Science is concerned with explaining natural phenomena, based on observation, experiments, and evidence. Other questions are best answered by using other forms of knowledge and understanding, such as art, philosophy, or religion. Read each topic and select the topics for Science.
Select ALL that apply.

behavior of alligators

meaning of existence

black holes

deep-sea vents

the Aurora Borealis (Northern Lights)

ghosts, goblins, and other creatures in stories

Answers

Answer 1

Answer:

These:

Explanation:

behavior of alligators

black holes

deep sea vents

the Aurora Borealis

Answer 2
Behaviour of alligatorsBlack holesDeep-sea ventsThe Aurora Borealis

What is natural phenomena?

Any event or an occurrence that happens on its own without any human intervention is termed as a natural phenomena.

Natural phenomena harms the nature as well as life on earth.

Common examples of natural phenomena include thunder storms, earthquakes, landslides, volcanic eruptions, hurricane etc.

Some majestic natural phenomena include blood rain, Northern lights and luminous water in the world.

Natural phenomena can sometimes be destructive in nature and are therefore responsible for loss of lives and property.

It is almost impossible to predict the occurrence of any natural phenomena.

However, the negative outcome of natural phenomena can be managed with special disaster management operation

Thus, natural phenomena could only be observed and understood in science.

Learn more about natural phenomena, here:

https://brainly.com/question/28585198

#SPJ2


Related Questions

Questions

Which of the following is a feature seen in viruses as well as cellular organisms?
Genetic information in the form of nucleotide sequences in a nucleic acid genome?

1-Genetic information in the form of amino acid sequences in a protein genome
2- Plasma membrane always present
3-A protein capsid always present
4- Ability to carry out cellular respiration and gene expression independently
retu bratswap
5026
A

Answers

Answer:

Genetic information in the form of amino acid sequences in a protein genome

Describe the difference in pressure against your cheeks when they are full of air versus When You released it

Answers

Answer: When they were full of air, then the Pressure was the Highest 'cause of the larger force under the specified area as compared to when we released it. We decreased the area of our cheek, so pressure increased and air flows from the cheek (area of high pressure) to the atmosphere

Explanation:

inguinal lymph nodes are found in

Answers

Inguinal lymph nodes are found in the inguinal region, which is located in the groin area. Specifically, they are present in the crease between the upper thigh and the lower abdomen. The inguinal lymph nodes play an important role in the immune system by filtering and monitoring lymph fluid from the lower extremities, genitals, and abdominal wall. They are part of the body's lymphatic system, which helps to defend against infections and disease.

A mutation causes a sequence of DNA that has the nucleotides TTG to be changed to TCG. The resulting protein has a different sequence of amino acids. Which type of mutation is this?

Answers

Answer:

subtitution mutation

Explanation:

The T in the middle is subtituted with C.

Hope it helps.

Answer:

The answer is A, missense.

Explanation:

The dark bands seen under the microscope in a skeletal muscle fiber are concentrations of actin protein called l-bands . It is true or false.

Answers

Answer:

it is false

Explanation:

it appears as light bands under microscope

Answer:

false

Explanation:

because dark band seen under the microscope in a skeletal muscle fiber are concentration of actin protein  are known as A bands because they are anisotropic when viewed with polarized light

If 98 out of 200 individuals in a population express the recessive phenotype, what percent of the population would you predict to be homzygous dominant?

Answers

Answer:

49% is the answer for this question

Please answer the following 4 questions regarding genetics.

Please answer the following 4 questions regarding genetics.

Answers

Answer:

1. Carol is heterozygous for hemophilia. Her husband does not carry the allele for hemophilia. What is the probability that they will have a daughter with hemophilia? A son with hemophilia?

Solution:

Since Carol is heterozygous for hemophilia, she has one X chromosome with the hemophilia allele and one X chromosome without the hemophilia allele. Her husband, who does not carry the allele, has one X chromosome without the allele and one Y chromosome.

The probability that they will have a daughter with hemophilia is 0, as the daughter would need to inherit the hemophilia allele from both parents, which is not possible in this case.

The probability that they will have a son with hemophilia is 50%, as the son will inherit the hemophilia allele from Carol (who passes one of her X chromosomes to her son) and the Y chromosome from his father.

