PLEASE HELP ME


Amplify Science lesson 2.7 activity 3

Answers

Answer 1

Answer: Elisa has diabetes.

Explanation: Elisa has diabetes. I know this because she is constantly tired which is a huge symptom of low blood sugar which is what people with diabetes have. Therefore if she has such a huge sympto of it that maker her very likely to have diabetes. Second of all she is getting enough sleep and trying to eat the right foods lately but it doesnt seem to be helping. This shows that its not something she’s doing and since these things dont necessarily cure diabetes it’s likely that she has diabetes and needs to adjust her diet to help her condition.


Related Questions

The most powerful fmri tests suggest that the language areas of the cortex are:

Answers

The most powerful fmri tests suggest that the language areas of the cortex are patchy, widespread, and variable.

What is a cortex?

It should be noted that a cortex is the outer or the superficial part of an organ.

In this case, the most powerful fmri tests suggest that the language areas of the cortex are patchy, widespread, and variable.

Learn more about cortex on:

brainly.com/question/1191477

#SPJ12

One Strand of DNA is listed below. Which of the following best
represents the complementary strand of DNA?
DNA Strand: TCGAGGCTAA
A. ACGUCCGAUU
B. GATCTTAGCC
C. AGTCCGAUU

Answers

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

The complementary strand of  the mentioned DNA strand is AGCTCCGATT.

What is DNA?

DNA  is a hereditary material  which is present in human beings as well as all other living organisms.  Every cell which is present in an organism's body has DNA  which is the same. Most of the DNA is situated in the cell's nucleus and small amount of it can be found in the cell's mitochondria as well.

Information which is stored in DNA is stored as codes made up of four chemical bases namely, adenine, thymine , cytosine and guanine.Human DNA consists of 3 billion bases .The order of the bases determines information which is required for building and maintaining an organism.

DNA bases are capable of pairing up with each other. Adenine pairs with thymine and guanine pairs up with cytosine .Each base is also attached to a sugar molecule and a phosphate group. A base, phosphate  sugar are together called as nucleotides.

Learn more about DNA,here:

https://brainly.com/question/2293843

#SPJ2

Your question is incomplete but most probably your full question  was ,one Strand of DNA is listed below. Which of the following best

represents the complementary strand of DNA?

DNA Strand: TCGAGGCTAA

A. ACGUCCGAUU

B. GATCTTAGCC

C. AGTCCGAUU

D. AGCTCCGATT.

Which of the following has a stabilizing effect on equilibrium? A. Intraspecific competition B. Niches C. Interspecific competition D. Evolution

Answers

Answer:

The answer is option A "Intra-specific competition"

Explanation:

The equilibrium properties of an added substance multi-locus model of a quantitative attribute under recurrence and thickness subordinate determination are examined. Two contradicting transformative forces are expected to act:

1. settling determination on the attribute, which favors genotype with a middle aggregate, and

2. Intraspecific competition interceded by that quality, which favors genotype whose impact on the attribute digresses most from that of the overall genotype.

Likewise, wellness of genotypes have a recurrence free part depicting balancing out choice and a recurrence and thickness subordinate segment demonstrating competition.

1. A car traveled at 75 km/h for 3.0 hours. How far did it travel?

2. Joseph walked 4.0 km/h .How long did it take him to travel 12 km?

Answers

Answer:

1. The car traveled 225km in 3 hours

2. It took him 3 hours to travel 12 km

Why is the distance of the energy level from the nucleus important in determing the corresponding peak position in the photoelectron spectrum?

Answers

The distance of the energy level from the nucleus is important in determining the corresponding peak position in the photoelectron spectrum because the closer the electron, the more interaction and attraction, and the more energy is needed to get rid of that electron.

Spectrum, in physics, is the intensity of mild because it varies with wavelength or frequency. An instrument designed for visual observation of spectra is called a spectroscope, and an instrument that photographs or maps spectra is a spectrograph.

A spectrum is defined as the characteristic wavelengths of electromagnetic radiation (or an element thereof) that are emitted or absorbed by way of an item or substance, atom, or molecule. Examples of a spectrum include the rainbow, the emission colors from the sun, and the infrared absorption wavelengths from a molecule.

Learn more about spectrum here: https://brainly.com/question/25847009

#SPJ4

population of bacteria is growing according to the equation P(t)=1000e0.12t, where P(t) is the population and t is the time in hours. Estimate when the population will reach 5000 . Round to the tenths. Provide your answer below:

Answers

The estimated time it will take for the population to reach 5000 bacteria is approximately 13.4 hours.



