The oldest fossils indicate the fish ate plankton whereas the teeth on recent fossils indicate the fish began to eat larger plants. This observation best supports evolution of life theory
Evolution explains how living things are changing and how modern living things descended from ancient life forms that no longer exist now . As living things evolve, they become better suited for the environment. This is because they adapt.
The fossil found in the lower layer is older than the one above it. The fossils found in the same area are of exact same age.
The age of fossils is calculated by finding the age of the rock in which the fossil is found. One of the most accurate method is radiometric dating.
In this process, scientists measure the amount of parent isotope and daughter isotope in a sample. They determine the material's age, from this ratio.
To know more about evolution, refer
https://brainly.com/question/12271572
#SPJ4
When a molecule other than water moves from an area of high concentration to an
area of low concentration with the use of a protein it is an example of what type of
passive transport.
Osmosis
Facilitated diffusion
Active Transport
Diffusion
Answer:
Osmosis
Explanation:
Osmosis is the spontaneous net movement of solvent molecules through a selectively permeable membrane into a region of higher solute concentration, in the direction that tends to equalize the solute concentrations on the two sides.
This direction is from high concentration to low concentration, this will create equilibrium.
in a salt solution ,salt is to,___while water is ____
A.solute,solvent
B.solvent,solute
C.seasoning,water
D.solubility,concentration
Answer:
Solute , Solvent
Solute Is the substance which is less in amount and which is mix in a solution
Solvent is the substances which is more in amount and in which the solute is mixed.
What is the ICD-10 code for severe protein-calorie malnutrition?
The ICD-10 code for severe protein-calorie malnutrition is E43.
This code is used to classify and track cases of malnutrition that are caused by inadequate intake of both protein and calories, leading to severe weight loss and nutritional deficiencies. It is important to note that this code should only be used for cases where malnutrition is the primary reason for seeking medical attention, as it may not accurately reflect the severity of malnutrition in cases where it is a secondary condition.
ICD-10 (International Classification of Diseases, 10th Revision) is a system used globally for classifying and coding various diseases and medical conditions. In this system, the code E43 specifically represents "Unspecified severe protein-calorie malnutrition," which is used to indicate cases of severe protein-calorie malnutrition where a more specific diagnosis is not available.
To know more about malnutrition visit:-
https://brainly.com/question/24949815
#SPJ11
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
anyone wanna help I'm stuck?
what will happen to all organisms at the end of their life cycle
Answer:
They will all die!
Explanation:
PLEASE HELP I WILL GIVE BRAINALIST AND EXTRA POINTS
Answer:
Coal-fired power plants
Explanation:
Generally speaking coal-fired power plants emit more greenhouse gas, however both emit greenhouse gases in large quantities.
heritability estimates for personality traits tend to hover around
Heritability estimates for personality traits tend to hover around 40-60%.
Heritability refers to the proportion of phenotypic variation in a trait that can be attributed to genetic factors within a specific population at a particular time. A heritability estimate of 40-60% suggests that a substantial portion of the variation in personality traits is influenced by genetic factors. However, it is important to note that heritability estimates are population-specific and can vary depending on the methodology, study design, and the specific traits being measured.
The range of 40-60% indicates that genetic factors contribute significantly to the variability in personality traits, but it also highlights the role of environmental influences and interactions between genes and the environment. Personality traits are complex and multifaceted, influenced by a combination of genetic, environmental, and social factors. The heritability estimates indicate that genetic factors play a moderate to substantial role in shaping personality, but they do not imply that personality traits are solely determined by genetics. Environmental factors, including upbringing, experiences, and cultural influences, also contribute to the development and expression of personality traits.
To know more about heritability click here
brainly.com/question/27222788
#SPJ11
suppose that a snake handler bitten by a par- ticular venomous snake species was treated with antivenin. why might the same treatment for a second such bite have a harmful side effect?
A significant immunological reaction could be brought on by a further injection if the handler built up immunity to the anti-venin proteins.
What does immunity mean?a method by which the immune system defends the body from an infectious disease. There are three different kinds of immunity: innate, adaptive, & passive. Barriers that prevent hazardous chemicals from reaching the body include mucous membranes and the skin as part of innate immunity.
