What are some examples of mutual aid institutions?

Answers

Answer 1

Some examples of the mutual aid institutions are the Unions that are formed during the emergency situations.

Mutual aid institutions are the institutions which are formed to tackle the emergency situation that occur in any country or state. The emergency situation may arise from any man made hazard or natural hazard. Man made hazards include fire, chemical leakages, etc. while natural hazards include floods, earthquakes, etc. The governments of different countries form unions which help the people who suffer from these hazards and these unions help people of different as well as same country in the time of any emergency situation. Some other mutual aid institutions include Societies, social groups and Guilds.

Learn more about Mutual aid at:

brainly.com/question/29641093

#SPJ4


Related Questions

An attorney hired a recent law school graduate as an associate. For the first six months, the associate was assigned to draft legal documents that the attorney carefully reviewed and revised before filing. However, shortly after the associate was admitted to the bar, the attorney told the associate that he would be going on vacation the following week and was assigning her the representation of the landlord in a housing case that was going to trial while he was away. The associate had never conducted or observed a trial before and, because she had not previously worked on any housing cases, she was unfamiliar with the relevant law and procedure. She did not believe that she would have enough time to learn everything that she needed to know, but she was reluctant to decline the assignment. Before the trial began, she met with the landlord and disclosed that this would be her first trial, but the landlord did not object. Although the associate prepared diligently, the landlord lost the trial. Is the attorney subject to discipline

Answers

Lawyers are required to deliver proficient advocacy to their clients as part of their professional duties. To provide capable representation, one must possess the appropriate expertise, aptitude, meticulousness, etc.

What is the case about?

If a lawyer delegates a complicated case to a new colleague without sufficient monitoring or assistance, it may give rise to doubts about the lawyer's fulfillment of their responsibility to be proficient.

In the situation above, the lawyer entrusted an inexperienced associate with the responsibility of leading or witnessing a trial for the first time. Moreover, the associate lacked knowledge about the appropriate legislation and protocol concerning matters related to housing.

Learn more about  attorney  from

https://brainly.com/question/29731616

#SPJ4

In the end of the court case it was decided by the court that Sally was just over-reacting and should not receive any retribution for the stolen boyfriend. She decides she wants a second opinion and therefore appeals. The court is known as: *

Answers

Answer:

Appellate Court.

Explanation:

The Appellate Court, also known as the Court of Appeals, is a judicial court that hears cases which have been already heard in other courts. The duty of an appellate court is to review the processes and verdicts givens by the trial courts.

Here, since Sally is not satisfied with the judgement made by the trial court, she can apply for a hearing in the Appellate Court. The appellate court would review hear case and make the final decision.

CÁCH LÀM BÀI THU HOẠCH

Answers

Answer:

Bạn nên hỏi bằng Tiếng Anh ấy ạ. Sẽ có nhiều người dễ chỉ hơn ạ. Đa số người nước ngoài, hỏi Tiếng Việt họ không hiểu đâu ạ.

Steps in the bank reconciliation process

Answers

Answer:

Steps:

Explanation:

1: Compare the bank account balance to the cash balance on your books

2: Scrutinize your bank statement

3: Scrutinize your cash book

4: Adjust the balance of your bank account

5: Adjust the balance of your books

6: Record the reconciliation

(Hope this helps?)

a medical assistant posts damaging remarks on a social media site about a provider at the clinic where she is employed. she may be legally found guilty of which of the following?

Answers

Answer:

The medical assistant may be legally found guilty of defamation if the damaging remarks made on social media are untrue and harm the reputation of the provider. Defamation is the act of making false statements that harm the reputation of another person.

Explanation:

The legal implications of a medical assistant posting damaging remarks about a provider on a social media site can vary depending on the specific circumstances and jurisdiction.

Some potential legal consequences could include: Defamation: If the damaging remarks are false and harm the reputation of the provider, the medical assistant could potentially be held liable for defamation. Defamation involves making false statements about someone that harm their reputation. Breach of confidentiality: If the damaging remarks disclose confidential.

Breach of employment contract or policies: Many employment contracts and workplace policies include provisions regarding employee behavior, use of social media, and maintaining professionalism.Legal action by the provider: The provider who is the subject of the damaging remarks may choose to pursue legal action against the medical assistant for any harm caused, such as seeking damages for defamation or invasion of privacy.

