In an accretion/dilution analysis of an acquisition, if the
purchase price exceeds the book value of the target’s assets,
discuss the key components of the balance sheet that will be
adjusted on the

Answers

Answer 1

In an accretion/dilution analysis of an acquisition, when the purchase price exceeds the book value of the target's assets, several key components of the balance sheet will be adjusted to account for the difference.

These adjustments are made to reflect the impact of the acquisition on the financial position of the acquiring company. The key components that will be adjusted include:

Goodwill: Goodwill represents the premium paid by the acquiring company over the book value of the target's net assets. When the purchase price exceeds the book value, goodwill is created to account for the intangible value of the target's brand, customer relationships, or other factors that contribute to its earning power.

Assets: The fair value of the target's tangible and intangible assets will be reassessed and adjusted. This includes adjustments to property, plant, and equipment, patents, trademarks, or any other identifiable intangible assets.

Liabilities: The target's liabilities, such as loans, debt, and contingent liabilities, will also be reassessed and adjusted based on their fair value. This ensures that the acquiring company reflects the true obligations it assumes as a result of the acquisition.

Equity: The target's equity accounts, including retained earnings and any other capital accounts, may be adjusted to align with the fair value of the acquired assets and liabilities.

By making these adjustments, the acquiring company can accurately reflect the financial impact of the acquisition on its balance sheet. This helps in determining the accretion or dilution effect on key financial metrics such as earnings per share and return on investment. Adjusting the balance sheet components is crucial in providing a comprehensive and accurate picture of the financial position of the combined entity after the acquisition.

Learn more about assets here

https://brainly.com/question/25746199

#SPJ11


Related Questions

Year to date, Company Y had earned a 10.8 percent return. During the same time period, Company R earned 12.20 percent and Company C earned −1.56 percent. If you have a portfolio made up of 45 percent Y, 35 percent R, and 20 percent C, what is your portfolio return?

Answers

Answer:

8.82%

Explanation:

The computation of the portfolio return is shown below:

Portfolio return = Respective returns ×Respective weights

= (10.8 × 0.45) + (12.2 × 0.35) + (-1.56 × 0.20)

= 8.82%

Hence, the portfolio return is 8.82%

We simply applied the above formula so that the portfolio return could come

And, the same is to be considered

This is my last question plzzzz get it right

Museum curators are in a tourism career.

A. True

B. False

Answers

Answer:

false

Explanation:

Which one of the following best describes the role of a financial intermediary? O Financial intermediaries collect large surpluses from a few suppliers of capital and lend those funds in small amounts to numerous demanders of capital.O Financial intermediaries match suppliers of capital with demanders of capital so they can directly exchange funds.O Suppliers of capital are hesitant to individually accept the credit risk associated with lending to demanders of capital.O Demanders of capital normally need funds for a short period of time.

Answers

O Suppliers of capital are hesitant to individually accept the credit risk associated with lending to demanders of capital.

If we knew the old and new values of the quantities of the optimal bundles, which elasticities could we calculate? Choose all that are correct: A.Income elasticity of demand for pens B.Cross price elasticity of demand for pens (in response to a price change of books) C.Price elasticity of demand for books D.Income elasticity of demand for books E.Price elasticity of demand for pens F.Cross price elasticity of demand for books (in response to a price change of pens)

Answers

If we knew the old and new values of the quantities of the optimal bundles, we could calculate the following elasticities: A. Income elasticity of demand for pens

D. Income elasticity of demand for books

E. Price elasticity of demand for pens

To calculate the income elasticity of demand for pens and books, we need to know the change in quantity demanded of each good in response to a change in income, which we can derive from the old and new optimal bundles. The income elasticity of demand measures the responsiveness of quantity demanded to a change in income.

To calculate the price elasticity of demand for pens, we need to know the change in quantity demanded of pens in response to a change in their price, which we can derive from the old and new optimal bundles. The price elasticity of demand measures the responsiveness of quantity demanded to a change in price.