Why is it significant?We are guarded against these hazardous bacteria as well as some diseases by our innate immunity, a network of complex bodily stages and channels. When it detects invading forces like bacteria, viruses, or parasites, it acts right away. Adaptive and inborn immunity are both present in humans.
To know more about immunity visit:
https://brainly.com/question/8189807
#SPJ4
_________ is the heritable variation among individuals of a single population or within the species as
a whole.
A) Species diversity
B) Genetic diversity
C) Natural selection
D) Coevolution
E) Extirpation
Answer: Genetic Diversity
Explanation:
The arrangement of the water molecules in ice causes the ice to float. Explain how ice floating on the surface of a body of water affects the water in a way that is beneficial to the organisms in it.
Answer:
this enables survival of aquatic life
Explanation:
floating ice lowers temperatures of water at the top while at the bottom the temperature is relatively higher. A property called anomalous expansion of water
Water ice helps life on Earth survive because it floats. During the winter, floating ice builds up on top of lakes and seas when surface temperatures are low enough for water to freeze. This ice layer protects the water below it, keeping it liquid and preserving the life that exists there.
What is the arrangement of water molecules in ice ?The close proximity of the water molecules when water is in its solid state (ice) prevents it from altering shape. The molecules in ice are rigidly spaced apart from one another and are connected by hydrogen bonds, which form a crystalline lattice. This pattern is very regular.
Since liquid water is a fluid, its molecules are joined together by transient hydrogen bonds to form its structure. In ice, the hydrogen bonds solidify and produce a network of interconnected molecules with hexagonal shapes. Ice floats because it is less thick than liquid water.Learn more about Water molecules here:
https://brainly.com/question/1313076
#SPJ1
when making the baseline of your tlc plate, why do you use a pencil to trace the baseline straight across the plate at least 1-2 cm from the bottom of the plate?
A pencil is commonly used to draw the baseline straight across the TLC plate at least 1-2 cm from the bottom of the plate because pencil markings are stable.
When performing Thin Layer Chromatography (TLC), the baseline is an important reference point used to measure the migration distance of the analyte spots. A pencil is commonly used to draw the baseline straight across the TLC plate at least 1-2 cm from the bottom of the plate for several reasons:
1. Pencil markings are non-reactive: Pencil marks are made using graphite, which is non-reactive and does not interfere with the separation or analysis of the analyte. Other writing instruments, such as pens or markers, may contain chemicals that could contaminate the sample or interfere with the chromatographic process.
2. Pencil markings are stable: Pencil marks are relatively stable and do not easily dissolve or smudge when the plate is exposed to solvents during the chromatographic process. This ensures that the baseline remains visible and intact throughout the separation.
3. Pencil marks are easily visible: Pencil marks are typically dark and contrasting against the TLC plate's surface, making it easier to identify and measure the migration distances accurately. The baseline should be clearly visible to ensure precise measurements of spot migration.
4. Adequate distance from the bottom of the plate: By drawing the baseline at least 1-2 cm from the bottom of the plate, you provide sufficient space for the solvent to migrate and carry the analyte spots without interfering with the baseline. This distance allows for a clear separation between the baseline and the spots, making it easier to measure their migration distances accurately.
Overall, using a pencil to trace the baseline straight across the TLC plate at an appropriate distance from the bottom ensures visibility, stability, and non-interference with the chromatographic process, allowing for accurate measurements and analysis.
To know more about Thin Layer Chromatography (TLC) follow the link:
https://brainly.com/question/10296715
#SPJ4
COVID-19 and Flu can be either _______ or _______ and even _______. In some cases both can be spread through________ in the air from an infected person coughing, sneezing, or even talking.
Responses
Mild, Severe, Fatal, Droplets
Mild, Severe, Fatal, Droplets
slow, fast, dead, spit
slow, fast, dead, spit
non effective, effective, infective, feces
non effective, effective, infective, feces
None of these are correct
COVID-19 and Flu can be either Mild or Severe and even Fatal. In some cases both can be spread through Droplets in the air from an infected person coughing, sneezing, or even talking.
What is the flu?We know that the flu is one of the kinds of upper respiratory tract infection. The upper respiratory tract infection do affect the way that the person is able to talk and could even block the throat and lead to irritations.
There are several degrees of the symptoms of the flu and many of these different kinds of flu may be caused by very different causal organisms and the way that the symptoms do appear and carry on would always vary.
