How many molecules of ATP are pro
duced by substrate-level phosphorylation from one turn of the Krebs cycle? ​

Answers

Answer 1

Answer:

1 mole of ATP per Krebs cycle

Explanation:

it's produced when

succinlycoa ---> succinate

( succinlycoa dehydrogenase)

you can support by rating brainly it's very much appreciated ✅✅


Related Questions

Proper segregation of plasmids into daughter cells may incorporate which of the following strategies?
(choose appropriate response(s)
A. Random partitioning due to high copy number
B. Polymerization of a filament that binds to, and physically separates plasmids
C. Post-segregational killing via toxin / antitoxin system
D. Handcuffing

Answers

The required reactions for plasmids to properly segregate into daughter cells might be:

B. Polymerization of a plasmid-binding and -physically-separating filament: Some plasmids encode partitioning mechanisms that result in filaments or other structures that bind to plasmids and physically separate them during cell division. Plasmid distribution to daughter cells is ensured by doing this.

C. Plasmid maintenance is ensured by the toxin/antitoxin systems found in many plasmids, which prevent post-segregational death. While the antitoxin is created by the plasmid-containing cells, the toxin only affects cells that lack plasmids. This process fosters correct segregation during cell division and supports the survival of cells that retain the plasmid.

D. Handcuffing: When plasmids create proteins that directly interact with one another, they are said to be "handcuffed" together. This physical connection ensures that plasmids are distributed equally to daughter cells during cell division.

A. High-copy number plasmids may enhance the likelihood of correct segregation, however random partitioning by itself is not a reliable tactic. To assure the precise distribution of plasmids to daughter cells, additional processes, such as those outlined above, are frequently used.

As a result, B, C, and D are the right answers for the proper segregation of plasmids into daughter cells.

To learn more about plasmids here

https://brainly.com/question/31765340

#SPJ4

how do satellite views help scientists?

A. they give scientists the ability to predict catastrophic events

B.satellite cameras are not good enough to really be helpful

C. they allow scientists to know where valuable minerals are located

D. they allow scientist to see changes as they happen ​

Answers

The answer is D.


If not sorry

Organs of the body are defined as _______. Group of answer choices a collection of cells that perform similar functions. two or more tissues combined to form a structure that allows each tissue to function independently. a collection of cells that function independently of one another. a combination of two or more tissues that makes a structure which performs specific functions. a collection of tissues that function independently of one another.

Answers

Answer:

A combination of two or more tissues that makes a structure which performs specific functions.

What evidence from the study supports the hypothesis that dogs might use a magnetic sense to navigate?

Answers

Answer:

Yes.

Explanation:

Yes, a new research indicates that dogs might use a magnetic sense to navigate. Dogs has world class nose which helps them to navigate to their destination but it also has a magnetic compass that helps them in navigation. The dogs use magnetic field of the earth to find out shortcut ways in the unknown land or terrain so the hypothesis is right that dogs used magnetic sense for navigation.

Answer:

Yes

Explanation:

Yes, a new research indicates that dogs might use a magnetic sense to navigate. Dogs has world class nose which helps them to navigate to their destination but it also has a magnetic compass that helps them in navigation. The dogs use magnetic field of the earth to find out shortcut ways in the unknown land or terrain so the hypothesis is right that dogs used magnetic sense for navigation.

This is the correct answer so i m going to copy paste it for points sorry :(

Of the following types of personality tests, one is based largely on characteristics that were proposed by Carl Jung. Unfortunately, this test has not held up well to scientific analyses of validity and reliability. Which one is it?

Answers

One of the Myers-Briggs Types Indicator (MBTI) kinds of personality assessments is mostly based on traits put out by Carl Jung. Unfortunately, scientific assessments of the validity and reliability of this test have not been very positive.

The Myer - briggs Type Indicator has the drawback of pushing people into one type or the other. Even though people can be both people skills or introverted to some extent, there is no through the if one is neither extraverted nor introverted. Organizations utilize it most frequently to support personal growth, self-awareness development, and improved teamwork. The MBTI assessment, for instance, can aid in decision-making, leadership training, career coaching, team building, managing change, and conflict resolution. Based on psychiatrist Carl Jung's notion of psychological types, Isabel Briggs Myers with her mother Katherine Cook Briggs created the MBTI in the 1940s.