We cannot calculate the cross-price elasticity of demand for pens or books using only information about changes in the optimal bundles, as this requires information about changes in the prices of other goods. Therefore, options B and F are not correct. Similarly, we cannot calculate the price elasticity of demand for books, as this requires information about changes in the price of books, which we do not have. Therefore, option C is not correct.

Learn more about Income elasticity here

https://brainly.com/question/29564308

#SPJ4

true/false. the mirror-image rule says that terms of an acceptance can slightly be changed in order to benefit both parties.

Answers

This statement is False. The mirror-image rule states that an acceptance must exactly mirror the terms of the offer for a valid contract to be formed. Any changes or modifications to the terms of the offer would constitute a counteroffer, rather than an acceptance.

The mirror-image rule ensures that there is a meeting of the minds between the parties involved, as both parties must agree to the same terms and conditions of the offer.

Deviating from the terms of the original offer would introduce new terms or conditions, potentially altering the agreement and requiring further negotiation or acceptance.

Therefore, the mirror-image rule emphasizes the importance of maintaining the integrity and consistency of the original offer in order to establish a valid and enforceable contract.

Learn more about the mirror-image rule here:- brainly.com/question/32262129

#SPJ11

.. If two variables have a direct relationship on a graph, it indicates that
A. both variables are not related.
B. as one variable rises, the other variable falls.
C. both variables are moving in the same direction.
D. as one variable rises, the other variable is constant.

Answers

Answer:

Option C. Both variables are moving in the same direction.

Explanation:

The reason is that in the direct relationship, the variables move in the same direction which means if one of the variable increases then the other will also increase and vice versa. So the only option that satisfies this condition is option C.

All of the following are lagging economic indicators except:
a building permits
b corporate profits
c commercial loans outstanding
d employment duration

Answers

All of the following are lagging economic indicators except  corporate profits

What is  corporate profits?

A corporate tax, also known as a corporation tax or a business tax, is a direct tax levied on the profits or capital of corporations or similar legal entities. Many countries levy such taxes at the national level, and a comparable tax may be levied at the state or local level.

Corporate profits are the portion of total income produced from current output that is accounted for by corporations in the United States.

Profits are deposited in the corporation's retained earnings account, but they are not obligated to be distributed to stockholders. The corporation's board of directors makes the decision to allocate profits.

To know more about  corporate profits follow the link:

https://brainly.com/question/882446

#SPJ4

needs refer to a person's relationship with other people

Answers

Answer:

Sure what do you need :)

Explanation:

What led to the belief that anterior thalamus plays an important role in emotion? Choose the correct option. The observation that a lesion in the anterior thalamus led to spontaneous laughing and crying The observation that tumors in the anterior thalamus led to fear, irritability, and depression The observation that the anterior thalamus is affected by the virus responsible for rabies The observation that the anterior thalamus governs the behavioral expression of emotion

Answers

The correct option is: The observation that a lesion in the anterior thalamus led to spontaneous laughing and crying.

The belief that the anterior thalamus plays an important role in emotion is primarily based on the observation that a lesion or damage to this brain region can lead to spontaneous outbursts of laughter and crying. This observation suggests that the anterior thalamus is involved in the regulation of emotional expression.

Such emotional disturbances resulting from anterior thalamic lesions have been reported in medical literature and observed in clinical studies. These findings have contributed to the understanding that the anterior thalamus plays a significant role in the modulation of emotional behavior.

Learn more about anterior thalamus here:

https://brainly.com/question/31839936

#SPJ11

The financial system provides key services to the economy, including a. Lower inflation, lower unemployment, higher earnings, and a more equal distribution of the economy's output. b. diversification of risk, liquidity (quick \& cheap movements of funds), and information about the highest values uses of savings C. locking in long-term commitments of funds by savers so they can't back on financial agreements. d. allowing borrowers to have funds for a short a period as possible:

Answers

The financial system offers services such as risk diversification, liquidity, and information about investment opportunities. These services contribute to a well-functioning economy, promoting stability, flexibility, and informed decision-making.