To learn more about Jurisdiction visit here:

brainly.com/question/14179714

#SPJ11

(Case Study Question) Because Henry has a history of heart disease, he is concerned that his poor health may leave him incapacitated in the future. He would like to give his oldest child the right to make medical decisions if he is so ill he is unable to make them himself. Which of the following documents would accomplish this?
A) Living will
B) Power of appointment
C) Living trust
D) Durable power of attorney for health care (DPOAHC)

Answers

The document that would accomplish Henry's goal of granting his oldest child the right to make medical decisions on his behalf if he becomes incapacitated is option D) Durable power of attorney for health care (DPOAHC).

A Durable Power of Attorney for Health Care is a legal document that allows an individual (the principal) to designate someone (the agent or attorney-in-fact) to make healthcare decisions on their behalf if they become unable to do so themselves. This document ensures that Henry's wishes regarding his medical treatment and care are respected and followed, even if he is unable to communicate or make decisions.

Unlike a living will, which only specifies a person's preferences for end-of-life care, a DPOAHC grants broader decision-making authority to the designated agent. It allows the agent to make medical decisions in a variety of situations, not just limited to end-of-life care.

By selecting the Durable Power of Attorney for Health Care, Henry can ensure that his oldest child has the legal authority to act as his healthcare advocate and make important medical decisions on his behalf if he becomes incapacitated due to his poor health.

Learn more about attorney here:

https://brainly.com/question/31861735

#SPJ4

Local governments in texas, such as cities and counties, derive their authority from which sources?.

Answers

Answer:

mention four benefits the people on earth derive from oceans

Most illegal immigrants come from which country?

Answers

most illegal immigrants come from mexico

Mexico has been identified as the country from which the largest number of illegal immigrants come, particularly to the United States.

Mexico refers to a country that has been identified as a significant source of illegal immigrants, particularly in relation to the United States. Situated in North America, Mexico shares a border with the United States, making it geographically accessible for migration.

Economic factors, including limited job opportunities and lower wages in Mexico, often drive individuals to seek better prospects across the border.

Political and social factors, such as violence, corruption, and instability, also contribute to migration flows. The complex interplay of these factors makes Mexico a notable origin country for illegal immigration.

Learn more about immigrants here:

https://brainly.com/question/28791683

#SPJ6

How does studying sociology benefit people's thinking?
It helps people focus more on nature than on nurture to
understand human behavior.
It helps people use their preconceived notions to form opinions
about others.
It helps people be more open to diverse cultures and different
perspectives.
It helps people understand others in isolation from their social
contexts.

Answers

Studying sociology helps people be more open to diverse cultures and different

   Sociology is a discipline that analyzes human society critically. Different cultures are a result of the fact that societies are rarely culturally homogeneous. Different cultural traditions emerge as cultures grow and become more complicated. The likelihood that a culture will be internally diverse and varied increases with the complexity of the society. Cultural diffusion, invention, and the imposing of cultural change by the outside world are the causes of cultural changes in a society.

    Thus sociology examines human society in order to understand cultural diversity. It claims that factors like language, beliefs, customs, and values contribute to cultural diversity.

To learn more about sociology click here:

https://brainly.com/question/4120495

#SPJ9

Hello I need some help on this question because I’m overthinking that if it’s A,B,C my top three choices so please help me out on this one.

Hello I need some help on this question because Im overthinking that if its A,B,C my top three choices

Answers

Answer:

c

Explanation:

Because you should be patient

The government __________ is the difference produced when spending exceeds revenues in a fiscal year while the government __________ is the total amount of money borrowed over the years that is not yet repaid.
Group of answer choices

surplus; sequestration

sequestration; surplus

debt; deficit

deficit; debt

Answers

Answer:

debt is the answer to everything related to college payment

Explanation:

If a complaint has been filed against a licensee and the licensee refuses to mediate the complaint, what will happen

Answers

If a complaint has been filed against a licensee and the licensee refuses to mediate the complaint, the case will move on to arbitration or an administrative hearing.

If a licensee refuses to mediate a complaint, the case may move on to arbitration or an administrative hearing. Mediation is a common method of dispute resolution in which a neutral third party assists the parties in reaching a settlement. It is intended to be a less formal, more cooperative way of resolving conflicts than going to court. However, if one of the parties refuses to mediate, the process may have to be abandoned and the case taken to a more formal setting.