Learn more about Indicator

https://brainly.com/question/29603059

#SPJ4

One Strand of DNA is listed below. Which of the following best
represents the complementary strand of DNA?
DNA Strand: TCGAGGCTAA
A. ACGUCCGAUU
B. GATCTTAGCC
C. AGTCCGAUU

Answers

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

The complementary strand of  the mentioned DNA strand is AGCTCCGATT.

What is DNA?

DNA  is a hereditary material  which is present in human beings as well as all other living organisms.  Every cell which is present in an organism's body has DNA  which is the same. Most of the DNA is situated in the cell's nucleus and small amount of it can be found in the cell's mitochondria as well.

Information which is stored in DNA is stored as codes made up of four chemical bases namely, adenine, thymine , cytosine and guanine.Human DNA consists of 3 billion bases .The order of the bases determines information which is required for building and maintaining an organism.

DNA bases are capable of pairing up with each other. Adenine pairs with thymine and guanine pairs up with cytosine .Each base is also attached to a sugar molecule and a phosphate group. A base, phosphate  sugar are together called as nucleotides.

Learn more about DNA,here:

https://brainly.com/question/2293843

#SPJ2

Your question is incomplete but most probably your full question  was ,one Strand of DNA is listed below. Which of the following best

represents the complementary strand of DNA?

DNA Strand: TCGAGGCTAA

A. ACGUCCGAUU

B. GATCTTAGCC

C. AGTCCGAUU

D. AGCTCCGATT.

In the context of tree-building, what do we mean when we

Answers

Parsimony is the term used to describe the process we utilized to build the tree above. Parsimony is basically the choice of the simplest hypothesis that can explain our observations.

What does parsimony in tree construction mean?

A reliable method of building and evaluating trees called parsimony entails assembling taxa in a way that minimizes the amount of character-level evolutionary changes that would otherwise be required.

What does parsimony provide as a means of?

According to the parsimony principle, given a list of possible explanations, the most obvious explanation has the greatest chance of being correct. The principle of parsimony is employed in the sciences to choose amongst competing models that describe a reality. In biology, phylogenetic analysis is where it is most frequently used.

To know  more about parsimony visit:-

https://brainly.com/question/14809027

#SPJ4

question:

In the context of tree-building, what do we mean when we say parsimonious?

HELP PLEASE
Question 5 of 26
The image shows an energy pyramid.
Eagle
Snake
Frog
Grasshopper
Grass
Which statement is supported by the pyramid?
A. All of the energy in the grass will be passed on to the next level.
B. Some of the energy in a snake is available to frogs
C. Some of the energy in a grasshopper will be used for a frog's life
functions
D. Most of the energy in an eagle will be passed on to producers.

Answers

Answer:

C. Some of the energy in a grasshopper will be used for a frog's life functions is supported by the pyramid.

PLS HELP IT’S DUE TODAY

PLS HELP ITS DUE TODAY

Answers

Genes linked on the same chromosome tend to be inherited together, violating the principle of independent assortment.

What is the effect of crossing over?

The relative position of genes is determined by calculating the frequency of crossing-overs between genes located on the same chromosome. The closer two genes are located to each other on a chromosome, the lower is the probability that the independent distribution in the next generation violates the principle of the opposite chromosomes.

Crossing-over between them is highly likely, resulting in the formation of recombinant chromosomes. The phenotype resulting from a genotype is determined by the same distribution.

Learn more about crossing over at: https://brainly.com/question/927405

#SPJ1

(c) James results are shown in the table below.
Amount of Light (hours)
0
5
10
Number of Duckweed Plants after 1 Week
1
3
7
(i) Describe how increasing the amount of light affects the number of duckweed plants.
(ii) Explain why increasing the amount of light has this effect on pondweed plants.
(Q7 Total marks = 8)

Answers

i) From the table given, it is clear that the Duckweed plants responded to increased light. Where there was no light at all, there was only one of them. When light exposure was increased to 5 hours/day, the number of Duckweek plants increased to 3. When the amount of light increased, the number of duckweed also more than doubled, going from 3 to 7.

ii) As the light levels are increased there is an increase in photosynthesis in the plant. There is also an increase in growth.

