the basic pathophysiological mechanisms responsible for producing signs and symptoms in leukemia include all of the following, except? group of answer choices replacement of normal marrow precursors by leukemic cells causing anemia decrease in functional leukocytes causing infection hemorrhage secondary to thrombocytopenia decreased erythropoietin production

Answers

Answer 1

A natural physiological reaction to anemia would be an increase in erythropoietin production by the kidney. Leukemic cell buildup in the bone marrow causes marrow failure, which manifests as anemia, thrombocytopenia, and granulocytopenia.

The framework employed throughout this textbook is pathophysiology, which encompasses four interrelated topics: etiology, pathogenesis, clinical manifestations, and treatment implications. Specific disorders will be used to illustrate settings in which specific pathophysiologic processes can occur.

Pathophysiology refers to changes at the cellular level caused by disease or injury. To understand how disease processes affect normal bodily function, healthcare professionals must understand cellular biology as well as anatomy and physiology.

to know more about pathophysiological visit

https://brainly.com/question/27961681

#SPJ4


Related Questions

A health expert evaluates the sleeping patterns of adults. Each week she randomly selects 30 adults and calculates their average sleep time. Over many weeks, she finds that 5% of average sleep time is less than 9 hours and 5% of average sleep time is more than 9.4 hours. What are the mean and standard deviation (in hours) of sleep time for the population? (Round "Mean" to 1 decimal places and "standard deviation" to 3 decimal places.)

Answers

The mean and standard deviation (in hours) of sleep time for the population are 9.2 hours (rounded to 1 decimal place) and 1.785 hours (rounded to 3 decimal places), respectively.

We are given that a health expert evaluates the sleeping patterns of adults. Each week she randomly selects 30 adults and calculates their average sleep time. Over many weeks, she finds that 5% of average sleep time is less than 9 hours and 5% of average sleep time is more than 9.4 hours.

To determine the mean and standard deviation (in hours) of sleep time for the population, we have to make use of the standard normal distribution.The 5% of average sleep time is less than 9 hours represents the left tail of the distribution. So, the corresponding Z-score is -1.64 (obtained using the standard normal table). Similarly, the 5% of average sleep time is more than 9.4 hours represents the right tail of the distribution.

So, the corresponding Z-score is 1.64. Using the formula for the Z-score, we get;

\($$Z = \frac{\overline{x} - \mu}{\frac{\sigma}{\sqrt{n}}}$$\)

Where Z is the Z-score,\($\overline{x}$\) is the sample mean,\($\mu$\) is the population mean, \($\sigma$\) is the population standard deviation, and n is the sample size.

From the information given, we know that Z for 5% of the population on both tails are -1.64 and 1.64.

Hence, we can use this information to solve for \($\mu$\) and\($\sigma$\).We have two equations:

\($$-1.64 = \frac{9 - \mu}{\frac{\sigma}{\sqrt{30}}}$$$$1.64\)

\(= \frac{9.4 - \mu}{\frac{\sigma}{\sqrt{30}}}$$\)

Solving the first equation for\($\mu$,\) we get;\($$\mu\)

\(= 9 + 1.64\left(\frac{\sigma}{\sqrt{30}}\right)$$\)

Substituting \($\mu$\) into the second equation and solving fo\(r $\sigma$\), we get;\($$\sigma\)

=\(\frac{0.4\sqrt{30}}{3.28}\)

=\(1.785\text{ hours}$$\)

Substituting $\sigma$ into the expression we obtained for \($\mu$\), we get;

\($$\mu = 9 + 1.64\left(\frac{1.785}{\sqrt{30}}\right)\)

=\(9.22\text{ hours}$$\)

Therefore, the mean and standard deviation (in hours) of sleep time for the population are 9.2 hours (rounded to 1 decimal place) and 1.785 hours (rounded to 3 decimal places), respectively.

