the model of communication in which the sender and receiver play interchangeable roles, communicating simultaneously, is the: linear model interaction model transactional model shannon-weaver model

Answers

Answer 1

The model of communication in which the sender and receiver play interchangeable roles, communicating simultaneously, is the Transactional model.

What is Transactional model ?

In general, a transactional model is a model that considers interactions in two ways at once, such as from one person to another and back or from one subsystem to another and back.

The transactional model explains how transactions can be used in message flows to achieve certain goals and outcomes. A message flow is made up of the following components: an origin of input. The logic or message flow is determined by a series of nodes.

A face-to-face meeting, a phone, a session, interactive training or a meeting in which all participants participate by exchanging ideas and opinions are examples of the transactional model. Noises can interfere with communications, just like in the linear model.

To know more about Transactional model please click here ; https://brainly.com/question/14618508

#SPJ4


Related Questions

Which of the following elements has the highest atomic mass?
Helium: 2 protons and 2 neutrons
Nitrogen: 7 protons and 7 neutrons
Oxygen: 8 protons and 8 neutrons
Hydrogen: 1 proton and no neutrons

Will give crown.

Answers

Answer:

oxygen has the highest atomic mass.

Answer:

C Oxygen

Explanation:

The answer would be C since the protons and the neutrons are somewhat the same number / similar. As well as the periodic table would have somewhere in the elements "box".

What is the specific heat of a substance that absorbs 228 joules of heat when a sample of 706 g of the substance increases in tempature from 26.0 c to 88.8 c

Answers

Answer:

\(c=5.14\ J/kg ^{\circ} C\)

Explanation:

Given that,

Heat absorbed by a sample, Q = 228 J

Mass of a sample, m = 706 g = 0.706 kg

Initial temperature is 26 °C and final temperature is 88.8°C

We need to find the heat absorbed by the sample. The heat absorbed by an object is given by :

\(Q=mc\Delta T\\\\\text{Where c is specific heat of sample}\\\\c=\dfrac{Q}{m\Delta T}\\\\c=\dfrac{228\ J}{0.706\ kg(88.8-26)^{\circ} C}\\\\c=5.14\ J/kg ^{\circ} C\)

So, the specific heat of the sample is \(5.14\ J/kg ^{\circ} C\).

Which describes an atom that has fewer neutrons than protons and more lecterns than protons?

Answers

Answer:

An atom that has fewer neutrons than protons and more electrons than protons is a negative ion. The negatively charged particles in an atom are the electrons. The charge an atom carries depends on the balance between the number of protons and electrons in an atom.

Explanation:

All atoms of the same element must have the same number of what?

A.protons.
B.neutrons.
C.compounds.
D.electrons.

Answers

Answer:

A. protons

I hope this helps!

Answer:

A.

Explanation:

i just took the test and chose A.protons. lily~chan hopes she helps

Why do the planets in our solar system orbit in approximately the same plane around the sun?

Answers

The orbits of the planets are coplanar because during the Solar System's formation, the planets formed out of a disk of dust which surrounded the Sun. Because that disk of dust was a disk, all in a plane, all of the planets formed in a plane as well.

http://curious.astro.cornell.edu/about-us/57-our-solar-system/planets-and-dwarf-planets/orbits/242-why-do-all-the-planets-orbit-in-the-same-plane-intermediate

help with this question

help with this question

Answers

Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:

Which term is NOT submicroscopic?
A. atom
B. ion
C. pen
D. molecule

Answers

It’s is c and pen ushebejdhahejrdgwejr

27. The fundamental SI unit of length is the meter. How-

ever, we often deal with larger or smaller lengths or

distances for which multiples or fractions of the fun-

damental unit are more useful. For each of the fol-

lowing situations, suggest what fraction or multiple

of the meter might be the most appropriate mea-

surement.

a. the distance between Chicago and Saint Louis

b. the size of your bedroom

c. the dimensions of this textbook

d. the thickness of a hair

Answers

Answer:

A) Km

B) m

C) cm

D) mm

Explanation:

A) The distance between Chicago and Saint Louis is quite a distance and would be best presented in the largest multiple of the SI unit of length.

For example if the distance is 500000 m, it's a bit bogus to write, so we can simplify by writing in terms of 10^(-3) m which is in km.

