in order for lessons learned to be effective and usable by others a(n) needs to be assigned to assure it is properly documented and understood. question 60 options: stakeholder owner project manager software developer

Answers

Answer 1

In order for lessons learned to be effective and usable by others, a B) project manager needs to be assigned to assure it is properly documented and understood.

Lessons learned are an important part of the project management process as they provide valuable insights and knowledge that can be used to improve future projects. However, for lessons learned to be effective and usable by others, they need to be properly documented and understood.

This is where the role of a project manager becomes crucial. The project manager is responsible for overseeing the project from start to finish and is in the best position to ensure that the lessons learned are properly documented and shared with the relevant stakeholders.

The project manager can work with the team members to identify key insights and ensure that they are captured in a format that is easily understandable and accessible to others.So, b is correct optio.

For more questions like Manager click the link below:

https://brainly.com/question/11599959

#SPJ11


Related Questions

Which descriptions are examples of Facility and Mobile Equipment Maintenance workers?
Check all that apply.
(there’s probably around 3)


Jonathan tests and fixes systems for helicopters.

Angel analyzes ways to improve the flow of traffic.

Sarah cleans and services diesel engines for boats.

Damon loads cargo into ships.
Ariel repairs bicycles for customers.

Heather takes passengers to destinations in a taxi.

Answers

Answer:

1)Jonathan tests and fixes systems for helicopters.

3)Sarah cleans and services diesel engines for boats.

5)Ariel repairs bicycles for customers.

Explanation:

I just put these answers on edge and got them right :)

Answer:

1,3,and 5

Explanation:

Which descriptions are examples of Facility and Mobile Equipment Maintenance workers? Check all that

like time of day, percentage of For the purchase of an airline ticket, a consumer may use on-time departure, brand, and price to choose between offerings. Multiple Choice a) a consideration set b) value attributes c) selective features d) a cognitive cluster e) evaluative criteria

Answers

The correct option is e) evaluative criteria.  A customer can compare options for airline tickets by using "evaluative criteria" such time of day, percent of on-time departures, brand, and price.

Explain about  evaluative criteria in airline?

The standard of airport service is a significant concern in today's fiercely competitive air transportation economy.

In this study, we introduce a flexible multi-criteria decision-making (MCDM) approach for assessing the level of airport service quality.Airlines have typically and historically used unchanging pricing. A restricted number of price points dependent on registration booking designators (RBD) are used by an airline to establish its tariff structure, which is subsequently published through ATPCO. Every pricing point has been created with a particular client segment and market need in mind.There are people who are price-sensitive and will choose the cheapest flight regardless of lengthy layovers since they are not committed to a specific date or timetable. Others need to get somewhere on time and thus will pay everything to go on a certain day.

Thus, a customer can compare options for airline tickets by using "evaluative criteria" such time of day, percent of on-time departures, brand, and price.

To know more about the evaluative criteria, here

https://brainly.com/question/14291357

#SPJ1

The correct question is-

For the purchase of an airline ticket, a consumer may use ________ like time of day, percentage of on-time departure, brand, and price to choose between offerings.

a) a consideration set b) value attributes c) selective features d) a cognitive cluster e) evaluative criteria

What+is+the+portfolio+beta+if+75%+of+your+money+is+invested+in+the+market+portfolio,+and+the+remainder+is+invested+in+a+risk-free+asset?

Answers

Beta of the market potfolio is always 1 and the beta of risk free security is zero.

A market is a composition of systems, establishments, approaches, social relations or infrastructures whereby events have interaction in trade. even as parties might also change items and offerings through barter, most markets depend on sellers providing their items or services to customers in alternate for cash.

A marketplace is an area where consumers and sellers can meet to facilitate the exchange or transaction of goods and services. Markets may be physical like a retail outlet, or virtual like an e-store. other examples include unlawful markets, auction markets, and monetary markets.