Know more about   health  here:

https://brainly.com/question/19305870

#SPJ8

A seven-year-old female is experiencing noticeable weight loss and delayed growth. Until her sixth birthday,
she had been meeting all of her developmental milestones, but she is no longer following her growth curve. Her parents have noticed a significant change in her eating habits. She is rarely hungry, and they feel like
they have to force her to eat. She has lost six pounds over the past year. They have also noticed that she
seems to be constantly thirsty and urinates often. She is generally hyperactive and has a difficult time falling
asleep and staying asleep. She has no significant past medical history except for the placement of ear tubes
in both ears when she was five, for chronic ear infections

Answers

Answer:

I would say she may have an eating disorder; shes not eating enough, which is causing her body to not have enough energy to mantain basic functions like sleeping and why shes losing weight all of a sudden. It would cause her body to no longer grow properly. She may also be drinking water instead of consuming food which is why she is constantly thirsty and has to urinate so often.

im not 100% positive in my answer but i have a very stong feeling.

Answer: A tumor in her hypothalamus

Explanation: the hypothalamus controlls hunger and thirst

which of these is the most likely happening when you lose your voice?​

which of these is the most likely happening when you lose your voice?

Answers

b) the vocal chords are not vibrating correctly

to develop self respect you should do what?

Answers

Have a positive outlook on life

Answer: Choose self-respect. Consider your own feelings. Avoid making self-deprecating comments. Keep a journal.Take care of your emotional needs. .Acknowledge to yourself that you deserve respectful treatment.

Explanation:

Sanjay is part of a group text with several of his friends. One of them had an unpleasant encounter with a student in their class who is not part of the group text. Sanjay’s friends begin putting down this student in ways that are cruel and would be hurtful if the student ever saw them, so he is not comfortable responding. Why is this indirect pressure?

Answers

Since Sanjay’s friends begin putting down this student in ways that are cruel and would be hurtful if the student ever saw them, so he is not comfortable responding. This is  indirect pressure because  of option D He feels that his friends expect him to act a certain way.

What is the difference between direct and indirect peer pressure?

The term direct peer pressure, or the direct pursuit of change by an individual or group. indirect peer pressure occurs when someone is asked to change gently or explicitly.

Indirect peer pressure occurs when a teenager hears a friend talking negatively about someone and then responds to the gossip. Or if a middle schooler finds out that the parties of the popular students involve drink or drugs, that subliminal pressure can lead them to experiment as a means of fitting in.

Note that indirect peer pressure is less overt than unspoken peer pressure, it can nevertheless have a significant impact on an impressionable young person. Indirect peer pressure occurs when a teenager hears a friend talking negatively about someone and then responds to the gossip.

Learn more about pressure from

https://brainly.com/question/11982510
#SPJ1

See options below

Why is this indirect pressure?

OA. He is uncomfortable with the situation

OB. He has been asked his opinion directly.

OC. His friends will turn on him if he does not respond.

OD

He feels that his friends expect him to act a certain way.

Overall, what is the reaction in europe to genetically engineered food? question 30 options:
a. europe has not taken a position on genetically modified (engineered) food
b. europe has the most scientist in the world dedicated to genetically modified (engineered) food
c. europe is leading the fight against genetically modified (engineered) food
d. europe is supporting genetically modified (engineered) plants, but genetically engineered animals.

Answers

Option C

Europe is leading the fight against genetically modified (engineered) food.

What Is Engineered food?

Foods that have undergone genetic engineering (GE) have had their DNA altered using genes from other plants or animals. The desired trait's gene from one plant or animal is taken by scientists and put into the cell of another plant or animal.

To know more about Engineered food, check out:

https://brainly.com/question/13491558

#SPJ4

Vanessa is giving a presentation on four common drug classification and their uses for treatments. What are four categories she might include and their uses?

Answers

Vanessa is giving a presentation on four common drug classification which are Stimulants, Depressants, Hallucinogens, and Opioids and their uses for treatments are explained below.

Stimulants medicines are employed in the treatment of attention deficit disorder disorder (ADHD) and hypersomnia (a sleep disorder). they'll even be employed in the treatment of depression or nonheritable brain injury.

Depressants are medicines that embody sedatives, tranquilizers, and hypnotics. These medicine will slow brain activity, creating them helpful for treating anxiety, panic, acute stress reactions, and sleep disorders.