The financial system plays a crucial role in the economy by providing key services. One of these services is the diversification of risk, which allows individuals and businesses to spread their investments across different assets, reducing the impact of any single investment's performance. For example, investing in a mix of stocks, bonds, and real estate can help minimize risk.
Another service is liquidity, which refers to the quick and cheap movement of funds. This enables individuals and businesses to easily access their money when needed, providing flexibility and facilitating economic transactions. For instance, a person may need to withdraw money from their savings account to cover unexpected expenses.
Additionally, the financial system provides information about the highest value uses of savings. This information helps individuals and businesses make informed decisions about where to invest their money to achieve maximum returns. For instance, individuals can use financial data to determine which stocks or bonds are likely to generate the highest earnings.
In summary, the financial system offers services such as risk diversification, liquidity, and information about investment opportunities. These services contribute to a well-functioning economy, promoting stability, flexibility, and informed decision-making.

To know more about financial system visit :

https://brainly.com/question/32708260

#SPJ11

The financial system provides services such as risk diversification, liquidity, information about investment opportunities, long-term commitments for savers, and short-term financing for borrowers. These services contribute to the overall functioning and stability of the economy.

The financial system plays a crucial role in the economy by providing key services. One of these services is the diversification of risk, which allows individuals and businesses to spread their investments across different assets.

This helps reduce the impact of any single investment performing poorly.

Another service provided by the financial system is liquidity, which refers to the ability to quickly and cheaply move funds. This allows for efficient allocation of capital and facilitates economic transactions.

The financial system also provides information about the highest value uses of savings. For example, it helps individuals and businesses identify profitable investment opportunities, which can lead to higher earnings.

Additionally, the financial system allows savers to lock in long-term commitments of funds. This ensures that they cannot back out of financial agreements and helps provide stability to the economy.

Lastly, the financial system enables borrowers to have funds for a short period as possible. This can be beneficial for businesses and individuals who need short-term financing for various purposes.

In summary, the financial system provides services such as risk diversification, liquidity, information about investment opportunities, long-term commitments for savers, and short-term financing for borrowers.

These services contribute to the overall functioning and stability of the economy.

to learn more about financial system

https://brainly.com/question/32708260

#SPJ11

Davidson company has sales of $100,000, variable cost of goods sold of $40,000, variable selling expenses of $15,000, variable administrative expenses of $5,000, fixed selling expenses of $7,000, and fixed administrative expenses of $9,000. What is davidson’s contribution margin?.

Answers

Davidson’s contribution margin for the sale of goods would be : $40,000

What is contribution margin?

Contribution margin is a business' sales revenue less its variable costs. The resulting contribution margin can be used to cover its fixed.

Contribution margin is computed as:

= Sales - Total variable cost(Variable cost of goods sold + Variable selling expenses + Variable administrative expenses)

= $100,000 - ($40,000 + $15,000 + $5,000)

= $100,000 - $60,000

= $40,000

Therefore, Davidson’s contribution margin for the sale of goods would be $40,000

Learn more about contribution margin here : https://brainly.com/question/24309427

what can occur for project activities on a critical path that include slack time? more than one answer may be selected.

Answers

b) 'They can be completed after the project end date' and d) 'They need to be completed before other activities on the critical path' can occur for project activities on a critical path that include slack time.

Activities on the critical path are the ones that directly impact the project's overall duration. Slack time refers to the amount of time an activity can be delayed without causing a delay to the project's completion date. If an activity on the critical path has slack time, it means that it has flexibility in its schedule.

Given the nature of activities on the critical path and their impact on the project timeline, the following scenarios can occur for project activities with slack time:

b) They can be completed after the project end date: Activities with slack time can be delayed without affecting the project's completion date. This flexibility allows for adjusting the schedule to account for unforeseen delays or resource constraints.

d) They need to be completed before other activities on the critical path: While activities on the critical path have slack time, they still need to be completed before subsequent activities can begin. The critical path represents the longest sequence of dependent activities that determines the project's minimum duration. Completing activities on the critical path is crucial to maintain the project's timeline.