2. Jake suffers from red-green colorblindness. He married Janet who is not colorblind nor a carrier. What is the probability that they will have a daughter with color blindness? A son with colorblindness?

Solution:

Jake suffers from red-green colorblindness, which means he has a recessive allele for the condition on his X chromosome. Janet is not colorblind nor a carrier, which means she has two normal X chromosomes.

The probability that they will have a daughter with color blindness is 0, as the daughter would need to inherit the recessive allele for color blindness from both parents, which is not possible in this case.

The probability that they will have a son with color blindness is 50%, as the son will inherit the recessive allele for color blindness from Jake (who passes his X chromosome to his son) and a normal copy of the X chromosome from Janet.

3. William suffers from hemophilia. He married Sandra who is a carrier of the trait. What is the probability they will have a son with the disorder?

Solution:

William has hemophilia, which means he has a recessive allele for hemophilia on his X chromosome. Sandra is a carrier of the trait, which means she has one normal X chromosome and one X chromosome with the hemophilia allele.

The probability that they will have a son with hemophilia is 50%, as the son has a 50% chance of inheriting the hemophilia allele from Sandra (who passes one of her X chromosomes to her son) and a 50% chance of inheriting the Y chromosome from William.

4. Which of the following could be the parents of a colorblind female?

a) A normal male and a normal female (not a carrier)

b) A normal male and a female carrier

c) A colorblind male and a normal female (not a carrier)

d) A colorblind male and a female carrier

Solution:

A colorblind female can only occur if she inherits the recessive allele for color blindness onboth of her X chromosomes. Therefore, the only possible parents of a colorblind female are a colorblind male and a female carrier (option d).

Option a is not possible because both parents are normal and do not carry the color blindness allele. Option b is not possible because the female carrier would need to pass on the recessive allele for color blindness to the daughter, which is not possible as the daughter would inherit a normal X chromosome from the father. Option c is not possible because a normal female cannot carry the recessive allele for color blindness.

Hope this helps!

For any recessive disease to occur it is necessary that both the recessive alleles are expressed in the individual. 1) probability of a hemophilic daughter is 0  and a son is 50%. 2) Probability of a color-blind son is 50% and a daughter is 0. Hemophilic son - 50 %. 4) Option D is correct.

1) The probability that they will have a hemophilic daughter is zero. This is because to express the hemophilic trait one allele of the trait must be inherited from both the parents, but here the mother is a carrier while the father does not carry any allele for the disease.

The probability that they will have a hemophilic son is 50%. This is because he will inherit an X chromosome from his mother who is a carrier of the disease and one Y chromosome from his father.

2) The likelihood of having a color-blind daughter is 0 because the daughter would have to inherit the color-blind recessive allele from both parents.

The likelihood of having a color-blind son is 50% because the son inherits the color-blind recessive allele from Jake (through his X chromosome) and the normal X chromosome from Janet.

3) The likelihood of having a hemophiliac son is 50% because the son inherits 50% of the hemophilia gene from Sandra (passing one of her X-chromosomes to the son) and 50% of the Y-chromosome gene from William.

4) A colorblind woman can only become a colorblind woman if she has a recessive gene for color blindness in both her X-chromosomes. So, the only parents of a female who is colorblind are male and female carriers of the recessive gene.

To learn more about probability, refer to the link:

https://brainly.com/question/30034780

#SPJ2

Which of the following best illustrates evidence from comparative anatomy that
supports biological evolution?

Answers

Explanation:

our ancestors turning into humans that have evolved today

In which life stage do humans start to talk, read, and
write?

Answers

Answer:

In Stage 1 (initial reading, writing and decoding), typically between the ages of 6 and 7 years old, the child is learning the relation between letters and sounds and between print and spoken words.

Hope it helped!!!