What is photosynthesis?

Photosynthesis is a process that plants and other organisms utilize to transform light energy into chemical energy that may then be released to power the organism's activities via cellular respiration.

Sunlight, water, and oxygen are required, and two processes occur, one light-dependent and one light-independent.

Learn more about Duckweed:
https://brainly.com/question/14349779
#SPJ1

Full Question:

(c) James results are shown in the table below.

Amount of Light (hours)          Number of Duckweed Plants after 1 Week

0                                                                      1

5                                                                      3

10                                                                     7

(i) Describe how increasing the amount of light affects the number of duckweed plants.

(ii) Explain why increasing the amount of light has this effect on pondweed plants.

(Q7 Total marks = 8)

Which statement is FALSE about the Cell Cycle? Question 4 options:
A. During Prophase, the cell fully splits into a parent and a daughter cell.
B. Most of the cell's life is spent in Interphase, growing larger.
C. The stages of the cell cycle repeat themselves.
D. The cytoplasm divides during the process called cytokinesis.

Answers

Answer:

the answer is A since the cell splits into two only during the cytokinesis

Answer: I belive its A

Explanation:

If the 5′ → 3′ nucleotide sequence on the nontemplate dna strand is cat, what is the corresponding codon on mrna?.

Answers

If the 5′ → 3′ nucleotide sequence on the non template DNA strand is CAT, the corresponding codon on mRNA will be CAU. DNA first gets converted into RNA and then the complementary codon is read on mRNA.

Both the coding (or sense) and the template (or non-coding, or anti-sense) strands of DNA are complementary and anti-parallel. During transcription, the RNA polymerase "reads" the template strand in the 3' to 5' direction to create a complementary RNA that is in the 5' to 3' direction. Since the template strand of DNA is complementary to both the coding strand of DNA and the RNA, the coding (or sense) strand reveals the meaning of the RNA, except that all Ts in the coding strand are converted to Us in RNA because RNA employs uracil bases rather than thymine bases. Hence, the CAT on DNA template strand first converts into GTA and then changes to CAU. Here A gets replaced by U because of presence of mRNA.

Learn more about RNA here:

https://brainly.com/question/14317249

#SPJ4

Wha is biology and how it started and what kind of biology is this

Answers

Answer:

Basically biology traces the study of the living world from ancient to modern times. Although the concept of biology as a single coherent field arose in the 19th century, the biological sciences emerged from traditions of medicine and natural history reaching back to Ayurveda, ancient Egyptian medicine, and the works of Aristotle and Galen in the ancient Greco-Roman world. This ancient work was further developed in the Middle Ages by Muslim physicians and scholars such as Avicenna. During the European Renaissance and early modern period, biological thought was revolutionized in Europe by a renewed interest in empiricism and the discovery of many novel organisms

Explanation:

Answer:

Basically biology traces the study of the living world from ancient to modern times. Although the concept of biology as a single coherent field arose in the 19th century, the biological sciences emerged from traditions of medicine and natural history reaching back to Ayurveda, ancient Egyptian medicine, and the works of Aristotle and Galen in the ancient Greco-Roman world. This ancient work was further developed in the Middle Ages by Muslim physicians and scholars such as Avicenna. During the European Renaissance and early modern period, biological thought was revolutionized in Europe by a renewed interest in empiricism and the discovery of many novel organisms

Why do the cells in all living things need energy?

Responses

Answers

Answer:

All living cells need energy to carry out their basic functions, such as growth, reproduction, and maintenance. This energy is necessary for cells to maintain their structural integrity, to synthesize new molecules, and to perform the many other processes that are essential for life. Without a constant supply of energy, cells would not be able to carry out these functions and would quickly die.