Hallucinogens are promising drugs to treat depression, anxiety, and substance-related disorders.

Opioids are used medically for pain relief.

To learn more about  Stimulants here

brainly.com/question/12846446

#SPJ1

Select the correct answer. The body loses water _____ in hot conditions. A. Faster B. Slower C. The same D. None of the above

Answers

A.) Faster in hot conditions
the answer is faster

A young man sets a goal to compete in a marathon in two weeks. He started training last week by exercising three to four times a week with his friend. After each training session he writes his daily experiences to assess problems that may hinder his achievements. What aspect of his fitness program could keep him from achieving his goal? A. The use of a friend as a support system will decrease the likelihood of John achieving his goal. B. Assessing training obstacles once a week is not frequent enough to solve problems that arise. C. Training three to four times a week is too intense and may cause injury. D. The original goal that John set does not leave him enough time to train.

Answers

Answer:

D. The original goal that John set does not leave him enough time to train.

Explanation:

Answer:

D. The original goal that John set does not leave him enough time to train.

Explanation:

A young man sets a goal to compete in a marathon in two weeks. He started training last week by exercising

The image shows groundwater zones.

Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous rock. Zone 2 is between porous rock and water. Zone 3 is in the Water. Zone 4 is between the Water and Impermeable rock.

Which number represents the water table?

1
2
3
4

Answers

Answer:

c: 3

Explanation:

The water table is represented by Zone 2, which is between the porous rock or soil and the water zone as the water table is the level at which the groundwater in the subsurface is under atmospheric pressure and can rise to the surface.

What is the water table, and what are the different layers?

porous rock or soil is at the top, followed by Zone 1. Zone 1 is unsaturated and contains both air and some water. Below Zone 1 is Zone 2, which represents the water table. In this zone, the soil or rock is saturated with water, and the water pressure is at atmospheric pressure. This means that the water in this zone is not under any significant pressure and can easily move up or down depending on the changes in the water level.

Hence, the water table is represented by Zone 2, which is between the porous rock or soil and the water zone.

Learn more about the water table here.

https://brainly.com/question/30044698

#SPJ7

Ace Bandages, gauze, rolls of tape, band aids and sterile first aid dressings are what type of items in a first aid kit?

Answers

Answer:

•Top 10 First Aid Kit Items

•Gloves/Eye Protection.

•CPR Pocket Mask.

•Tourniquet.

•Roller Gauze.

•4×4 Gauze Pads.

•Medical Tape.

•Two Triangular Bandages.

•Sam Splint.

Answer:

yes

Explanation:

yes

What is the scale of RBS?

Answers

Each subscale on the RBS consists of six items, with scores ranging from 0 (absent) to 3 (severe) for each item. The total score for the RBS can range from 0 to 162, with higher scores indicating more severe repetitive behaviors.

The RBS consists of six subscales, each measuring a different type of repetitive behavior. The subscales are as follows, Stereotypical behavior is measured by this subscale, as it measures repetitive motor movements such as hand flapping, rocking, or spinning. Self-injurious Behavior is the subscale that measures behaviors that result in self-harm, such as head-banging or biting oneself. Compulsive Behavior: This subscale measures behaviors that are performed in a repetitive manner, such as counting or checking rituals.

Learn more about the behavior disorder here.

https://brainly.com/question/29817957

#SPJ4

The four influences on consumer choices are personal factors, advertising, advice of a salesperson, and: What else? Please help this is due today
Color
Si
Cost
Date

Answers

The answer is cost :)

what should I do if I failed in my exam​

Answers

Answer:

Don't be sad Try to do better than this time.always focus on your study don't divert your mind from your study .

hope it is helpful to you

Failure is not the end of life. Failing an exam doesn't make you any less intelligent or less capable of achieving success in life than those who got better results. Just think that the failure you had in exams was just another step towards success. You can definitely score good marks in the exam, next time.

If your patient's cardiac rhythm is life-threatening, your first action should be to __________.