To estimate when the population will reach 5000 bacteria, we can set up the equation P(t) = 5000 and solve for t.

The given equation for population growth is P(t) = 1000e^(0.12t). To solve for t, we can substitute 5000 for P(t):

5000 = 1000e^(0.12t)

To isolate the exponential term, we can divide both sides of the equation by 1000:

5 = e^(0.12t)

Next, we can take the natural logarithm (ln) of both sides to remove the exponential:

ln(5) = ln(e^(0.12t))

Using the property of logarithms, ln(e^(0.12t)) simplifies to 0.12t:

ln(5) = 0.12t

Now, we can solve for t by dividing both sides by 0.12:

t = ln(5) / 0.12

Using a calculator, we find that ln(5) is approximately 1.6094. Dividing this by 0.12 gives us an approximate value for t:

t ≈ 1.6094 / 0.12 ≈ 13.4117

Rounding to the tenths place, the estimated time it will take for the population to reach 5000 bacteria is approximately 13.4 hours.

Learn more about estimated time here:-

https://brainly.com/question/28579204

#SPJ11

If 35% of the bases in a region of the mouse genome are cytosine, what percentage in that region are adenine

Answers

The percentage of adenine if 35% of the bases in a region of the mouse genome are cytosine is 32.5%.

The percentage of bases must be made up of the other three nucleotides: adenine, guanine, and thymine. Since DNA always pairs up adenine with thymine and cytosine with guanine, we know that the percentage of adenine must be the same as the percentage of thymine in this region.

Since cytosine pairs with guanine, there would also be 35% guanine bases in that region. Together, cytosine and guanine make up 65% of the bases. Therefore, the percentage of adenine in this region of the mouse genome is 32.5%, which is half of the remaining percentage of nucleotides after subtracting the 35% of cytosine.

Learn more about adenine: https://brainly.com/question/907132

#SPJ11

What would happen to the Earth if not for the Sun’s gravitational pull?

Answers

Answer:

Earth would be a wandering planet.

Explanation:

it would be rogue upon the cosmos, or most likely, orbit the next big thing, ie, Jupiter. if none of those other planets are likely at that time, then it would most probably be a wandering planet with no life.

___________ is the process by which water and solutes flow from the blood into the capsular space in the renal corpuscle.

Answers

Answer:

filtration

Explanation:

What is unique about clams?

Answers

The clam's unique characteristic is their lack of eyes, ears, and noses, which prevents them from seeing, hearing, or smell.

The clams are members of the Bivalvia class of Mollusca. The clam is a soft-bodied organism enclosed in roughly two inverted bowl shells. They generally reside on ocean floors. Clams have a strong digging foot and two equal-sized shells joined by two adductor muscles. They possessed gills for the gaseous exchange.  The tentacles-like structure present around it help in capturing food and processing it. The external shell present over the clams is secreted by the mantle.

Hence, clams are complete organisms without diverse functions.

To know more about Gills.

https://brainly.com/question/14793690

#SPJ4

Select the correct text in the passage. Nick owns a grocery store. Identify the various types of roots in his store that are a type of stem. Nick owns a grocery store. Considering the high demand, he orders carrots, ginger, radish and sweet potatoes in excess quantities. Later, a sandwich bar owner contacts him for placing orders for cabbage and lettuce in bulk quantities for his sandwich bar. Now he has almost total control of the cabbage and lettuce market. He also sells potatoes, taros, and other spices like cinnamon in his store,

Answers

Answer:

cabbage and lettuce

Explanation:

They are the only types of roots in his store that are a type of stem.

Answer:

Cabbage and lettuce

Explanation:

If you grow crops, like me you would know that Cabbage and lettuce are the stem of there plant. There unlike other plants that grow Off of stems I hope this helps!

4. Koalas are herbivores that eat leaves from
eucalyptus trees. Before a joey (a baby koala) can
begin to eat leaves, the baby must ingest "pap," a
paste of partially digested leaves from the mother's
intestines. Why do you think this must happen
before the joey can digest the leaves?

Answers

Answer:

sorry i dont knwo

Joey of Koalas feed on their mother's milk before they can ingest pap.

Who are Koalas?