The current trend of increasing global temperatures has Heather wondering how an increase in the temperature of the atmosphere affects the temperature of the ocean. Heather decides to investigate the flow of energy between the atmosphere and the hydrosphere. Which investigation will provide evidence to answer the question, How does a warmer atmosphere affect the temperature of the ocean?A. Measuring the change in the temperature of water while in containers with air of different temperaturesB. Dissolving chalk in water with varying levels of acidityC. Comparing the heat capacity of water with that of other liquidsD. Testing the water solubility of various solids, such as salt and calcium carbonate

Answers

The investigation that will provide evidence to answer Heather's question about how a warmer atmosphere affects the temperature of the ocean, is by meausuring the change in the temperature of water while in containers with air of different temperatures. This will allow her to see the influence of air temperature on water temperature.

The correct option is A.

if shark fossils are found below flowering plant fossils, then what does that tell you about their relative ages?

Answers

If shark fossils are found below flowering plant fossils, it suggests that the sharks existed before the flowering plants. This is because the principle of superposition states that, in a series of undisturbed rock layers, the oldest rocks will be at the bottom and the youngest rocks will be at the top. Therefore, if shark fossils are found in lower rock layers than flowering plant fossils, it means that the sharks lived and died before the flowering plants evolved and were fossilized.

While this answer may provide helpful information regarding your assignment, it is important to remember that using it verbatim could be seen as plagiarism. To avoid this, it is best to cite your sources and use your own words to ensure a better answer.

~~~Harsha~~~

Which region indicates where the vegetation will be most
plentiful?
Choose the correct answer.
O region R
O region S
O region T
O region W

Which region indicates where the vegetation will be mostplentiful?Choose the correct answer.O region

Answers

Based on the given image, the region that indicates where the vegetation will be most plentiful is region R. In the image, region R appears to have a dense and extensive coverage of vegetation compared to the other regions. Option A)

Based on the given image, the region that indicates where the vegetation will be most plentiful is region R. In the image, region R appears to have a dense and extensive coverage of vegetation compared to the other regions. It is characterized by a darker shade of green, suggesting a higher concentration of vegetation.

Vegetation abundance can be influenced by various factors, including climate, precipitation, soil quality, and sunlight exposure. Without additional information about these factors or the specific location depicted in the image, we can make an inference based on the visual representation.

Region R exhibits a greater density and variety of vegetation, indicating favorable conditions for plant growth. It is possible that this region receives adequate rainfall, has fertile soil, and receives sufficient sunlight, supporting abundant vegetation.

Therefore option A) is correct, based solely on the image provided, region R is the most likely area where vegetation will be most plentiful.

For more question on vegetation

https://brainly.com/question/29285038

#SPJ8

HELP FOR 10 BRAINLY POINTS!!! How can a factory a hundred miles away from a vegetable farm can affect the farm’s crops? Give a somewhat detailed answer, bc I have to make a comic strip out of it!! Please and thank you!!

Answers

These are details on how a factory located a hundred miles away from a vegetable farm can affect the farm's crops:

Air PollutionWater ContaminationSoil ContaminationAcid RainClimate Change

What are these factors about?

Air Pollution: Factories often emit various pollutants into the air, such as smoke, gases, and particulate matter. These pollutants can travel through the air and settle on the crops at the farm. Over time, the accumulation of pollutants can affect the health and growth of the crops, leading to reduced yield and lower quality produce.

Water Contamination: Factories may release wastewater or chemicals into nearby water bodies, such as rivers or streams. If the factory's wastewater or chemical discharge finds its way into the water sources used for irrigation on the vegetable farm, it can contaminate the water supply. When crops are irrigated with contaminated water, they can absorb harmful substances, impacting their growth and potentially rendering them unsafe for consumption.

Soil Contamination: Some factories produce waste materials that are disposed of improperly or contain toxic substances. If these waste materials are not managed effectively, they can seep into the soil and contaminate the farmland. When crops are grown in contaminated soil, they can take up the toxins, affecting their health and potentially making them unfit for consumption.