Arbitration is similar to mediation, but the arbitrator has the authority to make a binding decision. An administrative hearing is a formal proceeding before a government agency or tribunal. Both of these options are more formal and adversarial than mediation. The outcome of the case will depend on the facts and evidence presented, and may include disciplinary action against the licensee if it is determined that they violated any laws or regulations.

To know more about regulations visit :

https://brainly.com/question/29767609

#SPJ11

A hoax bomb is a device that appears to be an explosive device or by its design causes alarm of any type by an official of a public safety agency or a volunteer agency organized to deal with emergencies.
a. true
b. false

Answers

True. Any gadget, destructive weapon, or explosion is considered a hoax bomb.

Define a hoax bomb?

The term "hoax bomb" refers to any device or item that, through its design, construction, content, or characteristics, appears to be, or to contain, or is represented to be, or to contain, a destructive device or explosive as defined in this chapter but, in reality, is an imitation or facsimile that is inoperable or does not contain the destructive device or explosive that was represented to be present.

What are the restrictions and punishments for planting "hoax bombs"?

A felony is committed by anyone who creates, owns, sells, delivers, sends, mails, displays, uses, threatens to use, tries to use, conspires to use, or makes easily accessible to others a hoax bomb without the proper authorization.

To know more about Explosives visit:

https://brainly.com/question/8393707

#SPJ4

lab 14-1 which rule of the federal rules of civil procedure requires expert witnesses to submit written reports?

Answers

Rule 26 of the Federal Rules of Civil Procedure requires expert witnesses to submit written reports.

The rule states that an expert witness must provide a written report detailing the facts and opinions to which the witness is expected to testify. The report must include a complete statement of all the facts and opinions to which the witness is expected to testify, the reasons for the opinions, any exhibits to be used as evidence, and the qualifications of the witness.

The report must be provided at least 90 days before the trial date, and the expert must be available for deposition prior to trial. The expert's report must be signed, dated, and served on all parties in the case.

To know more about Federal , click here:

https://brainly.com/question/14858877

#SPJ4

4. Which term applies to the 20 permanent committees of the House?
a. standing committees
b. conference committees
c. select committees
d. joint committees ​

Answers

Answer:

Standing committees or select committees, one out of the two

The Enron scandal proved that self-regulation has only benefits and little to no drawbacks, as evidenced by the role of their accounting firm, Arthur Andersen.
Trur or False

Answers

The statement "The Enron scandal proved that self-regulation has only benefits and little to no drawbacks, as evidenced by the role of their accounting firm, Arthur Andersen." is false as Enron scandal actually demonstrated the drawbacks and limitations of self-regulation.

The auditing company for Enron's financial statements, Arthur Andersen, was linked to the scandal. They were charged with carelessness, using shady accounting methods, and failing to adequately disclose Enron's fraudulent activities. As a result, they were found guilty of obstructing the administration of justice which ultimately caused Arthur Andersen to cease to exist as a business.

The Enron scandal brought to light the dangers of relying solely on corporate self-regulation. It demonstrated the potential for conflicts of interest, a lack of transparency and inadequate oversight when businesses are allowed to regulate themselves without the proper external oversight. To avoid similar incidents in the future the scandal prompted calls for stricter regulations and more thorough oversight.

Learn more about Enron scandal at:

brainly.com/question/28076943

#SPJ4

Mintzberg sostiene la hipótesis de que si el núcleo operativo se automatiza la organización se vuelve más flexible. Explique por qué este autor sostiene tal cosa.

Answers

Answer:

which language is this?

3. how do the two differ in assessing the dangers to american freedom?

Answers

The difference in assessing the dangers to American freedom can be demonstrated by the fact that the two groups may have different criteria for what they consider to be a threat to American freedom.

One group may believe that a lack of economic opportunity is the greatest danger to American freedom, while another may see government intervention in the market as the greatest threat.The two differ in assessing the dangers to American freedom by their perspectives on what constitutes a threat to American freedom. They may disagree on what qualifies as a threat, how severe it is, and what should be done about it. Different individuals and groups may have different criteria for assessing the dangers to American freedom, and may prioritize different factors or issues. Therefore, different groups may come to different conclusions about what the most significant dangers to American freedom are, and how best to address them.

To know more about  intervention , visit ;

https://brainly.com/question/31580264

#SPJ11

State legislatures are the primary locus of ____________, which is the power to make laws in furtherance of the public health, safety, welfare, and morality.

Answers

The police power, which is the authority to enact laws to promote the public's health, safety, welfare, and morality, is primarily vested in state legislatures.