Thus, we can write as 500000 × 10^(-3) km = 500 km

B) By standard measurement, the size of a bedroom is usually: 3.6 m × 3.6 m.

This not complex to write and can be kept as it is in metres.

C) The average dimension of a textbook is around 0.25 m by 0.2 m.

Let's get rid of the decimal by converting to terms of 10² m which is expressed as cm.

Thus, dimension is now: (0.25 × 10²) by (0.2 × 10²) = 25 cm by 20 cm

D) Average thickness of a hair in metres is 8 × 10^(-5) m.

Now this is a bit long. So we can express is in terms of 10^(3) m which is an expression denoted by millimeter (mm).

Thus, thickness is 8 × 10^(-5) × 10³ = 0.08 mm

2(t. A gas sample is held at constant pressure. The gas occupies 3.62 L of volume when the temperature is 21.6"C. Determine thetemperature at which the volume of the gas is 3.45 L.a) 309 K b) 281 K e) 20,6 K d) 294 K e) 326 K

Answers

They tell us that the pressure of the gas is constant and the temperature and volume vary. If we assume that the gas behaves like an ideal gas, we can apply Charles's law, which tells us:

\(\frac{V_1}{T_1}=\frac{V_2}{T_2}\)

where,

V1 is the initial volume, 3.62L

T1 is the initial temperature, 21.6°C=294.75K

V2 is the final volume, 3.45L

T2 is the final temperature, in Kelvin

Now, we clear T2 and replace the known data:

\(T_2=V_2\times\frac{T_1}{V_1}\)\(T_2=3.45L\times\frac{294.75K}{3.62L}=281K\)

The temperature at which the volume of the gas is 3.45 L will be 281K

Answer. b) 281K

The industrial degreasing solvent methylene chloride,CH2Cl2, is prepared from methane by reaction with chlorine:
CH4(g)+2Cl2(g)?CH2Cl2(g)+2HCl(g)
Use the following data to calculate ? H? in kilojoules for the reaction:
CH4(g)+Cl2(g)?CH3Cl(g)+HCl(g)?H?=?98.3kJCH3Cl(g)+Cl2(g)?CH2Cl2(g)+HCl(g)?H?=?104kJ
Express your answer using three significant figures.

Answers

The ΔH for the reaction CH₄(g) + 2Cl₂(g) → CH₂Cl₂(g) + 2HCl(g) is -202 kJ

To calculate the enthalpy (ΔH) for the reaction CH₄(g) + 2Cl₂(g) → CH₂Cl₂(g) + 2HCl(g), you need to add the ΔH values for the two given reactions.

1) CH₄(g) + Cl₂(g) → CH₃Cl(g) + HCl(g), ΔH = -98.3 kJ

2) CH3Cl(g) + Cl₂(g) → CH₂Cl₂(g) + HCl(g), ΔH = -104 kJ

Now, add the ΔH values for these reactions:

Total ΔH = (-98.3 kJ) + (-104 kJ) = -202.3 kJ

So, the ΔH for the reaction CH₄(g) + 2Cl₂(g) → CH₂Cl₂(g) + 2HCl(g) is -202 kJ (using three significant figures).

Learn more about enthalpy (ΔH): https://brainly.com/question/32332439

#SPJ11

Bromine trifluoride’s free-energy change is –229.4 kJ/mol, and water vapor’s is –228.6 kJ/mol. Though their free-energy changes are almost the same, bromine trifluoride reacts violently with water vapor, releasing much more energy than the water vapor. The field of chemistry called ______________ explains why bromine trifluoride reacts one way and water vapor reacts another during a reaction.

Answers

The field of chemistry called Kinetics explains why bromine trifluoride reacts one way and water vapor reacts another during a reaction.

What is Energy?

Energy is a fundamental concept in physics, often defined as the ability to do work. It can take many different forms, including thermal energy, kinetic energy, potential energy, electromagnetic radiation, and chemical energy, among others. Energy can be transferred from one system to another, and it can also be converted from one form to another. The SI unit of energy is the joule (J), although other units such as the calorie and the electronvolt are also used in specific contexts.