Acid Rain: Factories that release pollutants like sulfur dioxide and nitrogen oxide can contribute to the formation of acid rain. Acid rain occurs when these pollutants combine with water vapor in the atmosphere and fall back to the ground. Acid rain can negatively impact the pH balance of the soil, making it less suitable for growing crops.

Climate Change: Industrial activities contribute to the emission of greenhouse gases, such as carbon dioxide, which contribute to global climate change. Climate change can alter temperature and precipitation patterns, leading to shifts in growing seasons, irregular rainfall, and extreme weather events.

Find out more on farm crops here: https://brainly.com/question/845584

#SPJ1

Answer:

Hope this file helps!

Explanation:

HELP FOR 10 BRAINLY POINTS!!! How can a factory a hundred miles away from a vegetable farm can affect

What are potential problems in the cell cycle if the different cyclin molecules do not interact correctly?

Answers

Answer:

Interactions between cyclins and cyclin-dependent kinases. Disruptions to the cell cycle may result in cancer and/or programmed cell death (apoptosis).

can someone help me out here please ​

can someone help me out here please

Answers

Answer:

The answer is d

Explanation:

I hope it helps you

Please mark as brainlist answer

1) A region of the country is rapidly growing in population, causing the demand for electricity to go up each year. As a result, a new source of electricity is needed. This particular region of the country has plenty of agriculture, rivers, and access to coal deposits underground. Which of the following would be the cheapest way for this region of the country to make electricity, have minimal impact on the environment, yet not add carbon dioxide to the atmosphere?





Group of answer choices

A)Use the agriculture biomass to generate a renewable fuel that can be burned to generate electricity

B)Use the coal deposits to generate electricity in a few coal fired facilities

C)Build a nuclear power plant in the middle of the region

D)Build dams along the rivers to generate electricity


2)The image provided shows a partial river food web.



The local town relies on this river ecosystem to sustain their population both economically and as a source of food. Using the food web provided, which statement provides the best reasoning for regulating the amount of fish removed from the river by humans.

Group of answer choices

A)Regulation will help the ecosystem to remain balanced and contribute to the stabilization of other populations of river organisms.

B)Regulation will increase the amount of energy transferred from the catfish to the eagle.

C)Regulation will allow contaminated sediments to decrease in the river due the removal of the contamination source.

D)Regulation will ensure that carp will not overpopulate the ecosystem and begin to consume larger organisms like the salmon.

Answers

Answer:

The cheapest way for the country to make electricity would be

A) Use the agriculture biomass to generate a renewable fuel that can be burned to generate electricity

The statement provides the best reasoning for regulating the amount of fish removed from the river by humans is:

A) Regulation will help the ecosystem to remain balanced and contribute to the stabilization of other populations of river organisms.

Explanation:

For the electricity, the use of Biomass meets the demands due to the fact that, it has minimal impact on the environment, does not add carbon dioxide to the atmosphere. Also, it is renewable form of energy.

For the regulation of the amount of fish removed from the river helps to maintain the ecosystem balance. If it was not done, the fishes found in the river will be totally harvested thereby disrupting the chains in that river ecosystem.

While frying French fries, Wanda burned her hand. Burns are examples of a:

skin abnormality.

homeostatic balance.

skin infection.

homeostatic imbalance.

Answers

Answer:

Damage to the skin or deeper tissues caused by sun, hot liquids, fire, electricity, or chemicals.

The degree of severity of most burns is based on the size and depth of the burn. Electrical burns, however, are more difficult to diagnose because they're capable of causing significant injury beneath the skin without showing any signs of damage on the surface.

Explanation:

hope this helps, lovely!! Have a great day <3

Answer:

D

Explanation:

homeostatic imbalance

adaptations in glut4 expression in response to exercise detraining linked to downregulation of insulin-dependent pathways in cardiac but not in skeletal muscle tissue

Answers

The downregulation of insulin-dependent pathways in cardiac muscle tissue during exercise detraining may result in decreased glucose uptake and utilization by the heart, which could have implications for overall cardiac function.