One of the most fatal kinds of the flu is the kind that is caused by the corona virus which caused the wide spread pandemic that occurred in the year 2020 and was fatal to a lot of people across many countries.
Learn more about covid:https://brainly.com/question/29232894
#SPJ1
A meal providing 1200 kcalories contains 10 grams of saturated fats, 14 grams of monounsaturated fats, and 20 grams of polyunsaturated fats. What percentage of energy is from fats
The meal provides 1200 kcalories, and the total fat content is 44 grams (10 grams of saturated fats + 14 grams of monounsaturated fats + 20 grams of polyunsaturated fats). To calculate the percentage of energy from fats, we need to determine the energy contribution of the fat content in the meal.
In 1 gram of fat, there are 9 kcalories. Therefore, the total energy contribution from fats in the meal is 44 grams × 9 kcal/g = 396 kcal. To calculate the percentage, we divide the energy from fats (396 kcal) by the total energy content of the meal (1200 kcal) and multiply by 100:
\(\[\text{Percentage of energy from fats} = \frac{{396 \text{ kcal}}}{{1200 \text{ kcal}}} \times 100\]\)
Simplifying this equation, we find that the percentage of energy from fats in the meal is approximately 33%.
This means that 33% of the total energy provided by the meal comes from fats. It is important to note that while fats are a significant source of energy, it is recommended to consume them in moderation as part of a balanced diet. Different types of fats have varying effects on health, with saturated fats generally considered less healthy compared to monounsaturated and polyunsaturated fats. Therefore, it's essential to make informed choices about the types and amounts of fats consumed to maintain a healthy lifestyle.
To learn more about monounsaturated refer:
https://brainly.com/question/6356482
#SPJ11
whats the answer to this
Answer:
Fossil record of vertebrates
Urine may routinely contain sodium, potassium, proteins, and red blood cells.
True/ False
True. Urine may contain small amounts of sodium and potassium, which are typically filtered out by the kidneys.
However, high levels of these electrolytes may indicate a medical issue. Urine may also contain proteins, such as albumin, which can be a sign of kidney damage. Red blood cells may also be present in urine, which can be an indication of a urinary tract infection or kidney issue. It is important to monitor urine regularly for any abnormalities and consult a healthcare professional if any concerning symptoms arise.
Sodium and potassium are essential electrolytes that maintain fluid balance in the body, while proteins help maintain osmotic pressure. Red blood cells can be present in trace amounts due to normal kidney function or urinary tract issues. Overall, these components are commonly found in urine due to the body's process of filtering waste and maintaining homeostasis.
To know more about sodium visit:
https://brainly.com/question/30778909
#SPJ11
the observable outward manifestation of the genes of an individual is referred to as it'srecessivegenotypephenotype
The correct term for the observable outward manifestation of the genes of an individual is its phenotype.
Phenotype refers to the physical characteristics, traits, and behaviors exhibited by an organism as a result of its genetic makeup and the interaction with the environment. It includes both visible traits, such as hair color, eye color, and height, as well as non-visible traits, such as blood type or susceptibility to certain diseases.
Genotype, on the other hand, refers to the genetic composition of an individual, specifically the combination of alleles (variants of genes) that an individual possesses. It can include both dominant and recessive alleles.
The recessive genotype refers to the specific combination of recessive alleles that an individual carries for a particular trait. It is the genetic information that determines the recessive trait, but the recessive phenotype may not always be visible in the presence of a dominant allele.
In summary, phenotype refers to the observable characteristics of an individual, while genotype refers to the genetic makeup. The recessive genotype determines the recessive trait, but the visible manifestation of that trait is referred to as the phenotype.
Here you can learn more about phenotype
https://brainly.com/question/20730322#
#SPJ11
You return from lunch to science class, and there are two clear liquids on your
desk.
What is the best/safest way to determine what the liquids are?
A. Taste it
B. Touch with your bare fingers
C. Boil it
D. Drag a magnet through it
Answer:
My best guess would be boil it!
IN YOUR OWN WORDS, what is the definition for the words Zygote?
Zygote is the single cell formed from the fussion of male and female gamete.
Solar radiation warms earths surface and atmosphere and _____ gasses absorb the energy and radiate it back toward Earth’s surface.