Answers

If your patient's cardiac rhythm is life-threatening, your first action should be to Examine the patient's vital signs, as well as his or her emotional state.

A heart attack, also known as a myocardial infarction, is a severe ailment brought on by poor blood supply to your heart muscle. Although there are numerous potential causes, a blockage in one or more of your heart's arteries is the most common one.

The injured cardiac muscle will start to deteriorate without blood flow. A heart attack might result in lasting cardiac damage and perhaps death if blood flow isn't rapidly restored.

Blood flow to a part of your heart stops or is significantly reduced during a heart attack, which results in the death of that portion of your heart muscle. The pumping sequence for the entire heart might be disrupted when a portion of your heart is unable to pump due to death from lack of blood flow.

To learn more about life-threatening click here

https://brainly.com/question/13160598

#SPJ4

to cause cancer, tumor suppressor genes require [ select ] allele(s) to be mutated and are therefore considered to be [ select ]

Answers

To cause cancer, tumor suppressor genes require both alleles to be mutated and are therefore considered to be recessive.

Tumor suppressor genes play a crucial role in preventing the development and progression of cancer. These genes help regulate cell growth and division, acting as a defense mechanism against uncontrolled cell growth. Mutations in tumor suppressor genes can lead to the loss of their normal function.

However, unlike oncogenes that are activated by a single mutation, tumor suppressor genes require both copies or alleles to be mutated or inactivated to result in cancer development. This means that individuals with inherited mutations in one allele of a tumor suppressor gene have a higher risk of developing cancer since they only need an additional mutation in the other allele.

Due to the recessive nature of tumor suppressor gene mutations, they require a "double-hit" or loss of both functional copies to disable the gene's protective role, making them essential in cancer development.

To learn more about tumor suppressor here

https://brainly.com/question/31632723

#SPJ4


Select the device which is used for patients moving from a bed to a gurney.

Answers

Answer:

Position stretcher

Explanation:

This is used to move patients from a bed to a gurney

Question
Your body absorbs calories through food and burns calories through ________ ?

Body composition
Energy level
Nutrition
Activity

Answers

Answer:

body composition is correct

Explanation:

you burn fat every minute as the day goes on

body composition would be the answer

What is the definition of a standard drink for beer?

Answers

Definition of a standard drink in the US. 14 grams of pure alcohol in any drink or 0.6 fluid ounce (that is 18 grams). The amount of alcohol in any drink is important. Standard drink - Regular Beer. 5% , 350 ml.

Answer: Definition of a standard drink in the US. 14 grams of pure alcohol in any drink or 0.6 fluid ounce (that is 18 grams). The amount of alcohol in any drink is important. Standard drink - Regular Beer. 5% , 350 ml.

Milk and water are an important part of most healthy diets. Unlike water, milk contains a lot of calcium and vitamin D. In contrast to drinking water, drinking milk
rids the body of waste.
helps cells function properly.
keeps the body from losing fluids.
provides the body with building blocks.

Answers

D.) Provides the body with building blocks

Have a great day!

Answer:

D

Explanation:

EDGE2021


How many chromosomes does the cell in this animation start with?

Answers

Answer:

In humans, each cell normally contains 23 pairs of chromosomes, for a total of 46. Twenty-two of these pairs, called autosomes, look the same in both males and females. The 23rd pair, the sex chromosomes, differ between males and females

When taking a blood pressure reading, what sound does the healthcare provider listen for?

Answers

Answer:

Korotkoff sounds are blood flow sounds that healthcare providers observe while taking blood pressure with a sphygmomanometer over the brachial artery in the antecubital fossa. These sounds appear and disappear as the blood pressure cuff is inflated and deflated.

Explanation:

Who should address the needs of a patient with a mental disorder?

A. A speech therapist
B. An international medicine doctor
C. A mental health professional
D. A medical intern

I would really appreciate the help

Answers

Answer:

C. A mental health professional

Explanation:

because their a mental health professional

Answer:

A mental Health professional

Explanation:

They have the most experince out of everybody else there a mental intern could be good but it will not help the person with a mental disorder.

