According to the research, the central nervous system consists of the brain and the spinal cord (c).
What is the central nervous system?It is made up of the brain and spinal cord, these are the main information and control centers of the body.
The brain is the organ contained within the skull, which integrates and controls all the functions of the body, from the sensory, motor and integrative part.
Therefore, we can conclude that according to the research, the central nervous system consists of the brain and the spinal cord (c).
Learn more about the central nervous system here: https://brainly.com/question/2156614
#SPJ1
1) The most abundant glycoprotein in the extracellular matrix (ECM) is This protein attaches to which are proteins in the plasma membrane that connect the ECM with the inside of the cell. collagen: dyneins microtubules; integrins microfilaments; dynein collagen; integrins 2) Which listed tissue type would you expect to contain a large proportion of anchoring junctions? root tissue skin brain digestive tract tissue
1) The most abundant glycoprotein in the extracellular matrix (ECM), this protein attaches to integrins, which are proteins in the plasma membrane that connect the ECM with the inside of the cell is A. collagen. 2) The tissue type that would be expected to contain a large proportion of anchoring junctions is C. skin.
Collagen provides structural support to tissues and organs, it forms a network of fibers that give strength and flexibility to the ECM. Integrins act as bridges between the ECM and the cell, allowing cells to sense and respond to their environment, they play a role in cell adhesion, migration, and signaling. Dyneins and microtubules are not directly involved in the attachment of collagen to integrins. Microfilaments are involved in cellular movement and shape changes, but not in the attachment of collagen to integrins. So the correct answer is A. collagen.
Anchoring junctions are specialized cell-cell junctions that help hold cells together and provide mechanical strength. In the skin, anchoring junctions called desmosomes are particularly abundant. They connect adjacent skin cells, called keratinocytes, and contribute to the integrity and stability of the skin. Desmosomes consist of proteins called cadherins, which link cells together, and intermediate filaments, which provide structural support. Root tissue, brain tissue, and digestive tract tissue may contain different types of cell junctions, but they are not primarily characterized by anchoring junctions like the skin, so the correct answer is C. skin.
Learn more about collagen at:
https://brainly.com/question/30041579
#SPJ11
The corrective lenses of a person suffering from which vision ailment could be used to start a fire?
a. Myopia
b. hyperopia
c. astigmatism
d. cataracts
e. no eyeglass lenses can be used to make a fire.
The corrective lenses of a person suffering from myopia could be used to start a fire. Myopia is a condition where a person has nearsightedness, which means they can see objects that are close to them clearly, but objects in the distance appear blurry. This is corrected by using concave lenses, which are thinner at the center and thicker at the edges.
Concave lenses have the ability to refract and focus light, which can be used to start a fire. By angling the lens and focusing the sun's rays onto a small point, it can generate enough heat to ignite a piece of dry kindling. However, it's important to note that this method of starting a fire can be difficult and time-consuming, and there are much easier and safer ways to start a fire.
Hyperopia, also known as farsightedness, occurs when a person has difficulty focusing on nearby objects. The corrective lenses for hyperopia are converging lenses, which cause light rays to bend inward, focusing the light on the retina. Converging lenses can be used to start a fire by concentrating sunlight onto a small area, such as a piece of paper or dry leaves.
To know more about visit
https://brainly.com/question/30518008
#SPJ11
This process of protein synthesis occurs similarly in most organisms due to the fact that it is the same universal ____ molecule that contains the instructions for it.
A. DNA
B. RNA
Answer:
A. DNA
Explanation:
This process of protein synthesis occurs similarly in most organisms due to the fact that it is the same universal DNA molecule that contains the instructions for it. So, option (A) is the correct answer.
3. Use the list below to write the correct term for each definition below.
analogous system habitat fragmentation
scale model computer mode
pollutants technology
greenhouse gases runoff
a. chemicals emitted into the atmosphere at add to the overall increase in earth's temperatures
b. when roads cross a habitat; they expose animals within the habitat to death due to encounters with vehicles
c. substances which lower the amount of life within a system
d. the knowledge and tools we use to do difficult tasks
e. a research model that studies objects similar in function or design
f. water that travels over the surface of the land during and after rain
g. a miniaturized but proportional version of an object mimic or predict the behavior of real objects or systems
h. a program that allows a computer to quickly and with detail
helppppp!!!! :) please it’s due at 3
Answer:
q no 19 : option A
Explanation:
please mark me brainliest
A cow has alleles for both black and
white fur that are codominant. What
would be the resulting appearance
of the cow?