Regarding the other options:

a) They can be allocated fewer resources: This statement is not necessarily true. Activities on the critical path usually require sufficient resources to be completed within the planned time. Reducing resources may impact their timely completion and potentially affect the project's overall schedule.

c) They can be deemed a lower quality: Slack time does not necessarily imply lower quality for activities on the critical path. Quality standards should be maintained irrespective of the availability of slack time. The focus is on meeting the project's objectives and timeline while delivering the expected level of quality.

Hence, the correct answers are b) 'They can be completed after the project end date' and d) 'They need to be completed before other activities on the critical path'.

Correct Question :

What can occur for project activities on a critical path that include slack time?

More than one answer may be selected.

a) They can be allocated fewer resources.

b) They can be completed after the project end date.

c) They can be deemed a lower quality.

d) They need to be completed before other activities on the critical path.

To learn more about critical path here:

https://brainly.com/question/30664061

#SPJ4

which of the following includes all natural resources used in the production of goods and services? multiple choice question. entrepreneurship labor land capital

Answers

Land, labor, and capital (natural resources, entrepreneurialism, and human capital) (constructed inputs such as factories).

What are production and examples?

In its most basic form, it often made reference to a manufacturing line or its result. Economists define producers as companies that produce goods and services. These companies manufacture products that they sell to customers. For illustrate, a clothing company produces clothing for clients.

What characteristics define production?

In economics, the inputs needed to produce products are often to as manufacturing factors. The factors that affect entrepreneurship include land, people, capital, etc. The four elements comprise the resources required to create a good or service, as defined by a country's gross domestic product (GDP).

To know more about Production visit:

https://brainly.com/question/16755022

#SPJ4

The complee question is-

Which of the following are factors of production?

a. The outputs generated by the production process transforming land, labor, and capital into goods and services

b. Resources restricted to the land, such as natural resources that are unimproved by human economic activity

c. Land (natural resources), labor (human capital, entrepreneurship), and capital (constructed inputs such as factories)

d. Just labor and capital in industrialized countries, where natural resources are no longer used to produce goods and services

According to the law of large numbers, what happens as the number of exposure units increases?
A) Actual results will increasingly differ from probable results.
B) Actual results will more closely approach probable results.
C) Nondiversifiable risk will decrease.
D) Objective risk will increase.

Answers

According to the law of large numbers, as the number of exposure units increases, actual results will more closely approach probable results.  Actual results will more closely approach probable results.

This means that the more data or trials that are collected, the closer the results will be to the expected or probable outcome. This law is a fundamental principle in insurance and probability theory, which states that as the number of independent trials increases, the actual results will converge towards the expected or probable results. In the context of insurance, it means that as the number of insured individuals or policies increases, the actual losses experienced by the insurer will approach the expected losses predicted by actuarial analysis. The law of large numbers is used by insurance companies to manage risk and ensure that they have adequate reserves to cover future claims.

Learn more about probability theory and insurance here:https://brainly.com/question/30465101

#SPJ11

Years ago, American Express created the Gold Card for affluent customers. In response to recent declines, AmEx has decided to enhance the benefits of having a Gold Card by increasing the rewards and offering personalized services. This is an example of:

Answers

Based on the given scenario with Amex enhancing the benefits of having a Gold Card, this is an example of invention.

What is Invention?

This refers to the creation of new things with the aim of making a process easier that has not been done before.

Hence, we can see that based on the changes made by American Express in their Gold Card for their affluent customers and the increased benefits, this is an example of an invention.