The field of chemistry that explains why bromine trifluoride reacts violently with water vapor while water vapor reacts differently is called reaction thermodynamics. Reaction thermodynamics is concerned with the energy changes that occur during chemical reactions, including the free energy change (ΔG), enthalpy change (ΔH), and entropy change (ΔS).

Learn more about Energy

brainly.com/question/2003548

#SPJ1

Trường hợp nào sau đây là chất tinh khiết

Answers

Sắt, thép và nước là một số ví dụ về một chất tinh khiết. Không khí có thể là một hỗn hợp đồng nhất thường được coi là một chất tinh khiết. Như chúng ta đã biết kim cương, đường sucrose, mật ong và không khí đều là những chất tinh khiết. Nước tinh khiết có hai nguyên tử hydro và một nguyên tử oxy.

Using the Reasoning Tool to Write a Scientific Argument
In the right column of the table below, record the claim you have selected.
After reviewing your Science Seminar Evidence Cards, select the evidence you feel best supports or refutes this claim. Record this evidence in the left column. Then, in the rows below, record up to three pieces of additional evidence you feel could further support or refute your claim.
In the middle column, explain how each piece of evidence either supports or refutes your claim.
Question: Why is the liquid oxygen machine producing less liquid oxygen than normal?

Claim 1: There is frozen water in tank 2, which is blocking some of the oxygen from going into tank 3.
Claim 2: Some of the liquid oxygen evaporated in tank 3.
Claim 3: Some of the oxygen didn’t condense in tank 2.

Reference information from the “Liquid Oxygen” article:

Water has a stronger attraction between molecules than oxygen or nitrogen.
Oxygen has a stronger attraction than nitrogen.

Answers

yes your are right because water do have a stronger attraction

What does the vsepr theory tell about a molecule

Answers

Answer:

Using the VSEPR theory, the electron bond pairs and lone pairs on the center atom will help us predict the shape of a molecule. The shape of a molecule is determined by the location of the nuclei and its electrons. The electrons and the nuclei settle into positions that minimize repulsion and maximize attraction.

chlorine gas is bubbled through an acidified solution of potassium permanganate (chlorate ion is one product)

Answers

When chlorine gas is bubbled through an acidified solution of potassium permanganate, a chemical reaction occurs, resulting in the formation of chlorate ions as one of the products.

The potassium permanganate acts as an oxidizing agent, while the chlorine gas acts as a reducing agent. The acidified solution helps to facilitate the reaction by providing a suitable environment for the chemical reaction to take place. Chlorine gas is highly reactive and can undergo oxidation and reduction reactions, making it a useful chemical in many industrial applications. In this particular reaction, it reacts with the potassium permanganate to form chlorate ion, which has its own range of applications in various industries, including the manufacture of fertilizers, herbicides, and explosives. Overall, the reaction between chlorine gas and an acidified solution of potassium permanganate is a useful chemical process that has many industrial applications. It highlights the importance of understanding the properties of different chemicals and how they can be used in various processes to create new products.

for more information on potassium permanganate see:

https://brainly.com/question/31384813

#SPJ11

4-How does the concentration of ions in a strong acid differ from a weak acid?

Answers

Strong acids have a higher percentage of H+ ions which means that they have a higher pH and will fully dissociate in water. Whereas weak acids have a lower percentage of H+ ions which means that their pH would be lower and they would only partially dissociate.

#47 I’m stuck please help!!

#47 Im stuck please help!!

Answers

The term mole concept is used here to determine the compounds with greatest mass. Here 2.1 mol Br₂ has the greatest mass. The correct option is B.

What is mole?

One mole of a substance is defined as that amount of it which contains as many particles or entities as there are atoms in exactly 12 g of Carbon - 12. The equation used to calculate the number of moles is:

Number of moles (n) = Given mass / Molar mass

a) Number of moles of atoms = 9.5 × 10²⁴ / 6.022 × 10²³ = 1.57 × 10⁴⁷

Mass = n × Molar mass of 'C'

= 1.57 × 10⁴⁷ × 12.011 = 1.89 g

b) Mass = 159.80 × 2.1 = 335.58 g

c) n = 1.86 × 10²² / 6.022 × 10²³ = 3.088 × 10⁴⁴

Mass = 3.088 × 10⁴⁴ × 153.82 = 4.74 × 10⁴⁶ g

d) 59.5 g

Thus The term mole concept is used here to determine the compounds with greatest mass. Here 2.1 mol Br₂ has the greatest mass.

