Friendly_name argument has the jump text or numeric value that is displayed in the cell.
By using the Hyperlink function, you may build a shortcut that opens a document on a network server, an intranet, or the Internet or make a shortcut that moves to another position in the current workbook. Friendly name ignored, the cell's displayed cell content, such as the jump text or numeric value, Blue and highlighted text for Friendly's name may be seen. If the friendly name is left off, the jump text in the cell will be the link location which is an argument.
A friendly name can be a value, a text string, a name, a cell that has the jump text or value, or another type of value. The error is shown in the cell instead of the jump text if the friendly name gives an error value, such as #VALUE!
Learn to know more about Hyperlink on
https://brainly.com/question/17373938
#SPJ4
Describe 3 ways the land/terrain change as we move from Charlotte NC to the coastal plains of North Carolina
Answer:
Hilly towards flat.
Higher elevation toward lower elevation.
Clayey to sandy type of soil.
Explanation:
The land of Charlotte NC is hilly whereas coastal plains of North Carolina is flat. Charlotte NC is located at a high elevation while on the other hand, the coastal plains of North Carolina are located at the sea and at lower height. The soil type of Charlotte NC is clay and silt whereas the soil type of coastal plains of North Carolina is sandy due to the presence of sea.
A frameshift mutation that occurs in the dna and results in an amino acid change near the beginning of a protein sequence would have what effect on the protein’s structure?.
A frameshift mutation that occurs in DNA and leads to a change in the first amino acid of a protein sequence alters the Primary, secondary, and tertiary structure of protein.
What are frameshift mutations and how do they affect amino acid sequences?A reading frame consists of groups of three nucleotides, each of which codes for an amino acid. Frameshift variants occur when nucleotides are added or deleted, shifting the grouping and altering the coding of all downstream amino acids. This leads to premature protein translation or chain termination. Resulting protein is usually non-functional.Insertion and deletion mutations are two forms of frameshift mutation that can occur. Both have a similar overall effect, shifting the translational reading frame and generating random amino acid sequences.Which is most likely to lead to a frameshift mutation?Frameshift mutations are created by the insertion or deletion of one or more new bases. Since the reading frame begins at the start site, the mRNA generated from the mutated DNA sequence will be read out-of-frame at the point of insertion or deletion, producing a nonsense protein.
To learn more about frameshift mutation visit:
https://brainly.com/question/12732356
#SPJ4
Please help me answer all 4 I'm litteraly begging rn.
1. Which decomposers work primarily with large pieces of dead matter?
2. Which decomposers work primarily with tiny pieces of dead matter?
3. Look closely at the diagram of Cellular Respiration in Chapter 1. What do you think this diagram shows about cellular respiration?
4. Which organisms give off carbon?
decomposers
producers
consumers
dead matter
abiotic matter.
1. The decomposers work primarily with large pieces of dead matter in bacteria and fungi
2. The decomposers work primarily with large pieces of dead matter in bacteria and fungi
3. cellular respiration in which cells produce energy (in the form of ATP)
4.These organisms give off carbon
decomposers
producers
consumers
1. Decomposers that work essentially with huge pieces of dead matter incorporate detritivores, such as worms, millipedes, and woodlice. They break down huge pieces of natural matter into littler parts, which can be advanced and deteriorated by other life forms.
2. Decomposers that work fundamentally with modest pieces of dead matter incorporate microbes and parasites. They break down little natural matter, such as dead plant and creature cells, into easier compounds that can be utilized by other living beings.
3. The graph of Cellular Breath appears the method by which cells deliver vitality (within the shape of ATP) by breaking down glucose and other atoms within the nearness of oxygen. The chart highlights the different steps of cellular breath, counting glycolysis, the Krebs cycle, and the electron transport chain, as well as the inputs (glucose and oxygen) and yields (ATP, water, and carbon dioxide) of the method.
4. All living life forms, counting decomposers, makers, and buyers, deliver off carbon as a squander item amid cellular breath. Dead matter, such as rotting natural fabric, too contains carbon, which is discharged into the environment because it breaks down. Abiotic matter, such as rocks and minerals, don't grant off carbon as they are non-living.