Read more about inventions here:

https://brainly.com/question/17931211

employees rarely arrive and leave exactly on the quarter hour so it would make sense to round employee arrival times to the nearest quarter hour?
A. False
B. True
Please be right

Answers

false !!!!!!!!!!!!!!!!!
it is false for sure

Which of the following is true regarding stock options?
A. A loss is realized when stock options lapse. B. There is typically no tax effect on the grant date. C. Income recognized on the exercise date is greater for incentive stock options than nonqualified options.D. The bargain element on a nonqualified option is taxed to employees at capital gain rates

Answers

Answer: I would say b

Explanation: I search it up and this is what it told me

carmeria has an unwavering belief in her new start-up company. she possesses intense focus and takes unconventional risks to make her new company successful. these examples most closely relate to which personality trait of entrepreneurs?

Answers

Carmeria's personality traits align with the conception of entrepreneurial self efficacy.This personality particularity refers to a person's belief in their capability to successfully start organize, and manage a new business adventure.

Carmeria's unwavering belief in her startup company demonstrates her confidence in her capability to make it successful. Her violent focus on her startup company suggests her goodwill to conduct her energy and finances to achieve her objectives. Also her goodwill to take unconventional troubles demonstrates her confidence in her capability to manage.

To overcome the challenges that come with starting a new business. Overall Carmeria's personality exhibits a strong sense of entrepreneurial self efficacy.

To learn more about Self Efficacy:

https://brainly.com/question/10575222

#SPJ4

Arrange the following revenues in the federal government, from greatest to
least.
Drag each item to put them in the correct order.
(2 points)
= excise taxes
= Social Security and Medicare taxes
= corporate income taxes
= individual income taxes
= customs duties
= miscellaneous revenue

Answers

Individual income taxes
Social Security and Medicare taxes
Corporate income taxes
Excise taxes
Custom duties
miscellaneous revenue

Why is strength an internal force

Answers

Answer:

Because it comes from within the person.

Explanation:

In business, we learn about the concept of internal force and external force as two factors that could influence the outcome of a certain event.

External forces are the type of influences that come from our environment. Generally, it's not something that we can control. We have to make proper adaptation to address the external forces to prevent it from ruining our goals.

Example of External Goals : Natural disaster, Future laws made by the government, etc.

Internal forces on the other hand are the type of influences that come from within ourselves as a person. It is something that we can control and constantly thrive to improve in order to make it easier for us to achieve our goals.

Example of internal goals: Strength, Emotional stability, Motivation, etc.

As the CEO of your company, you can use only the planning and controlling functions to reach your organizational goals.
Select one:
O True
O False

Answers

Answer: False

Explanation:

CEOs are top management and top management use all five functions of management to ensure that the company reaches its goals and objectives.

The CEO has to use planning to to decide what long term strategies the company will use to achieve its goals. They have to use controlling to evaluate and improve the methods the company is taking to achieve its long term goals.

They also have to use staffing to hire the best top level and middle level talents that can push the company forward. As management they have to use leading to get the employees inspired to move the company forward and finally they will use organizing to put the various processes in the company together to ensure that the company's goals are met.

Fireeye is a security company that protects its clients against ________ that are sophisticated, possibly long-running computer hacks often perpetrated by large, well-funded organizations.

Answers

Fireeye is a security company that protects its clients against advanced persistent threats (APTs) that are sophisticated, possibly long-running computer hacks often perpetrated by large, well-funded organizations.

APTs are particularly dangerous because they are designed to evade traditional security measures and gain access to a network, often remaining undetected for long periods of time.

Fireeye uses advanced technologies and techniques such as threat intelligence, machine learning, and behavioral analysis to detect and mitigate these threats. The company also provides incident response services to help clients recover from attacks and strengthen their defenses.

In today's digital landscape where cyber attacks are becoming increasingly common and sophisticated, Fireeye plays a crucial role in protecting its clients against APTs and other security threats.