Hence if he invest 75% of  portfolio in market porfiolio weighted beta will be 75% of 1 =.75 beta

Balance 25% is invested in risk-free security hence weighted beta  will be 25%*0 =beta 0

Therefore porfolio beta = = .75 (1) + .25 (0) = .75

Learn more about market here:https://brainly.com/question/25754149
#SPJ4

This question is incomplete. Look below for the proper question.

What is the portfolio beta if 75% of your money is invested in the market portfolio, and the remainder is invested in a risk-free asset?

charlotte can produce pork and beans and can switch between producing them at a constant rate. if it takes charlotte 10 hours to produce a pound of pork and 5 hours to produce a pound of beans, what is charlotte's opportunity cost of pork and what is opportunity cost of beans?

Answers

Pork and beans can be produced in Charlotte. Pork has an opportunity cost of 10 pounds of beans divided by 5 equals 2 pounds of beans. 5 pounds of pork, 10 pounds of pork, or 1/2 pound of pork, is the opportunity cost of beans.

The demand for pork drives the demand for market hogs. Retailers create a wholesale demand plan for pork by subtracting an amount from the anticipated pork demand schedule that will cover their expenditures and generate a profit.

2020 saw the COVID-19 have an impact on the pork market. Neither state farms nor small-scale farmers can increase their output. Pork production did not increase and but decreased for the year by 1.42 million tonnes when compared to 2019. The demand for meat eventually exceeds the supply of pork.

Read more about charlotte's opportunity at

https://brainly.com/question/14984601

#SPJ4

One effective strategy for managing credit card debt it to
A. Replace low interest credit cards with higher interest credit cards
B.slightly exaggerate your yearly income when applying for a credit card
C. Pay more than minimum monthly payment to limit accumulating interest
D. Make sure you spend your entire credit limit before making any payments

Answers

Answer:

C hope tha helps

Explanation:

The effective strategy for managing credit card debt is to pay more than a minimum monthly payment to limit the accumulating interest.

What do you mean by credit card?

A credit card refers to a financial instrument that is issued by the banks with pre-set credit limits.

Credit cards impose the condition that cardholders will pay back the money and interest over time.

One effective strategy to manage credit card debt is to pay more than the minimum monthly payment to limit accumulating interest.

Therefore, C is the correct option.

Learn more about credit cards here:

https://brainly.com/question/27350251

#SPJ2

who here from K12? (sorry for asking this question)

Answers

Answer:

Explanation:

Answer:

Not I.

Explanation:

This is just constructive criticism, but I don't recommend listing your school here.

5x - 3y = 8
9 + 7y - 126​

Answers

Answer:

x=7

y=9

Explanation:

:)

you speak to a business owner that is taking in almost $2,000 in revenue each month. The owner still say that they’re having trouble keeping the doors open. How can that be possible? Use the terms revenue, expenses, and profit/ loss in your answer.

Answers

EXPLANATION

Explanation:

a business man with such amount in revenue every month most really be earning high his business must be lucrative. They are having trouble keeping the doors open this can only mean that the expenses made by the business man is higher p than the profit he is gaining, soo he is making a lot of loss for him not to be able to open any doors.

by the way to keep doors open mean to make things move forward now or later in the future/or make things in possible, in the case of this business man he can't move things forward so he is going to or is already suffering from diminishing returns in business. Thank you.

Total sales: $60,230 Rate of commission: 6% on first $40,000
7% on next $10,000;
8% on sales over $50,000
Income: ?

Answers

Answer:

1000000 wdnjdkdidhxh fdjjxifid

budgeting information is multiple choice not confined to finances. found strictly in accounting ledgers. restricted to dollars. inclusive of forecasting. confined to managerial decisions.

Answers

Budgeting information is inclusive of forecasting.