The primary responsibility of the police is to safeguard the public by detecting and preventing crime. The police have both common law and legislative authority to carry out this duty, which has been established in common law (precedents set by court decisions).

Laws governing equal rights and human rights must be compatible with the use of police authority. Each police officer is in charge of making sure their use of authority is proper, reasonable, and required.

Three categories can be used to classify police powers:

the ability to look into crimes - This includes a variety of authorities to gather information necessary to identify suspects and support a fair and efficient trial for them.

the ability to stop crime - This includes a variety of authority to preserve public peace, stop antisocial behaviour, and control known criminals or suspects.

the ability to "dispose" of criminal cases - Police can use these powers to resolve criminal cases outside of court or to charge suspects so that they can be brought to justice.

Learn more about "  police powers " to visit here;

https://brainly.com/question/2863065

#SPJ4

As a result of having no power to collect taxes under the Articles of Confederation, the confederal government could only raise funds by doing which of the following?

Select one:
A. borrowing money on credit
B. taxing the individual states
C. regulating internal trade
D. raiding Canadian mines

Answers

Answer:

borrowing money on credit

Explanation:

The federal government under the Articles of Confederation had to take out loans from foreign governments, though they also had no way of raising funds from the states to pay back these loans. Under the Articles of Confederation, the federal government quickly accumulated a large amount of national debt.

The answer to the question is A

The prosecutor kept saying that he has to meet her burden of proof with might be difficult in this case what does that mean

Answers

The prosecution has the burden of proof in a criminal trial. The defendant must be proven guilty of the allegations against them by the prosecution to the jury without a shadow of a doubt.

What does prosecution mean?

The decision to pursue a case is made by the magistrate based on the police report that was provided, and the prosecutor is then chosen. The prosecutor is chosen to act as the state's or the government's representative in any criminal case.

Such actions are started by the prosecuting attorney, who could be the federal United States Attorney, the state Attorney General, or the district attorney in question.

Learn more about prosecution from here:

https://brainly.com/question/23179189

#SPJ1

Do you think Mr. S is a reliable source? Explain your reasoning.

Answers

Answer:

No, I don't perceive Mr. S to be a reliable source. It is because the way he describes that how he discovered the Hae's body is enough to raise thr brows of viewers and listeners.

Explanation:

In Episode 3 of Serial, Mr. S is called by detectives to investigate his side of the story and how he came to find Hae's body which was found completely camouflaged in the dirt.

Mr. S can not be considered a reliabel source by the way he describes the event of his founding Hae's body in the forest, 127 miles away from the main road. Mr. S gives description to the detectives that he got off his car to pee and had a bottle of beer in his hand. It is interesting to note and enough to raise brows of listeners and viewers of the episode that how was he able to see Hae's body which was covered with dirt and was behind a heavy fallen log, which made impossible for someone to see the body easily (especially if someone is drunk).

So, because of this reasoning, one can not considered Mr. S to be a reliabel source.

This system of government where power lies with the legislative body and the chief executive (leader) is part of
the legislature.
confederal system
parliamentary
unitary
federal

Answers

Parliamentary i think :)

Private sector security officers are employed and utilized by a wide variety of of Government. Public and Corporates agencies. In this assianment. vou will review the associated Power Point Presentation RE Private Sector Security, to get An understandina of what agencies utilize private sector securty and now they use them
You will then write a one page report on how Govemment, Private, Cooperate Public and Indian Reservations utilize there services. DO NOT USE any of the agencies mentioned in the Power Point Presentation! Using the information you
have learned from the Power Point and from lecture, research an agency (Gov. Private, Cooperate, Public or Indian Reservation) that utilizes the services of Private Sector Security, in their business.

Answers

Answer:

The Business, Careers, and Challenges of Security and Loss Prevention

Philip P. Purpura, in Security and Loss Prevention (Sixth Edition), 2013

Regulation of the Industry

The security vocation has its share of charlatans who tarnish the industry, and, as with many types of services offered to the public, government intervention has taken the form of licensing and registration. The Task Force Report and Hallcrest Reports recommend regulation of the security industry by all states. To protect consumers, the majority of states have varied laws that regulate, through licensing and registration, contract security officer services, private investigators, polygraph and other detection-of-deception specialists, and security alarm businesses. Security consultants are generally not regulated, but consumers should verify professional memberships and certifications. Although government regulation does not guarantee that all security practitioners will perform in a satisfactory manner, it does prevent people who have criminal records from entering the profession. In the case of applicants who have lived in multiple states, their backgrounds should be checked in each jurisdiction.