Answer:

In Stage 1 (initial reading, writing and decoding), typically between the ages of 6 and 7 years old, the child is learning the relation between letters and sounds and between print and spoken words

2 pts Although most biologists do not consider viruses to be alive, viruses do share some characteristics with living things. Which of the following is the requirement for life that viruses lack? The ability to move The ability to reproduce on their own Having genetic material Having highly ordered structure Question 30 2 pts While they are simple relative to cells, viruses often have a very diverse collection of components. Which one of the following choices is LEAST likely to be found as part of a virus? membrane components ribosomes proteins with functional binding sites single-stranded DNA glycoproteins Although most biologists do not consider viruses to be alive, viruses do share some characteristics with living things. Which of the following is the requirement for life that viruses lack? The ability to move The ability to reproduce on their own Having genetic material Having highly ordered structure Question 30 2 pts While they are simple relative to cells, viruses often have a very diverse collection of components. Which one of the following choices is LEAST likely to be found as part of a virus? O membrane components O ribosomes O proteins with functional binding sites single-stranded DNA O glycoproteins

Answers

Viruses are considered to be non-living entities because they cannot carry out metabolic processes or reproduce on their own. Instead, they rely on the host cells they infect to provide them with the necessary machinery to replicate themselves.

However, viruses do possess genetic material, either DNA or RNA, and they have a highly ordered structure.

One requirement for life that viruses lack is the ability to reproduce on their own. They require a host cell to reproduce and cannot do so independently. This is because they lack the machinery necessary to carry out the complex processes involved in reproduction, such as DNA replication and protein synthesis.

While viruses are simple compared to cells, they often have a diverse collection of components. They typically have a protein coat, or capsid, that encloses their genetic material. Some viruses also have an envelope composed of membrane components, including lipids and glycoproteins, which they acquire from the host cell during the process of budding. Viruses do not have ribosomes, as they do not carry out protein synthesis themselves, but they may have proteins with functional binding sites, such as enzymes that aid in the process of replication.

Of the choices listed, single-stranded DNA is least likely to be found as part of a virus. While some viruses do have DNA as their genetic material, it is typically double-stranded, and RNA is also a common viral genome. Single-stranded DNA is more commonly found in certain types of bacteria-infecting viruses known as bacteriophages.

Learn more about viruses  here:

https://brainly.com/question/30428438

#SPJ4

2. ______ are made up of at least one cell. Which word best fits in the blank? * 1 point A. Animals B. All living things C. Plants D. Atoms

Answers

Living things are made up of at least one cell which is option B.

Living things explained.

Living things are organisms that have one or more cells and have life i.e they can breathe.

Living things are organisms that can perform some essential processes and has the ability to maintain their internal environment.

Some essential processes perform by living things are metabolism, respiration and so on.

The mature characteristics of living things are movement, respiration, nutrition, irritabilility, growth, excretiuon, reproduction and death.

Examples of living things are plants and animals.

Therefore, living things are composed of one or more cells and have a complex organization that help them to maintain their internal environment.

Learn more about living things below.

https://brainly.com/question/280237

#SPJ1

List at least four factors that
determine the type of vegetation
that occurs in a terrestrial
biome.

Pleaseeee help

Answers

Answer:

Differences in temperature or precipitation determine the types of plants that grow in a given area (Figure 1). Generally speaking, height, density, and species diversity decreases from warm, wet climates to cool, dry climates. Raunkiaer (1934) classified plant life forms based on traits that varied with climate.

Explanation:

ANSWER FAST PLEAAASEEE

Because killer whales are at the top of many food chains, it may seem as if they are not at risk of starving if seals die off. Why is this not necessarily true?

Answers

Answer:

This is not true. Although they eat sharks, whales, and dolphins, that is just occasional. Seals are their primary meal.

Sorry it was late

Hope this helps!

Based on what you've read, answer the following questions.
1. Girls generally begin their growth spurt with a major hormonal shift called the
2. The hormone that causes the growth of pubic and underarm hair in girls is
3. Most
don't understand that adults have experienced the same kinds of things
they re experiencing.
4. According to Erik Erikson, adolescents face the crisis of
5. Most people express more than
identity.
6. What factor--parents, peer groups, or youth culture has the greatest effect on the educational and vocational choices of teenagers?
7. Two eating disorders associated with young women and adolescents are
and
8. The abused substances that are most used by adolescents are
and
9. Most sexually transmitted diseases are

Answers

Explanation:

secondary character structure

developing countries tend to have high birth rates. why?

