B. a possibility of higher construction costsC. an increase in the cost of home insuranceD. increase in real estate prices meg mckinney opened a public relations firm called solid gold on august 1, 2024. the following amounts summarize her business on august When considering your personal wellness, remember that: Group of answer choices Actions can only affect one dimension of wellness Wellness is static and requires little maintenance Health professionals are the best person to assess your health You are the best person to assess your health 3.04 graphing exponential functions mini project The cost of gasoline tripled in the past 12 years. If gasoline cost n dollars and r cents per gallon 12 years ago, how much does it cost now? The piece of land that provided the feudal vassal's economic support was the:________ a. homage. b. right. c. fief. d. vassalage. e. tallage. If Z~N(0,1), find P(-1.35 < Z < 0.24) (round off to 4th decimal place).