Another way the industry is regulated is through local, state, and federal agencies that contract out private security services and mandate various contract requirements (e.g., education, training, and character) to enhance professionalism and competence. Certain industries are regulated by the government and require stringent security standards. For example, the U.S. Nuclear Regulatory Commission issues rules and standards that must be followed by licensees of nuclear reactors to ensure safety and security. A variety of businesses, institutions, and other organizations also issue requirements. Notably, when a contract is awarded simply to the lowest bidder, professionalism may be sacrificed.

Attempts have been made through Congress to pass a national law to regulate the security industry. In 1995, Rep. Bob Barr (R-GA) introduced H.R. 2092, The Private Security Officers Quality Assurance Act. It languished in Congress in various forms until Rep. Matthew Martinez (D-CA) introduced a similar bill. Known as the Barr-Martinez Bill, if passed, it would have provided state regulators with expedited FBI criminal background checks of prospective and newly hired security officers. The minimal training standards were struck from the bill. These would have required eight hours of training and four hours of on-the-job training for unarmed officers and an additional 15 hours for armed officers. Critics argued that states are against such a national law and state regulations are sufficient.

Finally, Congress passed the Private Security Officer Employment Authorization Act of 2004 (included in the National Intelligence Reform Act of 2004), which enables security service businesses and proprietary security organizations in all 50 states to check whether applicants have a criminal history record with the FBI, which may emanate from one or more states. (National training requirements were not included in the legislation.) This law is significant and adds strength to criminal records checks of security officer applicants. Traditional name-based searches can result in false positives (i.e., an applicant’s name is incorrectly matched to an offender’s name or similar name) and false negatives (i.e., an applicant’s name does not result in a match because the applicant is using a different name or a database was omitted from the investigation). Because applicants may use different names and other bogus identifying information, fingerprints provide increased accuracy in background investigations. Under the act, security firm access to the FBI’s Integrated Automated Fingerprint Identification System (IAFIS) also includes access to the Violent Gangs and Terrorism Organization File. Although not all security organizations are required to check these fingerprint databases for a match with their applicants, the effort and expense of doing so prevent litigation and the possibility that an applicant is a terrorist or other criminal. Cost is one of several factors that influence the extent of background investigations (Friedrick, 2005: 11).

Which government agency (or agencies) in your state regulates the private security industry? What are the requirements for contract security (“guard”) companies, private detectives, and security alarm installers? Are proprietary security organizations regulated in your state?

A husband and wife were charged with stealing credit cards and charging expensive items on the misappropriated cards. An attorney was appointed by the court to represent the couple jointly. At the preliminary hearing, the judge found that the attorney would have no conflict representing both defendants in the joint trial. Halfway through the trial, however, a conflict arose between the defenses of the husband and wife. At the wife's request, the attorney moved that another attorney be appointed to represent the wife and that a mistrial be declared. The trial judge moved favorably on the attorney's motion. Another attorney was appointed to represent the wife, and as soon as the wife's trial began, her attorney moved to dismiss the case on the ground that jeopardy had attached during the wife's first trial and that she was being retried in violation of the United States Constitution.

Required:
Should the judge grant the wife's attorney's motion?

Answers

Answer: The Judge should not grant the wife's attorney's motion.

Explanation:  In this case in the first trial the Judge awarded a mistrial due to a conflict in representation between the wife and the husband.  This could have been a serious procedural error that could have resulted in an unfair trial for the wife and/or the husband.  A mistrial adjourns the case without a decision and awards a new (fair) trial.  

Summarizing an essay after reading it is useful in order to:

A. keep you focused on your purpose for reading.

B. remember the meaning of unfamiliar words and phrases.

C. help you remember the important ideas better.

D. make connections with your prior knowledge.

Answers

Answer:

C

Explanation:

Essays are long, and can eventually result in losing the reader's interest. By writing a summary highlighting key events, one can get to the point while still getting educated enough to comprehend the concept/purpose of the essay.

Selective incorporation was created by

Answers

it was developed by the supreme court

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

Answers

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

a chief officer is known as a judge in a state court of record as well as in a federal court. T/F

Answers

True, a chief officer is known as a judge in both a state court of record and a federal court.

In the context of the judicial system, a chief officer or judge plays a crucial role in administering justice, overseeing court proceedings, and ensuring the fair application of the law.