Answers

Answer:

In developing countries children are needed as a labour force and to provide care for their parents in old age. In these countries, fertility rates are higher due to the lack of access to contraceptives and generally lower levels of female education

Explanation:

At what pH levels are enzymes in the human body productive?

Answers

Answer:

Between ph7 and ph 11

Explanation:

The optimum pH level for this is at pH7 because the number achieved was 350 product molecules per Minute

What is the per capita growth rate of the global human population?
A.) negative
B.) fluctuating
C.) positive
D.) zero

Answers

Answer:

positive

Explanation:

The global human population has been steadily increasing in size for hundreds of years.

Cellular Respiration: describe each set of chemical reactions. Make sure to include the reactants, products, and location where each step occurs.

Answers

Answer:

n,,,,,,xdwe

Explanation:

The diagram below represents a stack of rock layers. Examine the diagram, and answer the question that follows.

What do these layers and their fossils suggest about Earth's history?
A.
There have been changes in Earth's lifeforms over time.
B.
Lifeforms on Earth have been the same over time.
C.
No lifeforms were present when these layers formed.
D.
Only one kind of lifeform lived where these layers formed.

The diagram below represents a stack of rock layers. Examine the diagram, and answer the question that

Answers

Fossils are animals and vegetable remains that get deposited or printed in sedimentary layers. Option A is correct: There have been changes in Earth's lifeforms over time.

What is a fossil?

Fossils are animal and vegetable rests found in different strata of sedimentary rocks. Sedimentary layers deposit chronologically, so they are used to reflect history. They keep in each layer some of the forms of life that inhabited that area in the past.

Fossils are very useful while dating ages. Index fossils are the fossilized organizms that only used to exist in a given era or geological period during evolution.

Fossil registers show that similar or different structured have been inhabiting the same area in the same period of time.

According to this framework, we can assume option A is correct: There have been changes in Earth's lifeforms over time.

In the image, from the bottom (oldest layers) to the upper part (most recent layers), we can see how the organisms inhabiting this area changed with the pass of time.

You can learn more about fossils at

https://brainly.com/question/14988327

#SPJ1

Which is NOT a function of the muscular system?
A. sensing the environment
B. balance
C. generating heat
D. circulation

Answers

Answer:

A is the answer

plz give me a brainest

Sensing the environment is not a function of the muscular system. Thus Option A is correct.

What are the major function of muscular system?

A system which act like a machine by converting chemical energy from food into mechanical energy to enable various physiological activities of body.

Three types of muscles present in the body. A consciously controlled skeletal muscles attached to bones and causes movement of those bones to do various activities like running, chewing.

An involuntary Smooth muscle present inside the blood vessels like the stomach, help in movement of food and blood circulation.

An involuntary Cardiac muscle resides in heart stimulates contractions leads to generation of heartbeat.

Some major function of this system include movement, support, providing stability, maintain posture of body, blood circulation, respiration due to diaphragm muscle, digestion, urination etc.

Hence, option A is correct.

Learn more about muscular system, here:

https://brainly.com/question/3162365

#SPJ2

What is the minimum internal temperature for holding hot food to
prevent harmful food borne pathogens from multiplying?

Answers

74 degrees celsius or 165 degrees Fahrenheit

SOMEONE HELP ME PLEASE PLEASE JUST ZOOM UP ON THE PICTURE IT’S DUE TODAY PLEASE I NEED HELP

SOMEONE HELP ME PLEASE PLEASE JUST ZOOM UP ON THE PICTURE ITS DUE TODAY PLEASE I NEED HELP

Answers

Answer:

A blue whale is not equipped to lift objects as it is a mammal adapted for living in the ocean. They are the largest animals on Earth and can weigh up to 200 tons, but they have no muscles in their fins to lift objects. They primarily use their fins for swimming and maneuvering in the water

Explanation:

What is the most important influence of the forest ecosystem on the environment

Answers

Answer:

Forests

Explanation:

Forests have also sanitary influences upon environment due to the production of oxygen through photosynthesis.

The study of the environment is called ecology. There are two types of factors for an ecosystem and these are a biotic and abiotic factors.