To know more about decomposers refer to this :
https://brainly.com/question/380333
#SPJ1
which is it?
a , b, c, or d?
What is the skeletal system? Answer in
2-4 sentences, including the words
below:
bones
structure
movement
ligaments, cartilage, or tendons
how can you prove whether a trait is acquired through genetics or the environment?
Answer:
some people look like their parents or relatives and that's because of genes
As for the environment, we adapt to live in places that were different from the other environment
Explanation:
Example for the environment: winter foxes weren't always white. they change colors to match their environment to serve. change happens generation after generations change to fit their environment
By conducting twin studies, adoption studies, or using animal models to separate genetic and environmental influences on the trait.
Researchers employ twin, adoption, and animal models to evaluate if a feature is inherited or environmental. Twin studies compare identical (100%) and fraternal (50%) twins for a certain attribute. Identical twins are more similar than fraternal twins, suggesting a stronger genetic effect.
Adoption studies compare biological and adoptive households. If the adopted person and their biological family share a characteristic, genetics are involved. If the attribute is more comparable between the adopted person and their adoptive family, it suggests environmental impact.
Researchers can explore inheritance patterns by carefully breeding animals with specified features. Scientists can determine how genetics and environment affect a characteristic by combining these strategies.
Learn more about acquired trait, here:
https://brainly.com/question/10589145
#SPJ7
can i have the answers to these 2 questions please?
Answer:
Question 10: True Question 11: Competition and Variation
Explanation:
Natural Selection is when the animal with the best survival rates gets the right to mate. Every species wants to survive and by letting the animals with the best traits reproduce, it ensures their survival. This, of course, happens naturally.
Competition is to show whose fit and whose not and variation increases the chance of their survival. For example, if a whole species was exactly the same if one died of a disease then all of them would, because they would have the same immune system. But if there is variation, one might be vulnerable to the disease but the other might have protection from it. Meaning it could pass those genes to offspring because it was fit.
Hope this helped :)
which explanation below is best for the following statement? since rna is single-stranded, it does not have complementary base-pairing as part of its structure. the statement is true because single-stranded nucleic acids have no complementary strand to base-pair with. the statement is false because single-stranded nucleic acids can base-pair with their dna template. the statement is true because only dna can base-pair with dna. the statement is false because single-stranded nucleic acids may have intra-strand complementarity and base-pair within themselves. the statement is false because rna would have base-pairing as part of its structure but it has no complementary strand to base-pair with.
The best explanation for the statement "since RNA is single-stranded, it does not have complementary base-pairing as part of its structure" is: the statement is false because single-stranded nucleic acids may have intra-strand complementarity and base-pair within themselves.
RNA molecules can form secondary structures through base pairing within their own strand, which allows them to fold into complex shapes and perform their biological functions. While RNA does not have a complementary strand like DNA, it can still form base-pairing within its own single strand, creating secondary and tertiary structures.
While it is true that single-stranded nucleic acids have no complementary strand to base-pair with, this does not mean that they cannot base-pair at all. Therefore, the third and fourth explanations are incorrect. The last explanation is also incorrect because RNA does have base-pairing as part of its structure, but it does not require a complementary DNA strand to do so.
Learn more about RNA molecules
brainly.com/question/7763419
#SPJ11
Please help!! I will give BRAILEST!
Answer:
Explanation:
lmk if u need any more help the pic is attached!
Please describe this picture using directional terminology, body planes and body movements.
The human body is a complex organism and understanding its structure and functions requires a thorough knowledge of directional terminology, body planes, and body movements. In this image, we can see a person performing a side plank exercise which is an effective core-strengthening exercise.
We can also use directional terminology to describe the person's movements. The person is performing a lateral flexion to the side while maintaining an isometric contraction of the core muscles. The movement involves the transverse axis of the body, which runs from front to back, perpendicular to the frontal plane.
In conclusion, this picture shows a person performing a side plank exercise, positioned on the frontal plane and performing a lateral flexion movement. The person is using their core muscles to maintain the position while one arm is supporting their weight and the other arm is extended towards the ceiling.