Answer:
solar
Explanation:
the anterior pituitary hormone that controls the release of glucocorticoids from the adrenal cortex is __________.
Answer:
Adrenocorticotropic Hormone (ACTH)
Explanation:
Explanation:
Adrenocorticotropic hormone (ACTH)
Microorganisms play a vital role in the nitrogen cycle “justify the statement.
Answer:
Without nitrogen-fixing bacteria, nitrogen would not be replenished.
Explanation:
The nitrogen cycle is critical because all living things need nitrogen. Atmospheric nitrogen cannot be used by most organisms and must be converted into a usable form. This is why we need microorganisms (nitrogen-fixing bacteria) to do this task. Atmospheric nitrogen (N2) is converted into usable ammonia (NH3) and to nitrates and nitrites (NO3 & NO2). Other bacteria convert these back to N2. These are all important to keep nitrogen cycling.
It is becoming clear that denitrifying fungi, nitrifying archaea, anammox bacteria, aerobic denitrifying bacteria, and heterotrophic nitrifying microorganisms are key players in the nitrogen cycle.
In the nitrogen fixation process, nitrogen-fixing bacteria convert the N2
in the atmosphere into NH3 (ammonia). This bacteria binds hydrogen molecules with the gaseous nitrogen to form ammonia in the soil.
During assimilation, or when plants take up nitrates from the soil, bacteria aid in the process with the plants making ammonia. Animal waste is also a major place where bacteria thrive and produce ammonia. The process in which assimilation occurs in plants, and then bacteria convert the nitrates to ammonia is called ammonification.
From the conversion of ammonia to nitrites, bacteria also aid in this process called nitrification. The nitrifying bacteria mostly present in soils, oxidize ammonia into nitrites, and from nitrites to nitrates.
Finally, the process of denitrification also has bacteria present to aid in converting nitrates back into a gaseous form of nitrogen in the atmosphere.
To learn more about the Role of Microorganisms in the nitrogen cycle visit the link:
https://brainly.com/question/18664364
What are some functions of calcium?
Select all that apply.
-making teeth strong
-helping with muscle function
-making amino acids
-helping water balance
Answer:
-making teeth strong
-helping with muscle function
Explanation:
Calcium is a nutrient that all living organisms need, including humans. It is the most abundant mineral in the body, and it is vital for bone health.
The correct functions of calcium are:
Making teeth strongHelping with muscle functionHelping water balanceTherefore, the correct options are A, B and D.
In the body, calcium plays an important role and supports a variety of processes. It is essential for strong teeth and bones as it provides stability and support. For muscles to contract, nerve impulses must be transmitted, and calcium plays an important role in this process.
Additionally, it helps regulate water balance, promoting optimal cellular hydration and fluid balance inside the body. However, calcium is not directly required for the synthesis of amino acids. Its many roles in skeletal strength, muscle activity and cellular hydration highlight how important it is to maintaining general health.
Therefore, the correct options are A, B and D.
Learn more about calcium, here:
https://brainly.com/question/31566398
#SPJ3
Your question is incomplete, most probably the complete question is:
What are some functions of calcium?
Select all that apply.
-making teeth strong-helping with muscle function-making amino acids-helping water balanceThe antibiotics lincomycin A and B are separated by elution chromatography using a bed of cellulose beads with a solvent system of butanol, acetic acid, and water. The total volume of the bed is 100 liters and void fraction is 0.40. The equilibrium constants, K, have been previously measured as 11.0 and 12.0 for A and B, respectively. Estimate the volume of eluate at which the peak will occur for each of these antibiotics.
To estimate volume of eluate at which the peak will occur for each antibiotic, we need to consider the equilibrium constants (K) and the void fraction of bed. estimated elution volume for lincomycin A is approximately 3.64 liters, while for lincomycin B, it is approximately 3.33 liters.
The equilibrium constant (K) represents the distribution of a solute between the stationary phase (cellulose beads) and the mobile phase (solvent system). A higher K value indicates a stronger affinity of the solute for the stationary phase.
In this case, lincomycin A has an equilibrium constant (K) of 11.0, while lincomycin B has a K value of 12.0. Since lincomycin B has a slightly higher K value, it will have a stronger affinity for the cellulose beads and will take longer to elute from the column compared to lincomycin A.