Koalas are arboreal marsupials native to Australia. They are one of the mammals who give birth to the young ones who remain in their mother's lower belly.

What is pap?

It is a special substance produces by their mother that look like droppings and acts like probiotics.

To know more about Koalas here

https://brainly.com/question/7627147

#SPJ2

How do different types of cells get energy?

Answers

Answer:

eukaryotic cells make energy and I think prokaryotic gets food from photosynthesis and glucose

Explanation:

i -

Children tend to resemble their parents due to __________

Answers

Answer:genetics

Explanation:

It is due to Genetics

Is this correct? Please help me and explain

Is this correct? Please help me and explain

Answers

Similar to a person's occupation in that it reveals what that person does in their community, their work, and their role, an organism's niche indicates that organism's role in their environment.

How does a career compare to a niche? Similar to a person's occupation in that it reveals what that person does in their community, their work, and their role, an organism's niche indicates that organism's role in their environment.In terms of ecology, a niche is comparable to a vocation.For instance, if a corporation has a variety of professions and/or positions, each of those jobs has a certain role that the employee is responsible for carrying out.The water an organism consumes, the area it lives in, and whatever materials it utilizes to construct a nest, a burrow, etc. are other elements of its niche.The term "niche" in ecology refers to the function an organism performs within a community. The physical and environmental requirements (such as temperature or topography) and interactions with other species that a species must tolerate make up its niche (like predation or competition) .

To learn more about  niche refer

https://brainly.com/question/728057

#SPJ1

Species such as the dusky seaside sparrow, the passenger pigeon, and the woolly mammoth are extinct. Populations of other species have declined to the point where they are designated as threatened or endangered. Identify one threatened or endangered species and explain why its population has declined. Describe three characteristics of organisms that would make them particularly vulnerable to extinction. Present three arguments in favor of the maintenance of biodiversity. Name and describe one United States federal law or one international treaty that is intended to prevent the extinction of species

Answers

One endangered species is the Florida panther. Its population has declined because of habitat destruction, hunting, and vehicular collisions.

The panther is a territorial animal that needs a lot of space and they need a large area to hunt, rest, and mate. As the human population grows, the amount of land available for the Florida panther decreases. The panthers are also killed by hunters who mistake them for other animals and by cars on highways that pass through panther habitats. Organisms with small population sizes, specific habitat requirements, or a narrow range of food sources are particularly vulnerable to extinction. The ESA also requires federal agencies to ensure that their actions do not jeopardize listed species or their habitats.

To learn more about species click here https://brainly.com/question/1712608

#SPJ11

Question 3 of 10
Which process describes the function of the category of enzymes known as
DNA polymerases?
A. Add new nucleotides to a strand and repair any errors
B. Unwind the double helix of DNA
O C. Separate the complementary strands of DNA
D. Bond together groups of nucleotides on the lagging strand
SUBMIT

Answers

D I think is the answer Bc “bonds together groups of nucleotides on the lagging strand” is correct

explain how aquaporins that are inserted into one area of the plasma membrane are distributed to other parts of the plasma membrane​

Answers

Aquaporins (AQP) are integral membrane proteins that serve as channels in the transfer of water, and in some cases, small solutes across the membrane. They are conserved in bacteria, plants, and animals. Structural analyses of the molecules have revealed the presence of a pore in the center of each aquaporin molecule.

Which of the following does the house cat have in common with a human

Answers

Answer:

Both living

Explanation:

A gene has two alleles: A and a. In a population that is in Hardy-Weinberg equilibrium, 9% of individuals have the aa genotype. What is the frequency of the A allele

Answers

Not sure about what the question wants exactly, A alleles or AA alleles or Aa alleles. This is the answers for A alleles.

I have to screenshot the answer cuz Brainly says my words are rude. Sorry for the inconveniences!

A gene has two alleles: A and a. In a population that is in Hardy-Weinberg equilibrium, 9% of individuals

Put the drinking water treatment steps in the correct order.

Put the drinking water treatment steps in the correct order.

Answers

2 5 4 3 1 I pretty sure that’s it but if not I’m sorry

1
What unique process occurs during Prophase I (of Meiosis I) to ensure new chromosomes aren't exact copies of the original chromosome?

A) a spindle forms and attached to each tetrad
B) crossing-over
C) independent assortment
D) nuclear envelope reforms

Answers

The unique process that occurs during Prophase I of Meiosis I to ensure new chromosomes aren't exact copies of the original chromosome is : crossing-over. Option B)  is the correct answer.