What is mole?

One mole of a substance is defined as that amount of it which contains as many particles or entities as there are atoms in exactly 12 g of Carbon - 12. The equation used to calculate the number of moles is:

Number of moles (n) = Given mass / Molar mass

a) Number of moles of atoms = 9.5 × 10²⁴ / 6.022 × 10²³ = 1.57 × 10⁴⁷

Mass = n × Molar mass of 'C'

= 1.57 × 10⁴⁷ × 12.011 = 1.89 g

b) Mass = 159.80 × 2.1 = 335.58 g

c) n = 1.86 × 10²² / 6.022 × 10²³ = 3.088 × 10⁴⁴

Mass = 3.088 × 10⁴⁴ × 153.82 = 4.74 × 10⁴⁶ g

d) 59.5 g

Thus the correct option is B.

To know more about moles, visit;

https://brainly.com/question/29974655

#SPJ1

What is the maximum number of protons that can be placed in the level J=13/2 orbital? 14 7 12 26

Answers

The maximum number of protons that can be placed in the level J=13/2 orbital is 14.

To determine the maximum number of protons that can be placed in the level with the quantum number J=13/2, we need to understand the electron configuration rules. The quantum number J represents the total angular momentum of the electrons in a subshell. In the case of J=13/2, it is associated with the d subshell.

The maximum number of electrons that can be placed in a subshell is given by the formula:

Maximum number of electrons = 2(2J + 1)

where J is the quantum number.

For J=13/2:

Maximum number of electrons = 2(2 * 13/2 + 1) = 2(14) = 28

Since there are two electrons in each orbital (one with spin up and one with spin down), the maximum number of protons that can be placed in the level with the quantum number J=13/2 is half of the maximum number of electrons.

Maximum number of protons = 28 / 2 = 14

So, the correct option is: A. 14

Learn more about electron configuration:

https://brainly.com/question/26084288

#SPJ11

the published value for the density of water is 1.0 g/cm2 during a lab a student 0.92 g for the desity of water

Answers

It's possible that the student made an error during the experiment, such as not measuring the volume of water correctly or making a mistake in the calculation. It's also possible that there were external factors that affected the measurement, such as the temperature of the water, the equipment used, or the presence of impurities in the water.

What is Density?

Density is a physical property of matter that describes how much mass is contained in a given volume of a substance. It is calculated by dividing the mass of an object by its volume, and is typically expressed in units such as grams per cubic centimeter (g/cm³) or kilograms per cubic meter (kg/m³).

In simpler terms, density is a measure of how closely packed the atoms or molecules are within a substance. Substances with a higher density have more mass per unit volume, while substances with a lower density have less mass per unit volume. For example, lead is a dense material with a density of about 11.3 g/cm³, while air is much less dense with a density of about 0.0012 g/cm³ at room temperature and atmospheric pressure.

To determine the cause of the discrepancy, the student could repeat the experiment multiple times to see if the results are consistent, use different methods or equipment to measure the density of water, or compare the results with other published values to see if they are within an acceptable range. It's important for the student to identify and correct any sources of error to ensure the accuracy of their results.

Learn more about Density from given link

https://brainly.com/question/1354972

#SPJ1

Complete the passage to describe endothermic and exothermic chemical reactions. Endothermic chemical reactions energy from the environment, and exothermic chemical reactions energy to the environment.

Answers

Endothermic chemical reactions absorb energy from the environment, exothermic chemical reactions release energy to the environment.

Endothermic chemical reactions absorb energy from the environment, which means that they require an input of energy to proceed. During an endothermic reaction, the system (i.e., the reactants) gains energy from the surroundings (i.e., the environment) in the form of heat, light, or electricity, among other forms of energy.

However, exothermic chemical reactions release energy to the environment, which means that they give off heat or light as they proceed. During an exothermic reaction, the system loses energy to the surroundings, which could be in the form of heat, light, or sound, among other forms of energy.