The statement suggests that adaptations in GLUT4 expression, in response to exercise detraining, are associated with a decrease in insulin-dependent pathways in cardiac muscle tissue but not in skeletal muscle tissue.

1. GLUT4 expression: GLUT4 is a glucose transporter protein that plays a crucial role in glucose uptake by cells. In response to exercise, GLUT4 expression increases to facilitate glucose uptake into muscle cells, promoting energy production.

2. Exercise detraining: Exercise detraining refers to the period of reduced or discontinued physical activity after a period of regular exercise. During this period, the adaptations gained from exercise may start to reverse.

3. Insulin-dependent pathways: Insulin is a hormone that regulates glucose uptake into cells. Insulin-dependent pathways involve insulin signaling and activation of various molecules that facilitate glucose transport into cells.

Based on the statement, here is a breakdown of the key information:

- In response to exercise detraining:
 - GLUT4 expression decreases in cardiac muscle tissue.
 - Insulin-dependent pathways are downregulated in cardiac muscle tissue.
 - However, there is no change in GLUT4 expression or insulin-dependent pathways in skeletal muscle tissue.



Learn more about insulin-dependent pathways here:-

https://brainly.com/question/32253191

#SPJ11

Which of the following are used to silence specific genes and hold promise for treating cancer or viral diseases, such as hepatitis B?
A) RNA interference (RNAi)
B) reverse transcriptase PCR (rtPCR)
C) DNA fingerprinting
D) tumor-inducing plasmids (Ti plasmids)
E) complementary DNA (cDNA)

Answers

The correct answer is option A). RNA interference (RNAi) is used to silence specific genes and holds promise for treating cancer or viral diseases, such as hepatitis B.

RNAi is a biological process in which short RNA molecules, called small interfering RNAs (siRNAs), can bind to and degrade messenger RNA (mRNA) molecules, preventing the translation of the mRNA into protein. By targeting specific mRNA molecules, researchers can selectively silence the expression of genes that are involved in diseases like cancer or viral infections.

RNAi has shown promise as a potential therapy for a variety of diseases, including cancer, viral infections, and genetic disorders. In cancer, RNAi can be used to target and silence specific genes that are involved in tumor growth and progression. In viral infections, RNAi can be used to silence viral genes and prevent the virus from replicating and infecting new cells.

B) reverse transcriptase PCR (rtPCR) is a technique used to measure the amount of RNA in a sample and is not used to silence specific genes.

C) DNA fingerprinting is a technique used to identify individuals based on their unique DNA profile and is not used to silence specific genes.

D) tumor-inducing plasmids (Ti plasmids) are bacterial plasmids that can be used to genetically engineer plants, but they are not used to silence specific genes in humans.

E) complementary DNA (cDNA) is a form of DNA that is synthesized from messenger RNA (mRNA) and is often used in gene cloning and expression studies, but it is not used to silence specific genes.

Therefore option A)  RNA interference (RNAi) is the correct answer.

Learn more about genetic disorders:

https://brainly.com/question/23583076

#SPJ11

chromosomal rearrangement means_______?

Answers

Answer:

A chromosomal rearrangement means that pieces of chromosomes are missing, duplicated (there are extra copies), or moved around.

Chromosomal rearrangement means 'a structural variation that alters the structure of chromosomes without changing the number of chromosomes'

It is a genetic abnormality that affects chromosome structure without altering the number of chromosomes in the organism. DNA segments are deleted, duplicated, inverted, or translocated from one location to another within the same or different chromosomes, resulting in a variety of genetic disorders.

For example, translocation can occur if a fragment of one chromosome breaks off and attaches to another chromosome, causing the genes in the chromosome fragment to be rearranged. Chromosomal rearrangements are associated with a variety of genetic diseases, ranging from cancer to developmental disabilities, depending on the type and severity of the rearrangement.

Learn more about the chromosomal arrangement here.https://brainly.com/question/31176709

#SPJ11

What are some symptoms of dental anxiety?
What are some situations when dental patients may exhibit these
symptoms?
What strategies can you use to calm a fearful or anxious
patien

Answers

Answer:

Symptoms of dental anxiety can include:

1. Fear or uneasiness: Patients may experience a general sense of fear or uneasiness when thinking about or visiting the dentist.

2. Increased heart rate: Anxiety can lead to an elevated heart rate and palpitations.

3. Difficulty breathing: Some individuals may experience shortness of breath or feel like they cannot breathe properly.