A. a solid coat of gray fur
B. fur with areas of both black and white
C. it is impossible to determine
Answer:B
Explanation:
Codominant is when neither allele is recessive so they are both expressed in the phenotype
A cow having the codominant alleles for both white and black fur will appear to have fur with areas of both black and white fur. This is an example of co-dominance where both alleles are expressed in the different parts of the animal. So option B is correct.
What is codominance?In codominance, two different versions of a gene are expressed separately and they are expressed equally in different parts of the organism. As a result, the traits of both alleles are expressed simultaneously. The term co-dominant means that both alleles are dominant and one allele does not mask the expression of the other.
Co-dominance can easily be spotted in plants and animals. Codominance is observed in some traits that are less visible like blood type. The A and B alleles are codominant and they can be expressed simultaneously.
To learn more about codominance, refer to the link:
https://brainly.com/question/3578928
#SPJ2
What is region x on the above wave called? I give brailiest!!!!!
Answer:
rarefaction
Explanation:
along the same direction the wave travels
Importance of scientific journals Complete the following statements regarding the importance of scientific journals in the reporting of scientific information Not all choices will be used. replicate Scientific studies are published in scientific journals after they have been examined by experts and gone through a(n) process. blased reliable Scientific journals ensure that they only publish research that is conducted property by credible scientists. This research must be accurate and unbiased disprove Based upon what scientists read in journals, they may wish to research conducted by others, or further study an aspect of the previous work. editing important Scientific journals are more resources compared to magazines websites, or books containing information from secondary resources review
The statements that complete the importance of scientific journals in the reporting of scientific information are as follows:
Scientific studies are published in scientific journals after they have been examined by experts and gone through a review process.
Scientific journals ensure that they only publish research that is conducted properly by credible scientists. This research must be accurate and unbiased. Based upon what scientists read in journals, they may wish to replicate research conducted by others, or further study an aspect of the previous work. Scientific journals are important resources compared to magazines, websites, or books containing information from secondary resources. The importance of scientific journals in the reporting of scientific information is that they ensure that only credible and reliable research is published.
These journals ensure that any information that is presented is based on scientific research and is not biased or disproved. Scientific journals publish only after the experts have examined the studies and gone through a review process. This ensures that the research is accurate and unbiased. Based on what scientists read in these journals, they may wish to replicate the research conducted by others or further study an aspect of previous work. Scientific journals are considered important resources compared to magazines, websites, or books containing information from secondary resources.
To know more about scientific journals visit:
https://brainly.com/question/618225
#SPJ11
Scientific studies are published in scientific journals after they have been examined by experts and gone through a reliable process.
Scientific journals ensure that they only publish research that is conducted property by credible scientists. This research must be accurate and unbiased.
Based upon what scientists read in journals, they may wish to replicate research conducted by others, or further study an aspect of the previous work.
Scientific journals are more important resources compared to magazines, websites, or books containing information from secondary resources.
To know more about Scientific studies, visit:
https://brainly.com/question/29811694
#SPJ11
where do stars form
A.in a planet's core
B.in nebula
C.on asteroids
D.in sun spots on the surface of the sun
Stars form in nebulae. The correct option is B
What is nebulae ?
A nebula is an interstellar cloud of gas and dust, primarily made of hydrogen and helium but also including other elements. Some of these enormous clouds have a diameter of hundreds of light-years.
It is possible for a nebula to create a protostar, which is the nebula's dense, hot core, when it experiences gravitational collapse. The protostar warms up and starts to radiate as it continues to collapse. The process that powers a star, nuclear fusion, begins when the protostar reaches a specific temperature and density.
Learn more about nebulae here : brainly.com/question/30165962
#SPJ1
Since the relative growth rate is 0.4416, then the differential equation that models this growth is?
since the relative growth rate is 0.4416, then the differential equation that models this growth comes out to be dP/dt = 0.4416 * P. We may use the exponential growth formula to find the differential equation that describes the growth with a relative growth rate of 0.4416.
The exponential growth formula is as follows: P = k * dP/dt. where:
The population change rate is shown by the formula dP/dt where k is the growth constant or relative growth rate. The relative growth rate in this instance is reported to be 0.4416. Thus, the differential equation that describes this growth is as follows: dP/dt = 0.4416 * P
to know more about relative growth rate refer to the link below
https://brainly.com/question/1822625
#SPJ4
A 1:2:1 phenotypic ratio in the F2 generation of a monohybrid cross is a sign of the gene having more than two alleles in individuals of the F1 generation incomplete dominance of the two alleles toward each other. O complete dominance of one allele over the other. a and b, but not a and c, but not b
A 1:2:1 phenotypic ratio in the F2 generation of a monohybrid cross is a sign of incomplete dominance of the two alleles toward each other.