THIS WAS DUE YESTERDAY!!!!!!! SOMEONE PLS HELP ME ASAP!!!!!!!!

Think about your community, and imagine that you work in one of your local libraries coordinating education classes for members. Your supervisor has asked you to plan some technology classes to help the members of your community who lack technological skills or access to devices. What are the two most important programs you’d propose for your community and why?

Answers

Ok, so think about the two important programs you'd propose for your community.

Answer: It means volunteering. So, here are some examples,

1.) Organize a community blood drive

2.) Hold a bake sale for your favorite charity

3.) Organize a car wash and donate the profits to charity

4.) Help deliver meals and gifts to patients at a local hospital

5.)  Donate or raise money for your local Red Cross

1. Two-year-old Sarah has a
shorter-than-average mother
and a taller-than-average father.
Her parents wonder whether
Sarah will be a tall, average, or
short adult. Can they predict her
height? If so, how? Do you think
such a prediction will be very
accurate? Why or why not?

Answers

Answer:

A simple method to predict adult height is to double the child's height at age 2. Girls develop more quickly, so doubling their height at 18

Explanation:

brainiest

What are some ways that you can identify non-communicable diseases/health issues in your family? just use your family PLEASEEEE HURRY AND ANSWER THIS!

Answers

Cardiovascular disease, Cancer, Chronic Respiratory disease and Diabetes

How has the national Anthem of Nepal made an effort to bring unity in diverdity? Write​

Answers

Answer:

hope it helps..........

How has the national Anthem of Nepal made an effort to bring unity in diverdity? Write

Answer:

hope it's helps you have a great day keep smiling be happy stay safe. Sister's answer is also correct.

How has the national Anthem of Nepal made an effort to bring unity in diverdity? Write

Make 1 Smart Goal based on 1 thing you can change about your nutrition to help improve your energy balance. This does not need to be a huge change! Timeframe - needs to be at least 2 weeks since that is how long you will need to reflect on your plan implementation for this assignment.

Goal =

Why = explain how this change will impact your nutrition/health -

Answers

Answer:

Explanation:

By eating more healthy foods and also eating less sweets and less saturated fat at best for 10 weeks.

Identify the factors affecting the promotion of a good mental health

Answers

These factors interact with each other and can vary in significance depending on individual circumstances.  Several factors can influence the promotion of good mental health. Here are five key factors:

Social support: Having a strong support system of family, friends, and community can positively impact mental health by providing emotional support, a sense of belonging, and opportunities for social interaction. Healthy lifestyle: Engaging in regular physical activity, maintaining a balanced diet, getting enough sleep, and avoiding substance abuse can contribute to better mental health and overall well-being.

Learn more about health here;

https://brainly.com/question/32613602

#SPJ11

Episodes of overwhelming anxiety that last for several minutes with physical symptoms such as shortness of breath and rapid heartbeat is most characteristic of:________.

Answers

This is indicative of panic attacks.