To know more about complex visit:
https://brainly.com/question/31836111
#SPJ11
some friends who are on vacation have sent you a photo from when they were out on a hike. you notice that all of the vascular plants in the photo are relatively short and that most of those plants are shorter than your friends. the caption on the photo says, "where are we?" based on the photo, which biome are your friends most likely to be in?
Your friends are most likely in a grassland biome.
What is a biome?A biome is a large, geographically distinct area of the Earth's surface where a certain type of ecosystem exists. Biomes are usually characterized by their climate, vegetation, and animal life. Examples of biomes include rainforests, deserts, tundra, and coral reefs.
Other examples of biomes include grasslands, temperate forests, alpine regions, and estuaries. Each biome has its own unique set of characteristics, such as its climate, soil, and vegetation. The unique combination of these characteristics creates an environment that is home to a variety of species of plants and animals.
Learn more about biome here:
https://brainly.com/question/1930321
#SPJ1
What is the name of baby stars?
sirius
Explanation:
the prostate is basically a baby star l, and grows into a star through its life cycle in the same way we are born and grow.
Which example is the best description of an adaptation?
a heritable characteristic that evolves
a heritable characteristic that helps an organism find food
a heritable characteristic that helps an organism survive and reproduce
a heritable characteristic that helps an organism avoid predators
Answer:
a heritable characteristic that evolves
Explanation:
The best description of an adaptation is that it is a heritable characteristic that helps an organism survive and reproduce.
What is an adaptation?An adaptation is a feature or characteristic of an organism that helps it to be able to survive in its environment.
Adaptations are important to an organism in order for it to grow and reproduce in its environment.
For example, polar bears have thick furs to enable rhem survive the cold environment of the polar regions.
Therefore, the best description of an adaptation is that it is a heritable characteristic that helps an organism survive and reproduce.
Learn more about adaptation at: https://brainly.com/question/29594
Questions
Teeth help to break down large pieces of food into lots of smaller pieces.
Suggest how this can help enzymes to digest the food faster.
Answer:
Answer:it helps in a lot of ways
Answer:it helps in a lot of waysExplanation:
Answer:it helps in a lot of waysExplanation:for instance, the enzyme in the mouth that act on carbohydrates called tyalin can only have an effect on the food particles when it is chopped by the teeth into smaller pieces
the down part of a fish is called what
substrates are held in the active site of an enzyme by:the matching shape of the allosteric site.the lowering of the activation energy.hydrogen and ionic bonds.the action of coenzymes and cofactors.
Substrates are held in the active site of an enzyme by hydrogen and ionic bonds.
What is ionic and hydrogen bonds?Ionic bonds are attracted by electrostatic forces, whereas hydrogen bonds are intermolecular forces. Ionic bonding occurs between permanent anions and cations, whereas hydrogen bonds occur between partial positive and partial negative charges. This is the main distinction between the two types of bonds.
In that they are created by the attraction of atoms with opposing polarity, hydrogen bonds are comparable to ionic bonds in this regard. They lack the strength of full or complete charges, however, as they are formed by the interplay of partial charges.
To know more about ionic and hydrogen bonds visit:
https://brainly.com/question/10777799
#SPJ4
Which is an extreme disturbance to any ecosystem?
A. coral bleaching
B. hurricanes
C.extreme temperature change
D.elk overgrazing
Answer:
1) B. extreme temperature change
2) D. living things in that ecosystem
3) B. the smaller herbivore population will decrease
4) B. the loss of a river system due to contamination
5) B. die out in the area
Explanation:
Modest Disturbances in Ecosystems Quick Check
100% :)
extreme temperature change s an extreme disturbance to any ecosystem.
what is ecosystem ?
An ecosystem can be defined as a community of living organisms concurrence with non-living components, interacting with each other in an environment.
The structure of an ecosystem composed of both biotic and abiotic components which include the distribution of energy in our environment, climatic conditions prevailing in that specific environment.