Thus the correct answer is B.
The process in which two true-breeding pаrents crossed to produce аn intermediаte offspring is cаlled incomplete dominаnce. Incomplete dominаnce is referred to аs pаrtiаl dominаnce or intermediаte inheritаnce. In incomplete dominаnce, the vаriаnts, аlso cаlled аlleles, аre not expressed аs dominаnt or recessive. Insteаd, the dominаnt аllele is expressed in а reduced rаtio.
In incomplete dominаnce, the F2 generаtion from heterozygous plаnts will hаve а rаtio of 1:2:1 with the phenotypes red, white аnd spotted flowers.
Your question is not well arranged, but most probably your full question was
A 1:2:1 phenotypic ratio in the F2 generation of a monohybrid cross is a sign of .
a. the gene having more than two alleles in individuals of the F1 generation
b. incomplete dominance of the two alleles toward each other.
c. complete dominance of one allele over the other.
d. a and b, but not a and c, but not b
For more information about incomplete dominance refers to the link:
https://brainly.com/question/14053639
#SPJ4
What is a gene? Describe the function, structure, and location of genes within the cell.
Answer:
Genes are a section of DNA that are in charge of different functions like making proteins. Long strands of DNA with lots of genes make up chromosomes. DNA molecules are found in chromosomes. Chromosomes are located inside of the nucleus of cells.
Hope this helps....
Have a nice day!!!!
How can 2 locations roughly the same distance from the equator (the same amount of sunlight) have such a different climates?
Answer:
Explanation:
Latitude or distance from the equator - Temperatures drop the further an area is from the equator due to the curvature of the earth. The humid subtropical climate is generally located between 25° and 35° latitude on the east sides of continents. Also, temperatures decrease as you move away from the equator.
If a cellular homogenate were subjected to differential centrifugation, which of the following would be expected to pellet first? A. the endoplasmic reticulum B. mitochondria C. the cytosol D. nuclei
A cellular homogenate is a mixture of cellular components such as organelles, membrane fragments, and cytosol. Answer D is incorrect because nuclei would pellet out before the endoplasmic reticulum.
A cellular homogenate is a mixture of cellular components such as organelles, membrane fragments, and cytosol. The procedure that isolates these components is called centrifugation. Homogenates are spun at a low speed, which produces a pellet of the largest and densest components such as nuclei and organelles, while cytosol and smaller organelles remain in the supernatant. The procedure is repeated several times, each time increasing the speed and duration of the spin to separate progressively smaller and lighter organelles and molecules. Therefore, if a cellular homogenate were subjected to differential centrifugation, the first organelles to pellet out would be the larger and denser ones, which are nuclei and mitochondria. The cytosol will remain in the supernatant. Thus, options A and B are incorrect. Answer D is incorrect because nuclei would pellet out before the endoplasmic reticulum. Therefore, the correct answer is option B mitochondria.
To know more about cytosol visit: https://brainly.com/question/29435961
#SPJ11
What is the function of RNA?
A.: It takes the message of the amino acid order for proteins to the cytoplasm, where the protein will be built.
B.: It stores in the nucleus the information a cell needs to make its proteins with the right orders of amino acids.
C.: It is stored in the nucleus and is used to make DNA.
D: It stores genes for specific proteins and traits.
Answer:
B.: It stores in the nucleus the information a cell needs to make its proteins with the right orders of amino acids.
Explanation:
It stores in the nucleus the information a cell needs to make its proteins with the right orders of amino acids.
What is RNA?RNA is ribonucleic acid. It is a nucleic acid composed of the ribose sugar.
mRNA helps in transforming the information in the process of protein formation.
There are four types of RNA are there, and all RNA helps in protein synthesis.
Thus, It stores in the nucleus the information a cell needs to make its proteins with the right orders of amino acids.
Learn more about RNA
https://brainly.com/question/25979866
Identify the organelles in the cell to the right. A B C D E F
Answer:A
✔ vacuole
B
✔ chloroplast
C
✔ cell membrane
D
✔ Golgi apparatus
E
✔ endoplasmic reticulum
F
✔ cell wall
Explanation:
While doing field research, two scientists discover a new species of plant. They take the plant back to their lab to watch how it grows and reproduces. Soon, the plant begins to produce a small purple flower. Upon further investigation, the scientists discover that the plant's seeds contain two embryonic leaves.
Which group could the plant belong to? Check all that apply.