Situations when dental patients may exhibit these symptoms include:

1. Dental phobia: Some individuals have an extreme fear or phobia of dental procedures, often stemming from past traumatic experiences.

2. Fear of pain or discomfort: The anticipation of dental procedures, such as injections or drilling, can trigger anxiety in patients who fear pain or discomfort.

Strategies to calm a fearful or anxious patient:

1. Establish trust and open communication: Take the time to listen to the patient's concerns and address any fears or questions they may have.

2. Create a calm and comforting environment: Ensure the dental office has a welcoming atmosphere with relaxing elements such as soothing music or aromatherapy.

3. Provide distractions: Offer distractions during the procedure, such as watching a movie or listening to music, to divert the patient's attention.

It is important to note that every patient is unique, and dentists should tailor their approach based on individual needs and preferences.

To know more about dental anxiety: https://brainly.com/question/33415558

#SPJ11

simple ways that you think we should do to prevent non-renewable resources to run out and renewable resources on becoming non-renewable.

Answers

Here are some simple ways to prevent non-renewable resources from running out and renewable resources from becoming non-renewable:

1. Reduce, reuse, and recycle: This is a simple but effective way to conserve natural resources. By reducing our consumption of products, reusing items as much as possible, and recycling materials, we can reduce the amount of waste we produce and conserve resources.

2. Use energy-efficient appliances: Energy-efficient appliances use less electricity and can help reduce our reliance on non-renewable energy sources.

3. Use public transportation, carpool, or bike: Transportation is a major source of carbon emissions, which contribute to climate change. By using public transportation, carpooling, or biking rather than driving alone, we can reduce our carbon footprint and conserve fossil fuels.

4. Support renewable energy: Supporting renewable energy sources like wind, solar, and hydroelectric power can help reduce our reliance on non-renewable resources.

5. Conserve water: Water is a finite resource, and conserving it can help prevent it from becoming scarce. Simple steps like fixing leaks, taking shorter showers, and using water-efficient appliances can help conserve water.

6. Support sustainable agriculture: Supporting sustainable agriculture practices like organic farming and crop rotation can help conserve soil and prevent it from becoming degraded.

7. Plant trees: Trees absorb carbon dioxide from the atmosphere and help mitigate the effects of climate change. Planting trees can also help conserve water and prevent soil erosion.

These are just a few examples of simple ways to conserve natural resources and prevent them from becoming depleted or non-renewable.

Answer:Actions like driving electric and hybrid vehicles, installing solar panels on and properly insulating places like business and home, and using energy-efficient appliances are all smaller-scale changes that you can make to reduce your nonrenewable resource

describe how you could determine the population size of a specific type of plant in a large forest without counting all of the plants

Answers

Answer:

The study of living and nonliving components of a system can be best described as an. ecosystem ... Describe how you could determine the population size of a specific type of plant in a large forest without counting all of the plants

It is possible to determine the population size of a specific plant in a forest by counting the number of the specific plant in a small section of the forest and then multiply this by the total area.

This technique is known as quadrat sampling.

Quadrat sampling is a methodology by which organisms of a sample of the habitat are directly counted and then this value is used to calculate the total population of an area, i.e., the total number of individuals/organisms in a given area.

In this case, a quadrat delimits a small area in which the specific plant can be estimated.

The abundance of a population in a particular area can be estimated by using the number found per quadrat and then multiply this value by the total size of the area.

Quadrat sampling is a very useful methodology for the study of biodiversity.

In conclusion, it is possible to determine the population size of a specific plant in a forest by counting the number of the specific plant in a small section of the forest and then multiply this by the total area.

Learn more in:

https://brainly.com/question/7869679?referrer=searchResults

in biological systems membrane channels are usually permeable to

Answers

In biological systems, membrane channels are usually permeable to specific molecules or ions based on their size, charge, and polarity. Some examples of common molecules and ions that can pass through membrane channels include water, oxygen, carbon dioxide, sodium ions, potassium ions, calcium ions, and chloride ions.