What is Meiosis?

This refers to a special form of cell division in which each daughter cell receives half the amount of DNA as the parent cell. Meiosis occurs during formation of egg and sperm cells in mammals.

meiosis also has distinct stages called:

prophase.metaphase.anaphase. telophase.

Learn more about Meiosis on

https://brainly.com/question/29383386

#SPJ1

The length of the ear is equal to the distance from the normal hairline to the

Answers

The length of the ear is a measurement from the top to the bottom of the ear, typically taken along the outer curve.

The distance from the normal hairline to the ear is the measurement from the point where the hair starts growing on the forehead to the top of the ear. This distance can vary depending on the individual's hairline and the position of the ear on the head.

It is important to note that the length of the ear and the distance from the hairline to the ear are not directly related, as one measures the ear itself while the other measures the distance between two points on the head.

However, both measurements can be useful in determining the overall proportions of the head and face. It is also worth noting that the hairline can vary greatly between individuals, and may change over time due to factors such as age, hormonal changes, and hair loss.

To know more about hairlines

https://brainly.com/question/22518003

#SPJ11

Some lizards have different size legs. Lizards with longer legs are able to better access food. Overtime
Lizards with short legs became less common.
What is the inherited variation?
please hurry

Answers

Answer:

Genetic variation is the difference in DNA among individuals or the differences between populations. There are multiple sources of genetic variation, including mutation and genetic recombination.

Explanation:

The size of the lizards' legs is the inherited variation in this situation. It is likely that hereditary variables, which can be transferred from parents to children, are responsible for the variance in leg size.

What is an inherited variation?

Genetic changes that are transferred from parents to children are referred to as inherited variation. Every person has a distinct set of genes that influence a variety of qualities, including physical attributes, behaviour, and disease risk. These genes, which a person inherits from both parents, are prone to chance mutations that happen throughout DNA replication and recombination.

In the aforementioned illustration, this genetic variation in leg length resulted in differential availability of food, with longer-legged lizards having better access to food sources. Because they had a harder time getting to food and might have been less fit, lizards with shorter limbs gradually decreased in population.

Therefore, the size of the lizards' legs is the inherited variation in this situation. It is likely that hereditary variables, which can be transferred from parents to children, are responsible for the variance in leg size.

Learn more about inherited variation, here:

https://brainly.com/question/28700250

#SPJ2

what are the flattened membranes in chloroplast called ?
A. photons
B. strong
c. Thylakoids
D. photosystems

Answers

Answer:

C. Thylakoids.

Explanation:

Hope this helps.

Answer:

C - thylakoids

Explanation:

your welcome

Natural Selection & Speciation:Question 1 A species of lizard has been studied on one of the isolated Galapagos Islands for many years. Since the island is small, the lineage of every lizard for several generations is known. Some groups of lizards have survived and others have died out. The groups that survive probably have​

Answers

Explanation:

Manged to utilize their adaptive features well and hence survived the competition

DNA is the genetic material that...

Answers

Answer:

the produces all genes and is passed down from parent to child and provides the "instructions" on the growth of the body, if the DNA is altered it can lead to things such as cancer, genetic mutations, etc.

Explanation:

Answer:

The answer is

That make up a living thing

This model shows a human embryo. What can you determine about its development from the model?
It has a postanal tail.
It’s a vertebrate
It has pharyngeal arches.
It has fully developed organ systems.

This model shows a human embryo. What can you determine about its development from the model?It has a

Answers

In humans, tails are vestigial structures, meaning the embryo can express it in early stages of development, but then, they loose it. Option A) It has a postanal tail.

What is a vestigial structure?

Vestigial structures are those body parts that have lost or reduced their original function during the evolution of a species.

These vestigial structures might be found in many animals, including human beings. They were plenty functional in the ancestors of new species, but now are typically degenerate, stunted, or rudimentary, and tend to be much more variable than homologous non-vestigial parts.

An example of these structures is the coccyx. This tailbone is the remnant of a missing tail. Actually, all mammals have a tail at some point in their development, even in humans, it is present for a period of 4 weeks during embryogenesis, but after a period of time this tail disappears and its forming vertebras get fussed with each other composing the coccyx.

In many animals, the function of the tail is to stabilize, equilibrate and mobilize. But in humans, the coccyx, located at the end of the vertebral column, has lost this original function. Although it is still an area of muscle insertion.