To know more about exothermic reaction here

https://brainly.com/question/9799465

#SPJ4

--The given question is incomplete, the complete question is

"Complete the passage to describe endothermic and exothermic chemical reactions. Endothermic chemical reactions ------ energy from the environment, and exothermic chemical reactions -------- energy to the environment."--

Answer:

abord and release

Explanation:

edge 2023

A solution is made by dissolving 6.93 grams of lead(II) nitrate into about 50 mL of water. The volume is then precisely brought up to 100 mL and the solution is saved as stock solution. A 50.0 mL aliquot* of this stock solution is then titrated with 0.222 M sodium phosphate. What would be the minimum number of milliliters (mL) of the the phosphate solution that are needed to completely precipitate (knock out) all the lead in this aliquot? (tolerance is ±0.1 mL)

Answers

6.32mL of phosphate solution is needed to completely neutralize the lead in this reaction.

What is a neutralization reaction?

A neutralization reaction is defined as the reaction between an strong acid and strong base to produce a salt and water.

The process of the reacting given volume of acids or bases for the determination of the concentration or volume of the acid or base which is required for neutralization is known as titration in volumetric analysis.

The formula used to determine the volume of the acid is given below:

(Ca × Va) /(Cb × Vb) = Na/Nb

where,

where Ca is the concentration of lead nitrate

Cb is the concentration of sodium phosphate

Va is the volume of lead nitrate

Vb is the volume of sodium phosphate

Na is the moles of lead nitrate

Nb is the moles of sodium phosphate

Concentration of lead nitrate = m/V

= 6.931/(0.1 × 331.2)

= 0.0281 M

Ca = 0.222M

Cb = 0.0281M

Na = Nb = 1

Va = ( 0.0281 × 50) /0.222

= 6.32 mL.

Thus, 6.32mL of phosphate solution is needed to completely neutralize the lead in this reaction.

learn more about neutralization reaction:

https://brainly.com/question/20038776

#SPJ1

How would you balance this chemical equation?

How would you balance this chemical equation?

Answers

Answer:

CH4 + 4Cl2 ===> CCl4 + 4HCl

Explanation:

If you are having trouble understanding how to balance equations, use chemical equation calculators and they tell you step by step.

If 4.0 mol of NO and 4.0 mol of O2 are combined, how many moles
of NO2 can be produced?
2NO + O2 —> 2NO2

Answers

Answer:

There will be 4 moles of NO2 produces at the end of the reaction.

Explanation:

First of all, you should consider that the limiting reactant is NO, since it's the first it's going to end in the reaction.

After that, the conversion factor must be done with the limiting reactant (NO). So since you have 4 mol of NO and the relation of NO with NO2 its 2:2, you will end up having 4 moles of NO2.

2. what is the factor in an experiment that a scientist wants to observe, which may change in response to
the manipulated variable; also known as a dependent variable​

Answers

I believe the answer is observation

Salt is added to water until no more can be dissolved. This is a kind of(blank) solution.

a) Saturated.
b) Unsaturated.
c) Diluted.
d) Insoluble.

Answers

Answer:

The correct answer is:

a) Saturated.

When salt is added to water until no more salt can be dissolved, it forms a saturated solution. A saturated solution is a solution in which the maximum amount of solute has been dissolved at a given temperature and pressure, and no more solute can dissolve. It is in a state of dynamic equilibrium, with solute particles constantly dissolving and precipitating at the same rate.

The correct answer is A (Saturated)

(GIVING BRAINLIEST)
Balance each of the following chemical equations below

(GIVING BRAINLIEST)Balance each of the following chemical equations below

Answers

Explanation:

A.

AgNO₃ + KCl → AgCl + KNO₃ (Already Balanced)

B.

H₂O + SO₃ → H₂SO₄ (Already balanced)

C.

2KI + Cl₂ → 2KCl + I₂

D.

2NaHCO₃ → Na₂CO₃ + H₂O + CO₂

E.

Zn + 2HCl → ZnCl₂ + H₂

F.

BaCl₂ + Na₂SO₄ → BaSO₄ + 2NaCl

G.

C₃H₈ + 5O₂ → 3CO₂ + 4H₂O

H.

2Al + 3CuCl₂ → 2AlCl₃ + 3Cu

2 moles of NO, was placed in an empty I dm' bottle and allowed to reach equilibrium according to the equation:
At equilibrium, 1.2 moles of N,O, dissociated. Calculate the value of the equilibrium constant for the reaction at that
temperature.