The void fraction of the bed is given as 0.40, which means that 40% of the total bed volume is occupied by the cellulose beads, while the remaining 60% is the volume available for elution.
To estimate the volume of eluate at which the peak will occur for each antibiotic, we can calculate the elution volume based on their equilibrium constants and the void fraction.
For lincomycin A: Elution volume = Void fraction * Total bed volume / K
Elution volume = 0.40 * 100 liters / 11.0 = 3.64 liters For lincomycin B:
Elution volume = Void fraction * Total bed volume / K
Elution volume = 0.40 * 100 liters / 12.0 = 3.33 liters
Therefore, the estimated elution volume for lincomycin A is approximately 3.64 liters, while for lincomycin B, it is approximately 3.33 liters.
Know more about equilibrium constants here:
https://brainly.com/question/28559466
#SPJ11
Which process results in a cell containing the same DNA as its parent cell? mitosis meiosis gamete formation fertilization
Answer:
The correct answer would be A. mitosis.
Explanation:
Mitosis is a type of cell division which results in the formation of two daughter cells each containing same DNA as its parent cell.
It usually takes place in somatic cells of eukaryotic organisms.
It helps in growth and repair of cells or tissues in multi-cellular organisms.
In contrast, meiosis takes place in germ cells to produce haploid gametes. Gametes contains half the number of chromosomes present in parent cell. In addition, crossing over takes place in meiosis which results in the genetic variation.
Answer: The answer is A.
Explanation: Because I got it correct.
What would be the safest way to reduce the impact of the the non-native red fire ant while minimizing the impact on other organisms
Answer:
The red fire ant is indigenous to South America. In recent years, this invasive species has become a pest for both humans and other ants
crop destruction
What would be the safest way to reduce the impact of the non-native red fire ant while minimizing the impact on other organisms?
A pouring gasoline on ant mounds
B
spraying broad-spectrum pesticides
с
release a species of fly that will prey on the fire ants
D
treating all species of ants with ant killer
Answer: Release a species of fly that ill prey on the fire ants
Explanation:
I assume that was the question with the answers and I had the same question thru study island so here ya go
if the frequency of stimulus is 10 pulse per/sec,
calculate how lo g the period is?
The period (the time it takes to complete one cycle of a waveform) of a 10-pulse-per-second stimulus is 0.1 seconds.
The period is the inverse of the frequency. In other words, the period is the amount of time it takes for one cycle of a repeating event to occur. The formula for calculating the period is:
Period = 1 / Frequency
In this case, the frequency of the stimulus is 10 pulses per second. To calculate the period, we can simply plug the frequency into the formula:
Period = 1 / 10
Period = 0.1 seconds
Therefore, the period of the stimulus is 0.1 seconds.
Answer: The period of the stimulus is 0.1 seconds
Learn more about formula of period at https://brainly.com/question/27992917
#SPJ11
How do genetics play a role in evolution?
A few of these characteristics are favourable and are called as beneficial mutations which provide a better survival benefit to changing surroundings. Evolution of a new class of species altogether occurs when a permanent change takes place in the phenotype of an entity as a result of natural selection and competition when an environment continues to stay for longer durations incorporating better-adapted entities.
Gene mutations cause the evolution we observe. It causes a change either in the organization or amount of genetic material in a cell. Such a mutation if occurred in a gamete can be easily inherited by the emerging gamete. New alleles of genes are produced as a result of mutations and hence the variations between entities. Therefore, genes and genetic mutations play a significant role in the process of evolution.
which greenhouse gas is created by humans exclusively?
Answer:
carbon dioxide is a greenhouse gas created by humans
Explanation:
due to the burning of fossil fuels
Two students make a model of a tree house they want to build. The scale is 1:42.
In the scale model, the tree house door is 3 cm tall.
How tall should the real tree house door be?
39 cm
45 cm
126 cm
14 cm
Answer:
126 cm
Explanation:
The real treehouse should be 126 centimeters tall. Given that two students make a model of a treehouse they want to build, and the scale is 1:42, and in the scale model the treehouse store is 3 cm tall, to determine how tall should the real tree house store be the following cross multiplication should be done: 1 = 342 = X(42 x 3) / 1 = X126 / 1 = X126 = XTherefore, the real treehouse should be 126 centimeters tall.