Both state and federal courts consist of judges who are responsible for interpreting and applying the law within their jurisdiction. State courts of record handle cases involving state laws, while federal courts deal with cases involving federal laws, the U.S. Constitution, and disputes between states.

In both court systems, the judge's primary duty is to uphold justice and maintain an impartial and professional environment during legal proceedings.

To know more about federal court refer here: https://brainly.com/question/31037815#

#SPJ11

Imagine the federal government has a national debt of $12. 6 trillion. Congress's budget for the coming year includes a spending projection of $5. 1 trillion. Tax revenue is expected to be $4. 8 billion. Which fiscal policy should congress adopt to avoid increasing the national debt? lower taxes. Increase funding. Decrease spending. No change is necessary.

Answers

Given that spending is anticipated to exceed tax revenue in the upcoming year, legislators should implement an austerity-based fiscal strategy to prevent the national debt from rising.

In order to achieve this, government spending would need to be decreased in order to match tax income. Making changes to government programs and services would undoubtedly be necessary, and doing so may be contentious and politically challenging.It would be vital, nevertheless, to prevent adding to the nation's already significant debt.There are a few measures Congress might take to stop the growth of the national debt. Spending might be reduced by $300 billion as one alternative. This might be accomplished by cutting the funding for each department and agency of government.

learn more about  national debt here:

brainly.com/question/22684204

#SPJ4

Other Questions
what percentage of college football players make it to the nfl Why did many colonists inJamestown starve? Zietlow Corporation has 2.11 million shares of common stock outstanding with a book value per share of 75$ with a recent divided of 3.4$. The firm's capital includes 290000 shares 67% preferred stock outstanding with a par value of 100 and the firms debt include 2250 6.5 percent quarterly bonds outstanding with 25 years maturity issued yeago. The current trading pris of the preferred stock and bonds are 106% of its par value and comomon stock trades for 15$ with a constant growth rate of 6%. The beta of the stock is 1.13dthekel risk premium is 7% Calculate after tax Weighted Avergae Cost of Capital of the firm assuming a tax rate of 30%. 9. Maximize 1170x1 + 1110x2 Subject to: 9x1 + 5x22 500 7x1 + 9x22 300 5x1 + 3x2 1500 7x1 + 9x2 1900 2x1 + 4x2 1000 x 1, x2 2 0 Find graphically the feasible region and the optimal solution? (5%) Is melting chocolate in your hand conduction?. Can you please help me Label. . Major arteries of the Right Pelvis and Lower Limb Abdominal aorta R. external iliac a. R. popliteal a. R. fibular a. R. common iliac a. R. femoral a. R. anterior tibial a. R. posterior tibial a. aMaZon is taking forever to ship my tablet. answer with problems you've had with aMaZon Equations:Solve each of the following equations1. X - 1 = 1/2x2. 2y+7/4 = 123. 4y - 1/ 5y + 1 = 5/7please solve these questions step by step. Thank you a dielectric is inserted between the plates of an isolated, charged capacitor. as the dielectric is being inserted, will the electric field between the plates and the electric potential difference across the plates of the capacitor increase, decrease, or remain the same? 4. Select all the ways that describe thegraph of the function in interval 2.ty(2)(1)(3)The function is increasing.The slope is negative.The function is decreasing.The function is constant.The slope is positive. cpi adjustments in leases affect the riskiness of the lease from the lessors point of view? 2. Use this idea web to answer the following question.Louisiana State Governmentcollecttaxesrole ofstategovernment?provideresourcesto schoolsWhich of these best completes the idea web?A. deliver the mailB. elect mayors of citiesC. sell gasoline to citizensD. provide driver's licenses We must recognize the impending danger to the united states. The lend-lease act is needed to support the war in europe. Which person would most likely make this statement?. Y=-x^2 +78x-512 I need help with this problem Complete both transformations below. Then enter the final coordinates of the figure.K= 2 If the strike of a unit is 10 degrees west of north, what is the correct notation? A ONW10 B N10W C Northwest 10 D) S10E what is networking why is useful when looking for a job houlihan automotive specializes in replacing the brake pads and shoes on domestic automobiles. the replacement is similar for each type of automobile. each replacement takes one labor hour, 0.75 machine hours, and costs $55 in direct materials. houlihan charges customers a flat fee of $120. which cost system should houlihan use and why? what is the role of financial accounting in a business