The correct answer is light

What is photosynthesis?

The process of the formation of food by trapping the sunlight with the help of chloroplast is called photosynthesis.

According to the question, the most influential factor which affects the environment is light as all the plants directly depend on the light for the formation of food and all the other species are dependent on plants either directly or indirectly.

Hence, the correct answer is light.

For more information about the light, refer to the link:-

https://brainly.com/question/1388366

Maggie places cells of Elodea, a freshwater plant, on a wet-mount microscope slide. She uses a saltwater solution to prepare the slide. When she observes the cells under the microscope, what is she most likely to see?


A.

The cell walls have dissolved, releasing the cell.

B.

The cells have remained unchanged.

C.

The cells will swollen, expanding the cell walls.

D.

The cells have shrunk within the cell walls.

Answers

When Maggie places the cells under the microscope, she is most likely to see D. The cells have shrunk within the cell walls.

Why would the cells have shrunken ?

If Maggie places cells of Elodea, a freshwater plant, on a wet-mount microscope slide, and then uses a saltwater solution to prepare the slide, she is most likely to see the cells have shrunk within the cell walls when she observes them under the microscope.

When cells are placed in a hypertonic solution (such as saltwater), water moves out of the cells by osmosis, resulting in the cells losing water and shrinking. In the case of Elodea cells, the cells will shrink within the cell walls.

Find out more on cells at https://brainly.com/question/13047140

#SPJ1

To determine whether regulation of gene expression by short RNAs was a naturally occurring phenomenon, researchers isolated RNA from a cell and fractionated them by size to obtain only short RNAs. The next step was to clone these molecules.
Today the cloning step would not be required. Which of the techniques below is the best reason why?
A. Because a microarray could tell if the fragments were encoded by the genome.
B. Because a PCR reaction could tell if the fragments were encoded by the genome.
C. Because an RNA-seq reaction could tell if the fragments were encoded by the genome.
D. Because a yeast 2 hybrid could tell if the fragments were encoded by the genome.
E. Because a GFP fusion could tell if the fragments were encoded by the genome.

Answers

Answer:

C. Because an RNA-seq reaction could tell if the fragments were encoded by the genome.

Explanation:

The combination of single-cell RNA sequencing (RNA-Seq) and bioinformatic tools to assemble and annotate sequence reads is currently the most common methodology used to obtain complete transcriptomes from individual cells. RNA-seq is a Next-Generation Sequencing (NGS) technology that enables the analysis of the entire transcriptome, thereby this method can be used to examine gene, allelic and ncRNA expression. In the last years, RNA-seq has become the gold standard technique for direct analysis of ncRNA expression profiles in biological samples and clinical research.

1. The following gene sequence appears on one strand of a segment of DNA that is about to go
through DNA Replication. What code will DNA Polymerase build to make the complementary
strand?
TACGGCATATGCAAATGGCGAGCCTATATT

Answers

The DNA polymerase will build the complementary strand with the code: ATGCCGTATACGTTTACCGCTCGGATATA.

What is DNA replication?

DNA replication is a process by which a DNA molecule makes a copy of itself. During DNA replication, an enzyme called DNA polymerase reads the existing DNA strand and builds a new complementary strand by matching up the appropriate nucleotides.

To build the complementary strand of DNA, we need to use the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).

So, for each base in the original sequence, we will pair it with its complement:

Original strand: TACGGCATATGCAAATGGCGAGCCTATATTComplementary strand: ATGCCGTATACGTTTACCGCTCGGATATA

Learn more about DNA Replication here: https://brainly.com/question/21265857

#SPJ1

The complementary strand to the given sequence would be:

ATGCCGTATACGTTTACCGCTCGGATATAA

What is gene sequence?

A gene sequence is a specific sequence of nucleotides in DNA (or RNA) that encodes the genetic information for a particular trait, function or protein. Genes are the basic unit of heredity and are responsible for passing on traits from one generation to the next.