While budgets may include financial data, they can also include non-financial data, such as units produced or employee headcount. Forecasting is an important part of the budgeting process as it allows managers to predict future trends and plan accordingly. By forecasting, managers can make informed decisions about how to allocate resources and adjust operations to meet changing market conditions. Therefore, budgeting information is not strictly confined to finances, but it can include a variety of data points to help inform business decisions.

Learn more about budgeting information here:

https://brainly.com/question/14313102

#SPJ11

Your older sister is planning on saving money by paying her bills, spending money on fun, and then saving whatever is leftover. Why is this not the best option for saving her money?

Answers

Answer:

spend money on bills first then food then save the leftover money for later

Which kind of budget would cause the largest increase in a country's national
debt?
A. One that decreases taxes and decreases spending
B. One that increases taxes and decreases spending
C. One that decreases taxes and increases spending
D. One that increases taxes and increases spending

Answers

Answer: One that decreases taxes and increases spending

Explanation: got it wrong

The kind of budget that would cause the largest increase in a country's national debt is One that decreases taxes and increases spending. Thus the correct option is C.

What is the budget?

A budget refers to making financial planning for the expenses that are going to occur and controlling the spending of an individual. The budget gives an estimate of the expenses.

A tax is a specific sum of money that is taken in by a government from its constituents and afterward used to fund projects like the construction of hospitals, roads, and transit systems, among other things.

A budget that decreases taxes and increases spending helps in lowering unemployment by raising opportunities for employment and increasing the standard of living of people.

Therefore, option C is appropriate.

Learn more about Tax, here:

https://brainly.com/question/16423331

#SPJ7

Which one of the following statements accurately describes FICO?
A.FICO is firm that analyzes data collected by credit bureaus and generates a credit score.
B.FICO is a credit bureau.
C.FICO collects information about your financial dealings involving any sort of loan, debt, or billing.
D. FICO uses your grades and employment information to determine your creditworthiness

Answers

Answer:

c. FICO collects information about your financial dealings involving any sort of loan debt or billing.

FICO collects information about your financial dealings involving any sort of loan, debt, or billing. Thus, the correct answer is option C.

What is FICO?

FICO, formerly Fair, Isaac and Company, is a data analytics business with a focus on credit scoring services that is situated in Bozeman, Montana. Its formal name is Fair Isaac Corporation. In 1956, Bill Fair and Earl Isaac started it. A standard of consumer lending in the US is the FICO score, which measures the risk of consumer credit.

A business can store a complete copy of its financial transaction data because of  FICO. FICO is specifically designed to assist businesses in producing and managing financial statements for analysis and reporting as well as supporting efficient business planning and decision-making.

Therefore, FICO collects information about your financial dealings involving any sort of loan, debt, or billing.

To learn more about FICO, click here:

https://brainly.com/question/13981035

#SPJ6

______ act primarily as in-house advertising agents for the various events booked into facilities.

Answers

Marketing departments act primarily as in-house advertising agents. They promote events booked into facilities.

Marketing departments within organizations serve as the in-house advertising agents for events booked into their facilities. Their primary role is to create promotional materials, develop advertising campaigns, and utilize different channels to reach target audiences. This ensures that events held at the facility receive optimal attendance and exposure. Marketing teams collaborate closely with event organizers, and other internal departments, to gather information about the events and tailor marketing strategies accordingly.

By employing various marketing tools such as social media, email campaigns, print media, and public relations, the marketing department effectively communicates the value of the event to potential attendees. Ultimately, a successful marketing effort by the in-house advertising agents leads to increased attendance, enhanced brand reputation, and positive overall outcomes for both the event and the facility.

To know more about advertising agents visit:

https://brainly.com/question/32147733

#SPJ11

Which one of the following is the most accurate description of a monopolist?
- A large, multinational firm that produces a single product in a narrow product class.
- A sole producer of a product for which good substitutes are lacking in a market with high barriers to entry.
- A sole producer of a narrowly defined product class, such as brown, Grade A eggs produced in Eagle County, Colorado.
- A firm that is very large relative to all its competitors within a narrow product class.