As the new species of plant produced purple flowers, so, the plant belongs to the angiosperms group. Also, the seeds of the plant contain two embryonic leaves, so, the plant must be a dicot.
Out of all five divisions of plants, only the plants that come under the Division Angiosperm can bear or form flowers. That's why angiosperms are also called flowering plants. Angiosperms are further divided into two groups based on the number of embryos that are produced from seeds on germination. If the germinating seeds contain only one embryo leaf, then we call them monocots while the seeds that contain two embryo leaves during their developing seeds, then they are called dicots.Thus, the plant that is discovered by scientists comes under the angiosperm group and further into the dicot group. Dicots have two embryo leaves on germination of their seeds and they also form flowers.
Learn more about angiosperms here:
https://brainly.com/question/9416370
#SPJ10
Identity Factors in an Experiment
WARM-UP
Consider what you already know about scientific design. To set up an experiment testing whether
students' grades are affected by their level of exercise, which factors do you think you would need to keep
in mind? Check all that apply.
student gender
vpe of exercise
amount of exercise
what grades are measured
how long the experiment will last
what time of day the students exercise
how much time the students spend studying
DONI
Answer:
Did you copy and paste this from somewhere because i want to help but i don't understand it at all.
Explanation:
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?
a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.
However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).
Therefore, the sequence o mRNA read in the 5' to 3' direction is:
5' CUAUGGAAACACAUCAGUAGAA 3'
b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.
The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.
The codons, then will be:
AUG GAA ACA CAU CAG UAG
Then, we can say that the amino acids translated will be:
Met Glu Thr His Gln
(Methionine - Glutamine - Threonine - Histidine - Glutamine
c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.
Please please help me its for a grade :(
Find the correct definition that matches the term in the bank. Column
A 1. heterozygous: heterozygous
2. probability: probability
3. trait: trait
4. dominant: dominant
5. recessive: recessive
6. heredity: heredity Column B
a.the allele that always shows up and hides the weaker allele
b.characteristic of an organism that makes it unique
c.the passing of traits from parent to offspring
d.the mathematical chance that something will happen
e.the allele that is always masked in the presence of the stronger allele
f.when the offspring inherits two different alleles
In an experiment, a scientist decides to study the effect of exercise on cholesterol levels in people. He studies two set of people—those who exercise every day for an hour and those who don’t exercise at all.
............................ In this case, the statement that people who exercise for an hoour may have lower cholesterol level is HYPOTHESIS. ....................... The cholesterol level would be the DEPENDENT VARIABLE.
An hypothesis refer to a proposed statement based on prior knowledge, which is used as a starting point in scientific experimentation.
In scientific experiments, there are always two variables, independent and the dependent variable. The independent variable is the variable that is changed or controlled in a scientific experiment in order to determine its effects on the dependent variable.
Explain the significance of coevolution.
Coevolution is one of the main procedures via which organization of biological communities is done.
What is coevolution?It is the process of reciprocal evolutionary change, which takes place between the groups of species or pairs of species as they associate with one another. The activity of every species, which takes part in the association leads to selection pressure on the others.
It is one of the main approaches by which organization of biological communities is done. It can result in very unique associations between the species, like that between the plant and pollinator and between the parasite and host. It may also encourage evolution of novel species.
Thus, coevolution plays an essential role in the organization of biological communities.
Find out more information about coevolution here:
https://brainly.com/question/1489642
HELP Creat a food chain. Choose the biotic factors from the list and move them onto the hotspots marked with circles! Biotic factors: minnows, trout, herons, mosquito larvae, algae
Answer:
Decaying Leaves, Worms, Frogs,Trout, Herons
Explanation:
I got it right on edg
The food chain are as follows:
Algae(producer) --> Mosquito larvae --> Minnows --> trout --> herons
What is Food chain?A food chain is defined as a linear network of links in a food web that begins with producer organisms and ends at an apex predator species, detritivores or decomposer species that shows how organisms are related to each other that is related to food. Each level of the food chain represents a different trophic level.
At the basic level there are plants that produce energy which passes up to higher level organisms like herbivores, then carnivores eat the herbivores, energy transfers from one to the other. Only 10% energy is transferred from one trophic level to another. In the above example, Algae is producer, larva is herbivore, after which there are carnivores.
Thus, the food chain are as follows:
Algae(producer) --> Mosquito larvae --> Minnows --> trout --> herons
Learn more about Food chain, here:
https://brainly.com/question/1101049
#SPJ2
diversity of opines and opinecatabolizing bacteria iso lated from naturally occurring crown gall tumors, appl. environ. microbiol., 1997,
Naturally occurring crown gall tumors host diverse opines and opine-catabolizing bacteria, contributing to their complex ecological interactions.