The complementary strand of DNA will have a sequence that pairs each nucleotide with its complementary base: adenine (A) with thymine (T), and cytosine (C) with guanine (G). Therefore, the complementary strand to the given sequence would be:

ATGCCGTATACGTTTACCGCTCGGATATAA

During DNA replication, DNA polymerase reads the existing strand from 3' to 5' and builds the complementary strand in the 5' to 3' direction. Therefore, the new strand would be synthesized by adding nucleotides in the following order:

ATA...CGT...TAA...CGC...TGG...ATA

Learn about complementary strand here https://brainly.com/question/1534778

#SPJ1

Which of the following concepts makes it legally right to reproduce a substantial portion of the works of another person with permission?​

Answers

The concept that makes it legally right to reproduce a substantial portion of the works of another person with permission is Copyright. Option A

What is copyright all about?

The concept of copyright grants the creator of an original work the sole rights to its use and distribution, usually for a limited time, with the intent of enabling the creator to receive compensation for their intellectual effort.

When someone else wishes to reproduce a substantial portion of those works, they must usually get permission from the copyright holder.

This permission can take the form of a license or contract that outlin the tems under which the work can be used.

The above answer is in response to the full question below;

Which of the following concepts makes it legally right to reproduce a substantial portion of the works of another person with permission?​

A. Copyright

B. Fair use

C. Freedom of information

D. Intellectual freedom

Find more exercises on Copyright.;

https://brainly.com/question/13800858

#SPJ1

Why is photosynthesis considered a light-dependent reaction?
1. It requires sunlight as an energy source.
2. It needs sunlight to break apart important molecules.
3. It depends on sunlight to warm the plant.
4. It requires sunlight as a catalyst.

Answers

The answer is the number 2.

Photosynthesis is a light-dependent reaction because light is used as a catalyst in this process. With the help of the light, the water molecule breaks; that is the first step. Option 4 is correct.

What is photosynthesis?

Photosynthesis is a process that requires sunlight. The sunlight acts as a catalyst as it falls on the chlorophyll pigment and breaks down the water molecules. Due to the breakdown of water molecules, the electron passes.

This process uses water and carbon dioxide to produce glucose and oxygen. Water is broken down at the PSII complex, and then the electron moves to the PSI. Through this electron movement process, a proton gradient is formed that helps in ATP production.

The carbon dioxide is fixed in the stroma, and it is a light-independent reaction. The water is oxidised to form oxygen, and carbon dioxide is reduced to form glucose.

Hence, sunlight acts as a catalyst. Option 4 is the correct answer.

Click here to learn more about photosynthesis.

https://brainly.com/question/1388366

#SPJ2

PLEASE HELP! 50 pts!!!!!
Answer each question individually


4. The graph below shows the population of a species over time.

a) Label four parts of the graph:

Exponential growth
Maximum growth
Carrying capacity
Growth slowing down
(I put a pic of the graph that’s to be labeled)

b) Why does growth slow down?

c) what are the conditions for exponential growth?

PLEASE HELP! 50 pts!!!!!Answer each question individually 4. The graph below shows the population of

Answers

Answer:

a)

exponential growth- from begining to end(not sure about this one)

maximum growth- -around the middle where line is going almost straight up (where the most increase of pop. happening)

growth slowing down-right before hitting the capacity

carry capacity - dotted line on top

b)the growth slows down as it hits is carrying capacity, it's essentially slowing down to get ready to stop (like a car slowing down before a stop)

c) conditions might be a surplus of food and water, lack of predation, little to no threats, etc

Explanation:

Help me fast please guys thanks!!!!!!!

Help me fast please guys thanks!!!!!!!

Answers

Answer:

The answer is cattle ranching for beef and leather products.

Explanation:

cattle ranching doesn't require trees. You don't use trees to feed the cattle.