Other Questions
50 points!! please don't copy from the internet -- (as long as you can)As technology continues to advance in our lives, it also continues to advance in the livestock and animal industry. Research a new reproductive technique that is used for livestock animals. Study how effective the technique is and how it can benefit or harm animal producers. Write a one page paper over your findings. Please talk about the technology you have researched; how it works, when it was developed, who it is used by, what species it is used on, and how it is or is not beneficial to producers. A business plan is a document describing the start-up costs and operating expenses of a new business.truefalse Good morning! Please help me sort these out for math in the picture above ( I put letters in red so then you can just tell me where the letter goes under either possible or impossible) A key dimensions of industry cultures is fast system Vs slow system Select one: True O False 7 What values for theta (0theta2) satisfy the equation? Equation: 3 sin theta = sin theta - 3Plss help! 13.(6.6) Solve.A retirement account that contains $53,000 earns 7.7% annual interest. What would be the balance I after 2 years?A=?P= R=T=Need help quick pls whick of the following for x makes the following true 24=6x+6 What is the sum of the lengths, in centimeters, of the two legs of a 30-60-90 right triangle, if the length of the hypotenuse is $2\sqrt{6}$ centimeters You react 2.33 g of iron (III) chloride with 50.0 mL of 0.500 M solution of sodium phosphate toform iron (III) phosphate and sodium chloride. How many grams of sodium chloride ought tobe produced? An experiment conducted at Pennsylvania State University was designed to evaluate the effectiveness of irrigation and fertilizers on colorado blue spruce trees growth. Fertilizer is used with one group of colorado blue spruce trees in a moist region, and irrigation is used with colorado blue spruce trees in a dry region. What are the confounding variables and why? What is your bodys last and most complicated line of defense against infection?. HELP ME PLEASE!!!!!!! MY MOM WILL OBLITERATE ME!!!!!!!!!!!!!!!!Which sentence illustrates a problem and solution interaction?(1 point)When my cousins come to visit, we put an extra leaf in the table to make it bigger.Because the island is so far from the mainland, the people have to wait for needed supplies.Compared to 2020, the 2015 school year was virtually problem-free.Because of severe drought in the area, this years harvest has been dramatically lower than normal. Jasmine and Peter each bought doughnuts from the same pastry shop. Jasmine spent K188 on 7chocolate doughnut treats and 11 Raspberry rose doughnut treats. Peter spent K236 on 13 chocolatedoughnut treats and 11 Raspberry rose doughnut treats. Find the cost of one Chocolate doughnut treatand the cost of one Raspberry rose doughnut treats Solve for x.7x = 42 the sum of two numbers is 9 and their difference is 1 Select the correct answer.Which description best fits the role of computer network architects?O A.A.OB.They design, implement, and test databases.They maintain and troubleshoot network systems.O C. They design, test, install, implement, and maintain network systems.O D.They design, configure, install, and maintain communication systemsResetNe Normal or regular syntax follows which pattern? Answer choices: beginning, middle, end verb, subject, object subject, verb, object article, subject, verb Cylinders A and B have the same radius but different heights. Which statement correctly compares cylinder A and cylinder B? Counteracting self-blame by reattributing responsibility for past negative outcomes is a cognitive therapy technique designed to change beliefs. rank beliefs. test beliefs. reveal beliefs. can you please compare the DNA sequences in thisimage, mark any insertion, deletion, polymorphism, and addition.Discuss about the yellow region in sequences and the nucleotides.discuss all the simi>M12-LCMT-F_D02.ab1TAAAGCCATTTACCGTACATAGCAC >M13-LCMT-F E02.ab1TAAAGCCATTTACCGTACATAGCAC >M14-LCMT-F_F02.ab1TAAAGCCATTTACCGTACATAGCAC325 >M15-LCMT-F_G02.ab1TAAAGCCATTTACCGTACATAGCAC >M16-LCMT-F_H02.ab1TAAAGCCATTTACCGTACATAGCAC>M12-LCMT-F_D02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M13-LCMT-F_E02.ab1ATTACAGTCAAATCCCTTCTCGTCC >M14-LCMT-F F02.ab1ATTACAGTCAAATCCCTTCTCGTCC350>M15-LCMT-F G02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M16-LCMT-F_H02.ab1ATTACAGTCAAATCCCTTCTCGTCC w >M12-LCMT-F_D02.ab1CCATGGATGACCCCCCTCAGATAGG>M13-LCMT-F_E02.ab1CCATGGATGACCCCCCTCAGATAGG >M14-LCMT-F_F02.ab1CCATGGATGACCCCCCTCAGATAGG375 >M15-LCMT-F_G02.ab1CCATGGATGACCCCCCTCAGATAGG>M16-LCMT-F_H02.ab1CCATGGATGACCCCCCTCAGATAGG>M12-LCMT-F_D02.ab1GGTCCCTTGACCAC>M13-LCMT-F_E02.ab1GGTCCCTTGACCAC >M14-LCMT-F_F02.ab1AGTCCCTTGACCAC >M15-LCMT-F_G02.ab1GGTCCCTTGACCAC>M16-LCMT-F H02.ab1GGTCCCTTGACCAC 400