Answers

The balanced equation for the dissociation of nitrogen monoxide (NO) is:

2NO(g) ⇌ N2(g) + O2(g)

According to the problem statement, 2 moles of NO were placed in a 1 dm^3 bottle and allowed to reach equilibrium, and at equilibrium, 1.2 moles of NO had dissociated. This means that the initial concentration of NO was:

[NO]initial = 2 mol / 1 dm^3 = 2 M

And the concentration of NO at equilibrium is:

[NO]equilibrium = (2 - 1.2) mol / 1 dm^3 = 0.8 M

Since the stoichiometry of the balanced equation is 2:1:1 for NO, N2, and O2, respectively, the equilibrium concentrations of N2 and O2 will also be 0.6 M.

The equilibrium constant (Kc) can be calculated using the equilibrium concentrations of the reactants and products, raised to the power of their stoichiometric coefficients. Therefore:

Kc = ([N2][O2]) / ([NO]^2)

Substituting the equilibrium concentrations into the equation, we get:

Kc = (0.6 M x 0.6 M) / (0.8 M x 0.8 M)
Kc = 0.5625

Therefore, the value of the equilibrium constant for the reaction at that temperature is 0.5625. Note that the units of Kc depend on the stoichiometry of the balanced equation. Since the stoichiometric coefficients are all 1, the units of Kc in this case are M^-1

the structure of the nacl crystal forms reflecting planes 0.541 nm apart. what is the smallest angle, measured from these planes, at which constructive interference of an x-ray beam reflecting off the two planes is observed? assume x-rays of wavelength 0.0649 nm are used? give your answer in degrees.

Answers

The smallest angle, measured from the reflecting planes, at which constructive interference of an X-ray beam is observed is approximately 27.2 degrees.

To determine the smallest angle of constructive interference, we can use Bragg's Law, which states that constructive interference occurs when the path difference between two waves is equal to an integer multiple of the wavelength. The formula is given as:

2d sin(θ) = nλ

Where:

d is the distance between the reflecting planes (0.541 nm)

θ is the angle between the incident X-ray beam and the planes (the desired angle)

n is the order of the interference (we are considering the first-order, so n = 1)

λ is the wavelength of the X-ray beam (0.0649 nm)

Rearranging the formula, we get:

sin(θ) = (nλ) / (2d)

θ = arcsin((nλ) / (2d))

Plugging in the values, we have:

θ = arcsin((1 * 0.0649 nm) / (2 * 0.541 nm))

θ ≈ 27.2 degrees

Therefore, the smallest angle at which constructive interference is observed is approximately 27.2 degrees.

To learn more about constructive interference, here

https://brainly.com/question/31857527

#SPJ4

given two orbitals as linear combinations of two atomic orbitals on carbon atom in ethene: where the hydrogen-like atomic orbitals are orthonormal. what is the value of the overlap integra

Answers

the overlap integral simplifies to:

S = c1c2 + d1d2d1d2.

To calculate the overlap integral between two linear combinations of atomic orbitals on a carbon atom in ethene, we first need to express the orbitals in terms of the hydrogen-like atomic orbitals. Let's assume that the two orbitals are denoted as ψ1 and ψ2, and can be expressed as linear combinations of the hydrogen-like atomic orbitals ϕ1 and ϕ2 as follows:

ψ1 = c1ϕ1 + d1ϕ2
ψ2 = c2ϕ1 + d2ϕ2

where c1, d1, c2, and d2 are constants.

The overlap integral between these two orbitals can be calculated using the following formula:

S = ∫ψ1ψ2*dτ

where dτ represents the infinitesimal volume element.

Substituting for ψ1 and ψ2, we get:

S = ∫(c1ϕ1 + d1ϕ2)(c2ϕ1 + d2ϕ2)*dτ

Expanding the product, we get:

S = c1c2∫ϕ1ϕ1*dτ + c1d2∫ϕ1ϕ2*dτ + d1c2∫ϕ2ϕ1*dτ + d1d2∫ϕ2ϕ2*dτ

Since the hydrogen-like atomic orbitals are orthonormal, the integral of ϕ1ϕ2 and ϕ2ϕ1 will be zero. Therefore, we can simplify the expression as follows:

S = c1c2∫ϕ1ϕ1*dτ + d1d2∫ϕ2ϕ2*dτ

Using the orthonormality of the hydrogen-like atomic orbitals, we know that the integral of ϕ1ϕ1 and ϕ2ϕ2 will both be equal to 1. Therefore, the overlap integral simplifies to:

S = c1c2 + d1d2d1d2.