Other Questions
(a) Find the value of b when the angle between v = (b, 2) and w = (-8,-6) is b = (6) (b) Find a unit vector perpendicular to the plane through P(2, 1,-1), ((-1,1,2) and R(1,-1,2). (6) (c) Find the equation of the plane containing the line x = -1+t, y = 1 2t, z=t : and is perpendicular to the other two planes 4x 2y + 22 1 = 0 and 3x 6y + 3z = -5. (5) = A child is pushing a merry-go-round. The angle through which the merty-go-round has turned varies with time according to (t)-7t + 3 where = 0.367 rad/s and 140-10-2 rad/sCalculate the angular velocity of the merry-go-round as a function of time Express your answer in terms of the variables , , and t. Part BWhat is the initial value of the angular velocity?Part CCalculate the instantaneous value of the angular velocty w, at t 550 rad/s Part DCalculate the average angular velocity wfor the time interval t = 0 to t = 5.50s List the simple shapes into which you divided shape C, and measure their sides. Write all the measurements in inches. find the area of the rectangle the square the triangle and the other rectangle Which of the following is the best definition of a chemical change?A. A change in a substance where no new substance formsB. A change in a substance where energy is conservedC. A change in a substance where a phase change occursD. A change in a substance where one or more new substances form most of the interior of a leaf consists of soft, thin-walled, living ________ cells. how can limiting factors (density dependent and density independent) affect a population size? Select the correct answer. Which equation could be solved using this application of the quadratic formula? Which numeral represents the location of the Battle of Vicksburg? A. I B. II C. III D. IV A _____ is a collection of related records. group of answer choices schema column field file In an effort to reassure the market and foreign investors, the Hong Kong government "fixes it currency," or holds the price steady in relation to the U.S. dollar. This is referred to as aGroup of answer choicespegmanaged floatfloatdollarization Which of the following refers to a set of procedures in which the sample size and sample statistics are used to make estimates of population values or facts?A) sample logicB) deductive statisticsC) statistical deductionD) generalizationE) deductive logic Which ordered pair is the solution to the system of equations?{y=2x154x+3y=5Responses(5, 5)begin ordered pair n 5 comma negative 5 end ordered pair(0, 6)begin ordered pair 0 comma 6 end ordered pair(4, 7) In a DNA molecule, ______ bonds form between nitrogenous bases, such that A (adenine) pairs with its complement ______, and G (guanine) pairs with its complement ______. The curve through the ordered pairs (0, 10), (1, 5), and (2, 2.5) can be represented by the function f(x) = 10(0.5)*.What is the multiplicative rate of change of the function?O 0.5022.55Mark this and returnSave and ExitNextSubmit Cmo crees que el Estado, la sociedad y la familia promueve de forma prioritaria el desarrollo de nios, nias y adolescentes y asegura el ejercicio de sus derechos? what is one of your responsibilities as an rbt? advocacy supervision direct instruction program development Activity 3 - Ice BreakerRead the selection below. The story illustrates what an experiment is. Study and answer thequestions that follow.Ice BreakerQ1. For his investigation, why did Mr. Edison buy the same kind of fish as those that had died? *1 pointBecause he missed his fishesBecause that kind of fish is expensiveTo make sure that his fish would have the same response behavior as the fish that diedTo bring back the memories of the dead fishesQ2. Why did he keep the fish on the aquarium he bought for two days before started his investigation? *1 pointTo ascertain that they can survive in their new environmentBecause he is not yet ready with his experimentTo give time for the fishes to meet each otherBecause he can't find a jar to keep the fishesQ3. Why did he use identical jars in his investigation? *1 pointIt is the only type of jars available in the market.It was necessary for all conditions to be identical except one: the experimental variable.The fishes are fitted to the jars.He used identical jars for no reason at all.Q4. Why did he put ice cube in Jar No. 1? *1 pointThe fishes in jar no. 1 feel hot.He learned that fishes in jar 1 loves cold water.To find out if there would be a difference in the behavior of the fish in the two jarsHe wants to kill the fishes in jar no. 1 to finish his investigation immediatelyQ5. What did Edison want to find out from this experiment? *1 pointThe reason of the death of fishes in the aquariumIf fishes will survive in smaller jarsThe reason why the maids put ice cubes in the aquariumIf he needs to fire his housemaids because of the death of the fishes.pasagot pls needed ko na now I have a little house in which I live all alone. It has no doors or windows, and if I want to go out I must break through the wall. What am I? 10 kg of R-134a fill a 1. 115-m3 rigid container at an initial temperature of 30C. The container is then heated until the pressure is 200 kPa. Determine the final temperature and the initial pressure. Use data from the steam tables when it comes to extended reality in business, what fact differentiates accenture from other companies