The structure of an ecosystem can be divided into two components such as Biotic Components and Abiotic Components
both biotic and abiotic components are interrelated with each other in an ecosystem,. it is an open system where the flow of energy and components occur throughout the boundaries.
The functions of the ecosystem include regulates the essential ecological processes, responsible for the cycling of nutrients between biotic and abiotic components, maintains a balance among the various trophic levels in the ecosystem.
For more details regarding ecosystem, visit
https://brainly.com/question/1061425
#SPJ2
81. suppose that following a lava flow, pine grass (a hypothetical species) is the first species to colonize the area. chemicals produced by pine grass change the soil chemistry in the environment, but these chemicals promote subsequent colonization by later species. which model would best explain this scenario of succession? a. inhibition b. tolerance c. facilitation d. compensation
The model that best explains this scenario of succession is facilitation. Option c is correct.
In facilitation, early successional species change the environment in a way that makes it more suitable for later successional species. In this case, pine grass changes the soil chemistry to create conditions more favorable for other species to colonize the area. This is an example of positive interactions between species, where the presence of one species benefits another.
As a result, the area goes through a predictable sequence of changes, with each species creating conditions that favor the next. In contrast, the inhibition model suggests that early species prevent colonization by later species, while the tolerance model suggests that species do not affect each other's colonization. The compensation model suggests that the loss of one species is compensated by the growth of another. Hence Option c is correct.
To learn more about succession, here
https://brainly.com/question/1291604
#SPJ4
What is the currently accepted therey
on the origin of the moon?
Answer:
giant-impact theory
Explanation:
I hope this helps
please help! question on beta blockers 6 marker
what is the information you were given in Table to answer the question?
When the person from number one was creating true breeding lines of plants for certain traits, what method was used?
A. Self pollination over and over a while discarding plants with unwanted traits
B. Cross pollination over and over while discarding plans with unwanted traits
C. Allowing for cross pollination by bees
D. Not allowing the plants to pollinate at all
When the person from number one was creating true breeding lines of plants for certain traits, the method used was self-pollination over and over while discarding plants with unwanted traits.so option (A) is correct.
The term “breeding” is the practice of mating animals and cultivating plants in order to achieve certain characteristics in their offspring. True breeding lines are those that produce offspring with certain traits that remain consistent from one generation to the next. Self-pollination is the process of pollinating the same plant with its own pollen. The result is a plant that is identical to the parent plant in every way.
The method used when the person from number one was creating true breeding lines of plants for certain traits was self-pollination over and over while discarding plants with unwanted traits.so option (A) is correct
To learn about breeding visit below link
https://brainly.com/question/30073241
#SPJ11
Some salmon have been genetically modified to grow bigger and mature faster than wild salmon. They are kept in fish facilities. Which statement regarding genetically modified salmon is correct
Salmon that have been genetically engineered have generated debate because of worries about the potential environmental and health effects if they were to escape and interact with native populations.
How is the genetic makeup of salmon altered?Canadian researchers patented genetically altered (GM) salmon after introducing a promoter—the genetic equivalent of a "on-off" switch—from an ocean pout and a gene that controls growth hormones in Pacific Chinook salmon into the genetic makeup of an Atlantic salmon.
Do wild salmon contain genetically engineered fish?All Atlantic salmon, including genetically modified (GM) salmon, is farmed salmon. Because Atlantic salmon is an endangered species, there is no natural fishery.
To know more about health effects visit:-
https://brainly.com/question/29786442
#SPJ1
part 1: Low tide will be 2:56 pm
High tide 9:00pm
Answer:
what's the question for this example
A key point in Darwin’s explanation of evolution is that
Answer:
The four key points of Darwin's Theory of Evolution are: individuals of a species are not identical; traits are passed from generation to generation; more offspring are born than can survive; and only the survivors of the competition for resources will reproduce.
Explanation:
What step in photosynthesis may occur during day and night? A.Light independant reactions B.Light dependant reactions c. Photolysis
Answer:
a is the answer
Explanation:
Light independent reactions of photosynthesis may occur during day and night.