In order to calculate the value of S, we need to know the values of the constants c1, d1, c2, and d2. These constants will depend on the specific linear combinations of atomic orbitals that we are considering. Without this information, we cannot calculate the value of the overlap integral.

Visit to know more about Integral:-

brainly.com/question/22008756

#SPJ11

If two orbitals as linear combinations of two atomic orbitals on carbon atom in ethene, then value of the overlap integral \(S_{12} = \int{\phi_{1}}^{*}\phi_{2}d \tau\), is equals to zero. So, option(b) is correct.

Orthonormal atomic orbitals are follow the following property:

\(\int{ m _i }* n_i d\tau = 1\)\(\int m_i^{*} n_j d\tau = 0\)

Now, we have provide that two orbitals are as a linear combinations of two atomic orbitals on carbon atom in ethene. \(\phi_{1 } = \frac{1}{ \sqrt{2} } ( {\psi_{2s }} + {\psi_{2p }}_{2})\)

\(\phi_{2 } = \frac{1}{ \sqrt{2} } ( \psi_{2 s} - {\psi_{2p} }_{2})\)

In the ethylene molecule, consists each carbon atom is bonded to two hydrogen atoms. Therefore, for the C-H, σ bond (sp²(C) - 1s(H)) in ethylene, the two sp² hybrid orbitals overlap with the 1s orbitals of the two hydrogen atoms. Let the hydrogen-like atomic orbitals, \(\psi_{2 s} and {\psi_{2p} }_{2}\) are orthonormal to each other. So, the overlap integral \(S_{12} = \int{ \phi_{1}}^{*}\phi_{2}d \tau\)

\( = \int \frac{1}{\sqrt{2}}( \psi_{2s} + {\psi_{2p} }_{2}) \frac{1}{\sqrt{2}}( \psi_{2s} - {\psi_{2p} }_{2})d \tau\\ \)

\( = \frac{1}{\sqrt{2}}( \int \psi_{2s}\psi_{2s} d \tau + \int {\psi_{2p} }_{2}\psi_{2s} d \tau - \int \psi_{2s} {\psi_{2p}}_{2} d \tau - \int {\psi_{2p} }_{2} {\psi_{2p} }_{2} d \tau) \\ \).

Using above formula, \(\psi_{2 s} \) and \({\psi_{2p} }_{2}\) are orthonormal so, \(\int \psi_{2 s} {\psi_{2p} }_{2} d\tau = 0\). Also \(\psi_{2 s} \) and \(\psi_{2 s}\) are normalised so \(\int \psi_{2 s} \psi_{2 s} d\tau = 1\). Similarly \(\int {\psi_{2p} }_{2} {\psi_{2p} }_{2} d\tau = 1 \).

Substitute all integral values in equation (1),

= 1 + 0 - 0 - 1

= 0

Hence, the required integral value is 0.

For more information about atomic orbitals, visit :

https://brainly.com/question/30911211

#SPJ4

Complete question:

given two orbitals as linear combinations of two atomic orbitals on carbon atom in ethene:

\(\phi_{1 } = \frac{1}{ \sqrt{2} } ( {\psi_{2s }} + {\psi_{2p }}_{2})\)

\(\phi_{2 } = \frac{1}{ \sqrt{2} } ( \psi_{2 s} - {\psi_{2p} }_{2})\)

where the hydrogen-like atomic orbitals are orthonormal. what is the value of the overlap integral,

\( S_{12} = \int \phi_{1} \times \phi_{2}dr\)

a) 1

b) 0

c) 1.5

d) 2

rock properties such as cleavage, fractures, and bedding planes ______ the mechanical strength of rock and may allow for downhill slippage. multiple choice question. increase stabilize reduce

Answers

Rock properties such as cleavage, fractures, and bedding planes reduce the mechanical strength of rock and may allow for downhill slippage.

The various characteristics of rocks that are of interest and importance to geologists and other professionals who work with rocks and rock materials are known as rock properties. In addition to the classification and physical properties of rocks, the mechanical, hydrologic, thermal, and electrical properties of rocks are also important.