Answers

The most exact definition of a monopolist is a solitary producer of a specifically defined product class, such as Eagle County, Colorado's brown, Grade A eggs.

A monopolist is a person, organisation, or company that totally controls the market for a particular good or service. A monopolist is more likely to be in favour of legislation that makes monopolies stronger since it gives them greater power.

A monopolist is unmotivated to improve their product because there is no rivalry. Instead, their motivation is to keep the monopoly intact. A monopoly develops when one supplier of a certain commodity or service becomes the only one.

A monopsony, in which only one organisation has the power to make purchases of commodities or services, is different from this. Moreover, it contrasts from an oligopoly, which is characterized by a monopoly held by a few suppliers, on a market.

To know more about monopolist:

https://brainly.com/question/14055453

#SPJ4

you are employed as a network administrator of vincent motors. an unreleased blueprint of a new car model of vincent motors has been leaked on the internet. you assume that an intruder must have succeeded in gaining access to your network in order to copy the blueprint. which of the following access control techniques will you use so that such an activity can be detected in the future?

Answers

The control process techniques that can be used so that such an activity can be detected in the future is authentication.

One of the significant management tasks is controlling. In reality, the management function as a whole will be rendered obsolete in the absence of a control process. The administration won't be able to tell whether the plan is being implemented correctly or not, or whether it is operating well. The primary goal of the management process is to ensure that the planned actions within an organization are occurring.

The control process aids managers in assessing the performance level of their individual organizations. The final function of management is control. If other management tasks are properly performed, the controlling function would become obsolete. Control will be necessary when there are any issues with the planned or collection and reporting.

Learn more about control process here:

https://brainly.com/question/13889508

#SPJ4

Checking off tasks as they are completed is which step in creating an effective assignment notebook?
Step 1
Step 2
Step 3
Step 4

Answers

Answer:

Step 2

Explanation:

Answer:

Step 4

Explanation:

Congress has passed laws requiring that a certain percentage of retail gasoline be from ethanol produced from corn. How would this destroy wealth?

Answers

Requiring a certain percentage of retail gasoline to be from ethanol produced from corn would destroy wealth by increasing the cost of gasoline and distorting the market for both gasoline and corn.

Mandating the use of corn-based ethanol would create an artificial demand for corn, which would increase the price of corn and other products that use corn as an input. This would lead to higher prices for food, livestock feed, and other consumer goods.

Furthermore, using corn-based ethanol as a fuel source is less efficient than using gasoline, which means that consumers would need to use more fuel to travel the same distance. This would result in higher fuel costs for consumers and reduce their overall purchasing power. The mandate would limit consumer choice and discourage innovation in the energy sector by favoring a particular type of fuel over others.


To know more about the Gasoline, here

https://brainly.com/question/30357395

#SPJ4

When making decisions, managers often must decide between doing what is beneficial for the firm in the short term, and what is beneficial for both the firm and society in the long term. To address this conflict, a firm must

Answers

When making decisions, managers are often faced with a conflict between what is beneficial for the firm in the short-term and what is beneficial for both the firm and society in the long-term.

This conflict arises because the actions that benefit the firm in the short-term may not necessarily align with the interests of society as a whole, which can lead to negative consequences for both the company and society in the long-term.

To address this conflict, a firm must adopt a long-term orientation and consider the broader social and environmental impacts of its decisions. This means looking beyond immediate financial gains and recognizing that actions taken today can have far-reaching implications for the company's reputation, customer loyalty, employee morale, and overall sustainability.

Firms that prioritize social responsibility and sustainable business practices are more likely to build strong relationships with stakeholders, including customers, employees, investors, and regulators. They are also better equipped to weather economic downturns and other disruptions, as they have diversified their risk and invested in building resilient supply chains and communities.