STAGES OF PHOTOSYNTHESIS:
Photosynthesis is a metabolic reaction undergone by green plants to obtain their food using energy from sunlight. Photosynthesis is a process that involves two major stages: light independent reactions and light reactions. Light dependent reactions occur strictly under light conditions because light is needed to break down water molecules in a process called photolysis. In the light dependent reactions, water is broken down by light to give oxygen gas. In the light independent reactions, carbon dioxide is required.However, light independent reactions may occur during day and night. This is because light independent reactions does not require light to occur.
Learn more: https://brainly.com/question/11240542?referrer=searchResults
Explain how the Periodic Table of Elements is organized. What are the patterns? Trends?
(take your time)
Answer:
The periodic table of elements arranges all of the known chemical elements using this method. Elements are arranged from left to right and top to bottom in order of increasing atomic number. Order is usually according with the increasment (Is this a word?) of the atomic mass.
Explanation:
Have a good day :)
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
you are on a committee that is planning whether or not to build a dam on a nearby river to produce hydroelectric power. describe some of the advantages and disadvantages you should consider before deciding to build the dam.
Dams preserve water, generate power, cause mass migration, and are expensive. Dams regulate water supply for domestic, industrial, and electric uses.
What are the advantages and disadvantages of dams?A dam is a structure that stops or slows the flow of water on the surface or in the ground.
Advantages of building a dam are:
Water flow is controlled and used to meet household, agricultural, and industrial demands.The reservoir that was formed behind the dam can be utilized for a variety of purposes, including irrigation, water sports, and even other forms of recreational pursuits.The production of energy by dams does not result in any pollution because there is no release of greenhouse gases during this process.Dams are utilized in conjunction with the hydroelectric plant in order to produce electricity.Disadvantages are:
The construction of dams takes many years, which results in a decrease in the quality of life for individuals who live in areas that are now undergoing construction.The process of constructing dams is one that is both time-consuming and incredibly expensive.The building of massive dams causes significant damage to the surface of the earth, which in turn has negative effects on geological processes.People are leaving in large numbers because they don't want to live in the area where the dam is going to be built.Learn more about dams, here:
https://brainly.com/question/27716403
#SPJ1
Both plants and animals require a constant supply of energy for life and both utilize some of their organelles to provide us energy processes with in choral plus and mitochondria transform store and release energy which statement best explains this flow of energy?
A. Energy is released through both photosynthesis and cellular respiration.
B. Energy is stored during the process of photosynthesis, and released during cellular respiration.
C. Energy is stored through Both the process of photosynthesis and cellular respiration
D. Energy is stored through the process of cellular respiration release the photosynthesis.
Animals and plants both depend on certain organelles to supply us with energy, which is necessary for both to maintain life. During the process of photosynthesis, energy is both saved and released, and this happens within cells. In this case, B is the right response.
What is respiration?Organic compounds release energy through the chemical process known as respiration. The molecules are transformed into new ones by exergonic processes. Adenosine triphosphate (ATP) breaks down into adenosine diphosphate (ADP) and phosphoric acid (Pi), which release energy (it is an exergonic reaction).What is photosynthesis? As a result, glucose is produced from carbon dioxide and transformed into oxygen from water. The plant returns oxygen to the atmosphere after storing energy inside glucose molecules. The purpose of chloroplasts, which are microscopic organelles found inside plant cells, is to store solar energy. Organic compounds release energy through the chemical process of respiration. The molecules are changed into new ones through exergonic processes. The conversion of adenosine triphosphate (ATP) into adenosine diphosphate (ADP) and phosphoric acid (Pi) releases energy (it is an exergonic reaction).For more information on photosynthesis and respiration kindly visit to
https://brainly.com/question/1388366
#SPJ1
Which of the following correctly defines one of the four parts of natural selection?
a
variation: the difference in the heritable traits of an individual from those of other individuals in the same species or population
b
extinction: the state in which all of the members of a species have died
c
overproduction: the process by which each generation produces more offspring than the previous generation produced
d
adaptation: an acquired trait that lets an organism better survive in its environment
Answer:
a- variation
Explanation:
Answer:
A
Explanation:
correct option A- variation