Naturally occurring crown gall tumors are associated with a diverse array of opines and opine-catabolizing bacteria. Opines are unique compounds synthesized by transformed plant cells within the tumor, which serve as growth substrates for the resident bacteria. The diversity of opines is remarkable, including nopaline, octopine, agropine, and others.
Similarly, the bacterial community within crown gall tumors exhibits substantial diversity, with various strains possessing specific opine-catabolism genes. These bacteria efficiently catabolize opines, providing them with a competitive advantage in the tumor environment. The intricate interplay between opines and opine-catabolizing bacteria contributes to the complex ecology of crown gall tumors and their ability to thrive in diverse environments.
To learn more about tumors follow the link:
https://brainly.com/question/14366025
#SPJ4
The appropriate question is:
What is the diversity of opines and opine-catabolizing bacteria isolated from naturally occurring crown gall tumors?
Nicotine replacement and self-management techniques are two approaches to smoking__________________.
What is the name of the method in which a smoker tries to avoid tempting situations and manages feelings that lead to nicotine use?
True or False Most people pick up smoking habits in adulthood.
Making sure your friends know you are tobacco-free and sticking to that decision in the face of pressures and influences requires ________________skills.
Critical Thinking Identify 5 health benefits of smoking cessation (stop smoking) that occur throughout the years after you quit, as well as those you see within a few days.
Can someone pls help me.
Answer:
It requires trolling your friends skills
what is the starting material for glyclosis and what is the product
The starting material for glycolysis is glucose and the final product of glycolysis is pyruvate in aerobic settings and lactate in anaerobic conditions.
What is glycolysisglycolysis?
Glycolysis is the process in which glucose is broken down to produce energy. It produces two molecules of pyruvate, ATP, NADH and water. The process takes place in the cytoplasm of a cell and does not require oxygen. It occurs in both aerobic and anaerobic organisms.
Supporting answer.
Glycolysis starts with one molecule of glucose and ends with two pyruvate (pyruvic acid) molecules, a total of four ATP molecules, and two molecules of NADH.
Hence, the starting material for glycolysis is glucose and the final product of glycolysis is pyruvate in aerobic settings and lactate in anaerobic conditions.
I need to know the answer to the question
Answer:
substitution is the Answer
Blood Smear 1 Blood Smear 2
Blood Smear 3 Blood Smear 4
CASE STUDY 2
A 40-year-old male presents at the Urgent Care Clinic after being hit in the face with a baseball. The patient complains of double vision and pain in his face. Upon physical exam, you observe that the left eye is fixed in downward gaze, but the right eye moves normally. The patient’s right cheek is also very tender. You order a CT scan to determine the extent of his facial injuries. A coronal image through the orbits and sinuses is displayed.
Questions:
1. What orbital bone is fractured and what sinus is involved in this injury?
2. How could this fracture affect movement of the eye?
1. Fracture: Orbital floor of left eye. Sinus: Maxillary sinus.
2. Fracture affects eye movement by entrapment of inferior rectus muscle or nerve, limiting upward gaze and causing double vision.
1. Based on the provided information, it is likely that the patient has a fracture of the orbital floor, specifically the orbital floor of the left eye. The involvement of the left eye being fixed in downward gaze suggests a possible entrapment of the inferior rectus muscle or the inferior orbital nerve, which commonly occurs with orbital floor fractures. Additionally, the tenderness in the right cheek may indicate a possible blowout fracture, which involves the maxillary sinus.
2. The fracture of the orbital floor can affect the movement of the eye due to several reasons. Firstly, the entrapment of the inferior rectus muscle or the inferior orbital nerve can limit the normal upward movement of the affected eye, resulting in a fixed downward gaze as observed in the patient. This restriction can lead to double vision (also known as diplopia) when the eyes are not properly aligned.
To learn more about Fracture follow the link:
https://brainly.com/question/33487249
#SPJ4
Compare You hold a 65*C cup of cocoa. Your hand is 37*C and the outside air is 6*C. Describe the flow of thermal energy.
If you hold a hot cup of cocoa is expected the heat flows from the cup to your hand and some of the heat will flow from your hand to the outside air.
How does heat flow?In general heat moves from hot objects to colder objects this process continues until both objects reach the same temperature in case all the objects involved are inanimate.
How will heat flow?In this situation, it is expected heat moves from the cup (hot object) to your hand, moreover, some of this heat will escape to the cold air.
Learn more about heat in https://brainly.com/question/13860901
#SPJ1