The correct option is A) It has a postanal tail.

You can learn more about tails as vestigial structures at

https://brainly.com/question/882540

#SPJ1

The city of Green Valley, Arizona, is trying to determine where to locate a new fire station. The fire station is expected to serve four neighborhoods.
Neighborhood X coordinate Y coordinate Number of homes
Birchwood 0.5 3.5 172
Cactus Circle 2 0.5 42
De La Urraca 3 1.5 223
Kingston 3 1 44
a The X* coordinate of the weighted center of gravity for the new fire station is _____. Enter your response to 2 decimal places.
b. The Y* coordinate of the weighted center of gravity for the new fire station is _____. Enter your response to 2 decimal places.
c. What other factors might come into play when making the final decision?
a. Zoning Considerations
b. Distance from other fire stations
c. Available space
d. All of the above.

Answers

(a) The X* coordinate of weighted center of gravity for new fire station is 1.82. (b) The Y* coordinate of weighted center of gravity for new fire station is 2.06. (c) The factors might come into play when making the final decision is Zoning Considerations, Distance from other fire stations, Available space. Option D is correct.

To determine the location for the new fire station in Green Valley, we need to calculate the weighted center of gravity based on the coordinates and the number of homes in each neighborhood.

The X* coordinate of the weighted center of gravity can be calculated using the formula;

X* = (X₁ × N₁ + X₂ × N₂ + X₃ × N₃ + X₄ × N₄) / (N₁ + N₂ + N + N₄)

where X₁, X₂, X₃, X₄ are the X coordinates of the neighborhoods, and N₁, N₂, N₃, N₄ are the number of homes in each neighborhood.

Using the given data:

X* = (0.5 × 172 + 2 × 42 + 3 × 223 + 3 × 44) / (172 + 42 + 223 + 44)

X* ≈ 1.82

Therefore, the X* coordinate of the weighted center of gravity for the new fire station is approximately 1.82.

The Y* coordinate of the weighted center of gravity can be calculated using the same formula, replacing the X coordinates with Y coordinates:

Y* = (Y₁ × N₁ + Y₂ × N₂ + Y₃ × N₃ + Y₄ × N₄) / (N₁ + N₂ + N₃ + N₄)

Using the given data:

Y* = (3.5 × 172 + 0.5 × 42 + 1.5 × 223 + 1 × 44) / (172 + 42 + 223 + 44)

Y* ≈ 2.06

Therefore, the Y* coordinate of the weighted center of gravity for the new fire station is approximately 2.06.

When making the final decision on the location of the fire station, several other factors might come into play;

Zoning Considerations: The city needs to consider any zoning regulations or restrictions that might limit the potential locations for the fire station.

Distance from other fire stations: The proximity to existing fire stations is an important factor to ensure efficient coverage and response times across the area.

Available space: The availability of suitable land or buildings that meet the requirements for a fire station, such as accessibility, size, and infrastructure, should be considered.

Ultimately, the decision should take into account a combination of factors, including zoning considerations, distance from other fire stations, and available space. This comprehensive approach ensures that the fire station is strategically located to serve the four neighborhoods effectively and efficiently.

Hence, D. is the correct option.

To know more about Available space here

https://brainly.com/question/20740359

#SPJ4

Which physical adaptations increase an organism's chances of finding food?

the armored plates of an armadillo

the bright black feathers of a male ostrich

the thin, needle-like beak of the hummingbird

the color of grasshoppers

Answers

Hummingbirds have evolved to survive in locations with harsh winters and limited food sources. They do this by lowering their metabolism and entering a dormant state.

How is metabolism carried out?

Metabolic process: converting food into energy. Metabolism is the term used to describe the process by which the body transforms food and liquids to energy. Calories from beverages and foods mix with oxygen during this process to produce the energy the body requires. Even when in rest, a body still needs energy to perform all of its activities.

Is a rapid metabolism beneficial?

Benefits of having a fast metabolism include the ability to burn carbohydrates more rapidly than someone who has a high metabolism. A rapid metabolism might make it challenging to gain weight or maintain a healthy diet, though.