To know more about advanced persistent threats visit:

https://brainly.com/question/31607497

#SPJ11

critically discuss how career and study choices are influenced by the following socio-economic factor: availability of finances/affordability​

Answers

Answer:

availability of financial/affordability

Explanation:

it's enables you to make more money for the growth of the community so we study it that way

Which government agency would be responsible for testing for leaded paint
in imported toys from China?
A. Consumer Product Safety Commission
B. Environmental Protection Agency
C. Food and Drug Administration
O
D. Federal Trade Commission

Answers

Answer:

A. Consumer Product Safety Commission

Explanation:

When the high lead levels were detected during a routine inspection, the Consumer Product Safety Commission (CPSC) issued a recall, the first for a lead-contaminated toy in 2007.

Consumer Product Safety Commission, government agency would be responsible for testing for leaded paint in imported toys from China. Thus, option (a) is correct.

What is a government agency?

A permanent or semi-permanent organization inside the federal or state government is referred to as a government agency. Federal agencies are specialized government institutions created for a particular function, such as resource management, financial regulation of specific sectors, or matters of national security.

On October 24, 1972, the Consumer Product Safety Commission was founded. The Consumer Product Safety Commission (CPSC) issued a recall after the excessive lead levels were found during a routine inspection, the first for a lead-contaminated toy in 2007. The CPSC works to reduce "unreasonable risks" of harm in order to advance the safety of consumer products.

As a result, the conclusion of the Consumer Product Safety Commission is a government agency. Therefore, option (a) is correct.

Learn more about on government agency, here:

https://brainly.com/question/31115038

#SPJ2

Which of the following best describes intellectual property theft?
A. Stealing money from a cash register
a
B. Stealing ideas, information, or creative products
C. Stealing supplies from your employer
D. Stealing music CDs from a store

Answers

Answer:

stealing ideas,information, or creative products

Explanation:

Answer:

B. Stealing ideas, information, or creative products

Explanation:

What are some changes that have happened in society that have affected the growth of the childcare profession?
Include one change from each area:

• employer

• Education attitudes

• Educational studies

• Benefits to the economy

Answers

Answer:

More mothers would increase their earnings and seek new job opportunities if they had greater access to reliable and affordable child care.

in recent years, the wall street journal has indicated that many companies have changed their accounting principles. what are the major reasons why companies change accounting methods?

Answers

Significant explanations for business accounting technique changes include:

goal to enhance CF by a reduction in income taxes, desire to show a better profit image, and desire to follow industry practices

Why would a business modify its accounting procedures?

You can improve your ability to evaluate your company's tax health and increase the efficacy of your tax strategy by changing the way your company does its accounting. The adjustment might give you a way to take advantage of potential tax breaks and keep more money in your pocket.

What justifies businesses' preference for particular accounting techniques?

Due to capital structures, political costs, bonus payouts, and a need to smooth earnings, businesses favor specific accounting techniques. Depreciation expense must be recorded in a certain year in order to: by displaying pro forma statistics.

Learn more about accounting techniques: https://brainly.com/question/28428858

#SPJ4

What are some of the advantages of incorporating?
A. All businesses are required by law to incorporate.
B. Business owners are protected from liability and lawsuits.
C. Incorporation is the least expensive business structure.
D. Incorporation makes a business more likely to succeed.

Answers

24. When documenting animal data, what is typically not included in the record?


pedigree
breeding plan
weight
estimated lifespan

Answers

the answer is most likely breeding plan. i may be wrong though. hope this helps

What are the advantages of working for a salary? Check all that apply.

In general, you will earn more than an hourly wage worker.
Whether you work 35 or 40 hours in a given week, your paycheck will be the same.
If you work more than 40 hours for several weeks in a row, your paycheck will increase.
Your employer must pay you the federal or state minimum wage.
You can easily budget your earnings for the year, knowing that your pay will be steady.

Answers

Explanation:

all of the above except if you work more than 40 hours for several weeks your paycheck will increase .This is False

Answer: its a,b, e

Explanation:

-In general, you will earn more than an hourly wage worker.

-Whether you work 35 or 40 hours in a given week, your paycheck will be the same.

-You can easily budget your earnings for the year, knowing that your pay will be steady.