Ultimately, the key to addressing the conflict between short-term gains and long-term benefits is a commitment to corporate social responsibility (CSR) and sustainable business practices. By prioritizing the needs of society and the environment alongside those of shareholders, firms can create value for all stakeholders over the long-term, ensuring their continued success and impact.

learn more about managers here

https://brainly.com/question/32150882

#SPJ11

commercial banks hold deposits and

Answers

Anddd??? What?? You just typed and stopped midway lol
? Umm I don’t get it

When performing a large company's audit of internal controls (ex. Tech company), what are some controls you think would be relevant to the audit for revenues and receivables? What are the elements involved in obtaining an understanding of Internal Controls.? What tests are performed and what are the procedures testing management's assertions when looking at revenue and receivables.

Answers

Obtaining an understanding of Internal Controls involves examining various documents, procedures, and policies put in place by the company. It may include examining the control environment, identifying the risks, understanding the internal controls in place, and testing the effectiveness of these controls.

When performing a large company's audit of internal controls for revenues and receivables in the tech company, some controls that would be relevant to the audit include the existence of authorized and approved credit policies and procedures, existence of a system for accounts receivable, ensuring completeness, accuracy and validity of revenue, segregation of duties for all procedures and authorization for transactions. Test performed when looking at revenue and receivables include inquiries of management, analytical procedures, and inspection of the relevant documents. Procedures testing management's assertions when looking at revenue and receivables include examining transactions and documents, performing substantive analytical procedures, confirming the existence of accounts receivable and obtaining an understanding of the credit policies and procedures.

To learn more about Internal Controls, visit:

https://brainly.com/question/32706197

#SPJ11

Which of these would be most likely to be included in CPI

Answers

Answer:

Frozen Pizzas

Explanation:

Info from the video:

"To calculate this index, the US Bureau of Labor Statistics uses a predetermined fixed basket of goods and services and averaging them together. The goods and services in this basket are developed from a survey of expenditures provided by individuals and families in a typical urban household."

Frozen pizza is an expenditure that could be bought by individuals and families in a household.

If you know a brand so well that you use its trademark name to describe all similar products, you are
exhibiting...
A. Brand Awareness
B. Brand Loyalty
C. Promotion Awareness
D. Promotion Susceptibility

Answers

Answer:

I think It's A. and C. or D. but I really think it's D. actually .

from 1981 to 2001, which change was most likely happening in the us economy? a decrease in spending by consumers an increase in the number of workers an increase in spending by consumers an increase in government intervention in the economy

Answers

Answer:

C

An increase in spending by consumers

Explanation:

From 1981 to 2001, The change that was most likely happening in the US economy is an increase in spending by consumers. Thus, option third is correct.

What is a kind of economy in U.S.?

The United States has a mixed economy, which includes components of the command and market economic models. In terms of consumer products and corporate services, the US economy is a free market.

Although the US economy is currently one of the most stable in the world, consumer spending increased between 1981 and 2001. There are several economic systems in operation around the world. Socialism, communism, and capitalism are a few instances. The United States operates under a capitalist framework.

And in economics, when there is public spending, there is a positive impact in the economy. Therefore, it can be concluded that option third is correct.

Learn more about US economy here:

https://brainly.com/question/9296500

#SPJ6

which manager designs the product in a business​

Answers

It is a product design manager

Answer:

Product Design Management (PDM)

Explanation:

Product Design Management (PDM) is one of the most important elements in the successful business of designing innovative products for production.

, the store manager, recently had to fire Susan, an employee who graduated from Hogwarts University. She felt that Susan was not well trained at her school. So when Severo, also a graduate from Hogwarts, applied for Susan's old position, Ivy did not want to consider hiring him, feeling Severo also probably did not receive the proper training. Ivy was affected by ________ bias.

Answers

Ivy, the store manager, was affected by the Halo effect bias when considering hiring Severo, another Hogwarts University graduate, for Susan's old position.