The physical characteristics of rocks include color, texture, and structure. Rock texture, which refers to the size and arrangement of mineral crystals, is used to distinguish rocks. Cleavage, fractures, and bedding planes are all structural features of rocks that have a significant impact on their mechanical strength, and as a result, their stability.

Fractures, cleavage, and bedding planes can significantly lower the strength of rocks. Fractures, which are cracks in the rock's surface, are the most frequent structural feature. Bedding planes, which are layers of rock that have distinct properties, and cleavage planes, which are parallel fractures that give the rock a tendency to break along specific planes, are examples of other structural features. This lack of mechanical strength allows rocks to slide downhill or collapse quickly.

Learn more about Rock properties here: https://brainly.com/question/30173390

#SPJ11

Other Questions
When a government seeks to promote full employment, it will adopt economic policies designed to reduceA the seasonal unemployment rate.B the frictional unemployment rate.C the cyclical unemployment rate.D the structural unemployment rate. Gregory Mendel was the first to use ( ) to explain genetic heredity and to trace one trait through ( ). A.) Chromosomes, geneticsB.) Probability, generationsC.) Probability, geneticsD.) Chromosomes, generations er the years, American Indian activists have valiantly fought for reform and for the government to honor certain treaty obligations. Sarah Winnemucca, a member of the Northern Paiutes tribe, campaigned for better living conditions for her tribe in the late 1800s. She lectured around the country in an effort to increase support for her cause. Physician and lecturer Charles Eastman, who was part of the Sioux tribe, also strove to improve the circumstances of American Indians in the early 1900s through public speaking and serving in organizations such as the Society of American IndiansWhat is the best reason to conclude that the author wants the reader to admire American Indians? _______ is the number of participants who discontinue use of a product or service. I need help with this She hopes that by separating the department into two agencies, she can get the Higher Education Agency to work on addressing student loan debt. This scenario illustrates: How many decibels is a sound wave that is 10,000 times as intense as a 20 decibelsound wave? Which of the following is a motivational state caused by consumer perceptions that a product, brand, or advertisement is relevant or interesting? collection of rivers of Nepal is a well defined or not well defined Requires government agencies to identify sensitive systems, conduct computer security training, and develop computer security plans? what transformation is represented by the figure below? Which statement best describes Matthias Grnewalds approach to painting? A: He incorporated Classical conventions of proportion, beauty, and harmony in his artwork.B: He believed the main purpose of art was to communicate religious messages and ideas.C: He focused on painting lifelike figures and depicting their importance in the world.D: He embraced Italian Renaissance conventions of evoking intellectual responses from viewers. Substance such as lipids and small nonpolar molecules move freely Through the sale membrane without the need for transport protein and a process called Which of the following is one of the seven steps organizations go through when considering a major training initiative? A. Acquire resourcesB. Hire employeesC. Review regulations Triple-F Health Club (Family, Fitness, and Fun) is a not-for-profit family-oriented health club. The club's board of directors is developing plans to acquire more equipment and to expand club facilities. The board plans to purchase about $25,000 of new equipment each year and wants to establish a fund to purchase the adjoining property in four or five years. The adjoining property has a market value of about $300,000.The club manager, Jane Crowe, is concerned that the board has unrealistic goals in light of the club's recent financial performance. She has sought the help of a club member with an accounting background to assist her in preparing a report to the board supporting her concerns. Jane would like you to prepare a cash budget for 2024 for the Triple-H Health Club and explain any operating problems that this budget discloses for the Triple-H Health Club. Is Jane Crowe's concern that the board's goals are unrealistic justified? What type of energy transfer is indicated by the arrows in the diagram? what is the product 7/11 and 3/7? What continent struggles the most with the digital Divide and has the least amount of users colonial corporation uses the retail method to value its inventory. the following information is available for the year: costretail beginning inventory$ 310,000$ 292,000 purchases741,000936,000 freight-in20,000 net markups 32,000 net markdowns 5,200 net sales 920,000 required: determine ending inventory and cost of goods sold by applying the conventional retail method using the information provided. The perceptual process by which the muscles control the shape of the lens to adjust to viewing objects at different distances is called?