Other Questions
What are a least 2 problems America was facing in 1780? At current sales revenue of $2,400, total variable costs are $960 and total fixed costs are $900. Your boss gave you a profit target of $1,800. How much do you need to sell in dollars to meet this profit target . who is credited with first realizing that intelligence may actually increase as we get older? bayley gardner spearman terman 1. Given the double-stranded stretch of DNA below, determine the base sequence ofmessenger RNA strand produced using this gene as the template. *Hint: Only one of thetwo strands is used as the template.5'ATGCCATTGCTTAAGCGGGCATTATATCCAAGA 3'3' TACGGTAACG AATTCGCCCGTAAT ATGGTACT 5AUGCCAUUGCUU AAG-CGG-GCAULAUAU CCA UGAHow many amino acids will this protein contain? ~.~Please Answer~.~ A sequence has an explicit formula a n =12n+3 . What is term a in the sequence? A mysterious flying superhero known as blue sky protects the good citizens of oxford. unknown to these citizens, blue sky is actually mild-mannered trudy, a scientist in a flying suit. before trudy can fly in the suit, she needs to charge its battery. there is a proportional relationship between the number of hours trudy has charged her flying suit, x, and the number of hours she can fly, y. x (hours charged)y (flight hours) 11 44 77 88 what is the constant of proportionality? write your answer as a whole number or decimal. flight hours per hour charged Brian asked a group of people their favourite holiday destination.The results are summarised in the table.DestinationUK = 201Europe = 252USA = 246Africa = 207Other = 174Work out the size of each angle to draw a pie chart. Multiply. Express your answer in simplest form. 9 1/6 1 1/11. A. 10 B. 9 1/66 C. 10 1/17 D. 10 5/6 45 equals the quotient of a number n and 3. Write the equation. POSSIBLE POINTS: 4.17 Mario's parents tell him he doesn't have to do the dishes if he can flip heads on a fair coin and roll an even number on a fair six-sided die. What is the probability that Mario can get out of doing the dishes ? In other words, P(heads and even number) = ? What is the formula to calculate the radius in sphere diagram? I NEED HELP :( Which type of figurative language is present in the line from paragraph one: A Lion was dozing in the deep distant forest, his kingly head at rest of his hefty sharp paws. I need help please.................... Question 3 please help 1. Marissa is watching a honeybee return from her flower garden to a beehive in a branch of a nearby tree. She notices that the bee's path resembles part of a trigonometric function (see below). Suppose that the flower is 2 ft above the ground, the beehive is 8 ft above the ground, and the horizontal distance from the flower to the beehive is 20 ft. Model this path with a sine or cosine function. Clearly indicate the following:: a. The maximum and minimum b. The midline c. The period and rate constant d. Write a formula for the function Clearly label all parts e. f. Sketch the graph Which question would be most appropriate to ask yourself when consideringow to address your audience for a procedural document?A. Where can I go for information about my topic?B. Will readers respond best to a formal or informal style?C. What research do I need to do to understand my topic?D. Why can't I find a good image to illustrate my points? Will give BRAINLIESTDescribe how you can usehealth knowledge to improve the physical component of your health. when marketers seek to evaluate market attractiveness, what must they do first? multiple choice question. develop a positioning strategy secure a marketing communications license determine whether the segment is worth pursuing develop a perceptual map BINARY DATA: 00000000 00000000 00001100 00000111 10101100 00001010 01111000 00101011 11001011 10011101 00111001 11110011 00001000 00000000 01000101 00000000 00000000 00101000 00000010 10001110 01000000 00000000 10000000 00000110 00000000 00000000 00001010 01111011 00001010 00100001 01101011 00010100 11011001 10101011 00111000 00010111 00000000 01010000 01001100 00100001 00011000 00001001 10011101 01100010 10100011 10001011 01010000 00010000 01000000 10110000 01011001 01110110 00000000 00000000Required:a. How do you know this is an IP packet?b. What is the embedded protocol?c. What is the size of the embedded protocol payload?