The Halo effect bias refers to the tendency to generalize a positive or negative impression of someone based on a single trait or characteristic. In this case, Ivy's negative perception of Susan's performance influenced her judgment of Severo, assuming that he would likely have similar deficiencies in training as well.The bias occurs because Ivy is relying on a stereotype or generalization based on her experience with one individual, Susan, to form an opinion about another individual, Severo.

However, it is important to recognize that individuals are unique and should not be judged solely based on their association with a particular school or institution. Ivy's decision not to consider hiring Severo solely due to his association with Hogwarts University demonstrates the Halo effect bias in action, potentially overlooking a qualified candidate based on a single negative impression.

To know more about  Halo effect click here

brainly.com/question/14739328

#SPJ11

A trading company acts like a ______, taking on much of the responsibility of finding markets while facilitating all marketing aspects of a transaction.

Answers

A trading company acts like a wholesaler

Financial managers are in charge of
what kind of planning, making sure that
the company is in good standing with
the government in terms of finances?
A. estate
B. venture
C. tax

Answers

Tax. Financial managers are responsible for developing and implementing plans for the effective use of the organization's financial resources, including tax planning.

What do you mean by tax?

Tax is the money that individuals and businesses are required to pay to the government, usually at regular intervals, in order to fund public services and other government activities. Taxes are typically based on income, property, or the value of goods and services.

Tax planning is an important part of a financial manager's job. It involves analyzing the company's financial situation and determining the best way to structure its taxes in order to minimize its tax liability. This includes making decisions about which deductions and credits to take advantage of, when to file tax returns, and how to structure investments and other transactions to reduce the company's tax burden. A financial manager must also be aware of local, state, and federal tax laws and regulations to ensure compliance. By properly managing the company's taxes, the financial manager can help the organization maximize its profits and reduce its overall tax burden.

Hence, option C is correct.

To know more about tax,

https://brainly.com/question/30157668

#SPJ1

What is NOT an advantage of being an entrepreneur?

Answers

Answer: Disadvantages include a lack of guarantee of success and the heightened responsibility of owning a business

Answer:

The advantages of entrepreneurship include the ability to shape one's own business, control of one's own working habits, and significant stock in the venture. Disadvantages include a lack of guarantee of success and the heightened responsibility of owning a business.

Explanation:

Now, working on your own, you will get a chance to practice the basic business communication skills we have covered so far. Use all the techniques learned so tar in this course to write a clear, professional message Use the writing process. Think about your audience and their questionsmeeds, then plan and write a draft. Then take 30 minutes to 1 hour to revise and proofread, ensuring your work demonstrates your understanding of the content we've covered in the course so far 1. Read the scenario below. 2. Write the email message called for in the situation described, using reader-focused language and a professional tone Make up any details necessary, as long as they are consistent with this case use your own words and include the relevant details . Decide which wording is appropriate for the message and which wording and aspects of the scenano to leave out • If you want to ensure you use the "direct approach correctly, you can use the optional planning sheet in this module to plan your message (do not sand this plan sheet in, please) In your Word document • Include an email "header at the top with the fields your email program creates for you (To, From Date Subject CC, Attachment) For readability, use a direct opening with the "Main Idea First • Be concise, and use at least one list (bullets), headings, and white space as "reader access techniques • Include a closing (e.g. "Thank you," "Sincerely," "Best regards.") and your name and "signature" (usually your name plus your position department and possibly your contact info beneath) under your final "action paragraph" • Save your document as an MS Word document

Answers

Subject: Confirmation of meetingDear [Name],I am writing to confirm our meeting scheduled for tomorrow at 2:00 pm at the headquarters of our organization. I look forward to meeting you personally and the purpose of the meeting is to finalize the agreement on the upcoming project to be launched next month.