To know more about  metabolism visit:

https://brainly.com/question/29763323

#SPJ1

Other Questions
Can anyone help pls Im struggling on this the joint pow/mia accounting command central identification laboratory (jpac-cil) is known for: Help help help please help I need help Which products are formed when aluminum is added to a silver chloride solution? Use the activity series below if needed. Al > Mn > Zn > Cr > Fe > Cd > Co > Ni > Sn > Pb > H > Sb > Bi > Cu > Ag > Pd >Hg > Pt none only AlCl3 AlCl3 and Ag AlAg3 and Cl2 Studies have found that a large percentage of prisoners have been diagnosed with _____ personality disorder. roast me!!!!!!!!!!!!!!!!!!!!! Farmers cross pumpkins to specifically have a round shape and deep orange color. this has been done to pumpkins since before dna was discovered and therefore, requires no genetic modification in a laboratory. which form of genetic engineering is most likely used by farmers to create pumpkins with a round shape and deep orange color? For a relaxation test, sketch and explain the response of the following models including the initial (elastic) stress and the final stress after a very long time: (a) two springs in parallel b) Maxwell modelPrevious questionNext question Which is remittance advice submitted by medicare to providers that includes payment information about a claim? Terence recently bought a home. He was specifically looking for a full leather sofa for his living room as he reckoned that it would be more durable and comfortable. He also wanted the sofa to be gold in colour, as it will match the rest of his dcor. As such a combination (of a gold and leather sofa) was unusual, Terence has been unable to find such a product thus far. One day, Terence came across a furniture shop owned and operated by a person called Steve, and he asked Steve whether he carried such a product.Steve enthusiastically informed Terence that he does carry such a product. Terence asked Steve, "Is the sofa made with genuine leather?" Steve replied, "Yes, absolutely! The sofa is one hundred percent covered with genuine leather." Steve took out a sample (which is a cutout of about 5cm by 5cm) of the material used to cover the sofa, and showed it to Terence. Steve said, "See, you can feel it for yourself!" Unknown to Steve, Terence was actually an expert on leather products as he sold leather bags in his line of work. Terence inspected the sample material carefully, and confirmed that it was indeed genuine leather.Terence was excited to have finally found his gold-coloured sofa in full leather. He immediately placed an order with Steve. Steve issued a sales invoice to Terence, writing the following words on it: "Full leather sofa (gold look) for $1,000, to be delivered within one week." When the sofa was delivered to Terences home a few days later, he discovered that it was not fully covered in the same leather material. While the front part of the sofa was indeed made with leather, the back of the sofa was made with a synthetic form of leather (called "plastic leather" or "pleather").Compare terms and representations, and explain which category (i.e. term or representation) the statement "The sofa is one hundred percent covered with genuine leather" should be classified. In your answer, you should state and apply the basic test used to distinguish between terms and representations and all the five (5) guidelines from the case law. Information Security professionals in a business need to monitor for hackers both inside and outside the business. Explain how business initiatives may require heightened awareness for attacks by different types of hackers. Provide two specific examples of business initiatives that would require heightened awareness for potential attacks. Provide at least one external reference from your research that supports your claim. What difference between americans and chinese cultures are depicted in this scene? use terms from lecture and text in your analysis. how many terms of the given series must be added to obtain an approximation that is within 0.00001 of the actual sum? The discount rate that makes the NPV of an investment exactly equal to zero is called the Multiple Choice profitable rate of return. IRR. average accounting return. profitability index. risk-free rate. compared with more-developed countries, which of the following statements is true of less developed countries? responses a higher percent of the labor force is engaged in food production . a higher percent of the labor force is engaged in food production . the population pyramids exhibit narrower bases . the population pyramids exhibit narrower bases . the per capita consumption of energy is higher . the per capita consumption of energy is higher . the natural increase of the population is lower . the natural increase of the population is lower . fertility rates are lower . How did immigration influence the industrial revolution and westward expansion? when was the first boat of slaves brought to america Brown v. Board of Education, Topeka removed the concept of "separate but equal" that supported racial segregation. The Supreme Court's decision would change the way states and local governments approached public education. After the decision, schools were no longer allowed to separate students on the basis of race. As a result of the decision, African American children were allowed access to their local public schools and would no longer have to travel across town to segregated schools. This Supreme Court decision helped to give the Civil Rights movement momentum by granting equal access to education for African American students California is known as a biodiversity hotspot. What are twofactors of California that lead to high biodiversity? Brieflyexplain your answer 6 litres of pink paint can be made by mixing 1.5 litres of red paint with the correct amount of white paint.How much white paint is needed