I appreciate your time and commitment towards this project and it will be a great opportunity to finalize the agreement and move forward. The meeting is expected to last about an hour, but the time could be extended if needed.In the meeting, I would like to go over the timeline of the project, along with the budget and other essential details that are required to be finalized before the project can be initiated. I will be accompanied by [Name], who will be responsible for implementing the project. In the meantime, please feel free to contact me with any queries or questions that you might have. I will be more than happy to assist you.I am looking forward to meeting you tomorrow. Thank you for your time and attention, and I look forward to a successful partnership in the future.Best regards,[Your Name]

Therefore, in this email, the writer confirmed the meeting scheduled for tomorrow at 2:00 pm at the headquarters of their organization and expressed their enthusiasm to meet the receiver in person. They provided details about the purpose of the meeting, its duration, and the details to be discussed during the meeting. The writer also gave assurance of their assistance with any queries or questions that the receiver might have. Lastly, they expressed their gratitude for the receiver's time and attention and looking forward to a successful partnership in the future. The email ends with the writer's name and signature beneath the final "action paragraph."

To know more about meeting visit:

brainly.com/question/14866702

#SPJ11

Other Questions
y = 2x + 4 and y = 3x+ 2 The peak current through a capacitor is 20.0mA . Part A: What is the current if the emf frequency is doubled?Part B: What is the current if the emf peak voltage is doubled (at the original frequency)?Part C: What is the current if the frequency is halved and, at the same time, the emf is doubled? If you bought one share (stock) of XYZ company for $100, and later sold it for $145. What is your profit assuming the stock paid no dividends and that you did not incur any fees during that time period (from the purchasing of the stock to the selling of the stock)? write a loop that reads positive integers from console input, printing out those values that are greater than 100, and that terminates when it reads an integer that is not positive. the printed values should be separated by single blank spaces. declare any variables that are needed. Care to help me guys please Visit the Fed's Summary of Commentary on Current Economic Conditions (Links to an external site.), also known as the Beige Book. Prepare a proposal recommending monetary policy actions designed to correct problems with spending, employment, and prices. Defend your choices.1 paragraph Why do we NEED to study the Constitution? Given the DNA sequence and three restriction enzymes (Hindill, Pstl and BamHI), write out the sequence of the digestion products for both DNA strands when the DNA sequence is subjected to digestion by a mixture of three restriction enzymes? 5 CTGTTACTGCAGCTAACGTGGATCCGGTCAATCTTCA 3 Restriction recognition sequences (1 - the cleavage site): Hindiri 5-A|AGCTT-3 3-TTCGA|A-5 BamHI 5-G|GATCC-3 3-CCTAG|G-5 Pst! 5-CTGCA G-3' 3-G|ACGTC-5 which feeding strategy is when organisms use specifcally designed structures to filter plankton from seawater PLEASE HELP ME WITH this question I need help a number one through four could you also explain how you got the answer thank you the person with the best answer will get BRAINLY !!!!!!!20 POINTS Will Fed decrease interest rates? Common factors that influence how a patient reacts to the stress of an illness or injury include all of the following, EXCEPT:Select one:A. distrust of the EMT.B. mental disorders.C. history of chronic disease.D. fear of medical personnel. 6. A and B are partners sharing profits in the ratio of 2:3. They admit C for 1/4th share in the business. The sacrificing ratio of A and B is: (A) 3:1 (B) 1:4 (C) 2:3 (D) 1:1 ow does the energy that you calculated in a. qualitatively compare with the free energy that is actually required for this reaction (more/less energy input/output) and why? What is something that most buildings dedicated to religious worship have in common? Frogs frequently frolic in fresh water ellen suffered a severe viral infection during her fourth month of pregnancy that caused her baby to be born with an abnormal heart valve. in this instance, the virus was clearly a simplify log10^8-log10^4 The map shows the geographic region of ancient Egypt.Which body of water is the arrow pointing to on the map?Red SeaArabian SeaIndian OceanMediterranean Sea TRUE / FALSE. assuming that pages are 128 integers (words) in size, consider the c program to initialize every element of a 128x128 integer array to zero.