The selectivity of membrane channels plays a critical role in maintaining cellular homeostasis and enabling communication between cells. In biological systems, membrane channels are usually permeable to specific ions and small molecules, such as potassium, sodium, calcium, and chloride ions. These channels facilitate the passive transport of these substances across the cell membrane, maintaining cellular homeostasis and enabling various physiological processes.

To know more about membrane channels visit:

https://brainly.com/question/7446951

#SPJ11

When vesicles from the Golgi apparatus deliver their contents to the exterior of the cell, they add their membranes to the cell/plasma membrane. One reason that the cell/plasma membrane might not increase in size is because

Answers

Because membrane is continuously being removed from the plasma membrane by endocytosis, the plasma membrane does not become larger. Hence (c) is the correct option.

In response to extracellular signals, secretory vesicles that originate from the trans Golgi network exocytose their contents to the cell's exterior. A protein (such a hormone or digestive enzyme) or a tiny molecule (like histamine) can both be released. While some transport vesicles choose the cargo molecules they want to transport and send them to the following compartment along the pathway, others catch escaping proteins and move them back to a previous compartment where they can resume their usual functions.

To know more about plasma, click here:

https://brainly.com/question/31510917

#SPJ4

When vesicles from the Golgi apparatus deliver their contents to the exterior of the cell, they add their membranes to the plasma membrane. The plasma membrane does not increase in size, because

A) some vesicles from the Golgi apparatus fuse with the lysosomes.

B) membrane vesicles carry proteins from the endoplasmic reticulum to the Golgi apparatus.

C) membrane is continually being lost from the plasma membrane by endocytosis.

D) new phospholipids are synthesized in the endoplasmic reticulum.

E) the phospholipids become more tightly packed together in the membrane.

Other Questions
What is the coefficient in the expression 10x+8 what is the aswer to ....y=3x+30 What is significant about The Yellow Wallpaper to the narrator Why does she become obsessed with it how is it described what might it symbolize? According to Poiseuilles law, the drop in pressure, P (dynes/cm2), across a tube of length, L, and diameter, d, at a flow rate, F (cm3/s), for a fluid of viscosity (poise) is given by the equation below.P=129LFd4Compute P for a tube 1 m long, 3 mm in diameter, with a flow rate of 0.5 L/min and a liquid viscosity of 1.5 centipoise.Using scientific notation, P is A x 10B dynes/cm2.A = [ Select ] ["1", "2", "3", "4", "5", "6", "7", "8", "9"]B = [ Select ] ["-2", "2", "-3", "3", "-4", "4", "-5", "5", "-6"] Sin y+ cos y + tan y sin y=sec y+ cos y tan y? True/false: the divine beauty of the ceiling figures in the sistine chapel were painted by leonardo da vinci. DIRECTIONS:give the formula for each surface area.pls answer thank you!! A wholesaler wants to establish a list price for an item so that his selling price gives a trade discount of 10% of the list price. If he makes a markup of 20% of this selling price, and if his cost is $160, what list price should he establish? Show that 4n3 + 10n 20 is O(n3). Your company has decided that security is very important and wants to add a second security check that will identify its employees while they are logging in to their computers. What type of security do you recommend?answer choicesSmart cardsKey fobsHardware tokensBiometric locks on a number line what numbers are either negative or greater than 5PLEASEEEEEEE help im deperate what suggestions or recommendations would you give to improve a reading program Is the equation: x + y = 9 a function. Explain. Why do we negotiate or debate? Is it important to do this in the world? Why. 4 sentences please answer for brainlest answer Find the volume of the cylinder. Find the volume of a cylinder with the same radius and double the height.The volume of the cylinder is ?The volume of a cylinder with the same radius and double the height is? A ball of mass 1 kg is dropped from a height of 3 m. Assume no air resistance. After it bounces off the ground it only reaches a height of 2 m. What is the change in momentum of the before and after the bounce?. 5 The Second Amendment says that we have a right to bear Please helppppp meeeee Imperial reform efforts in nineteenth-century Russia had which of the following effects?A) The reforms enabled Russia to catch up with western Europe economically, by abolishing serfdom and other primitive practices.B) The reforms had the unintended effect of giving rise to radical revolutionary movements, which led to the Russian Revolution of 1905.C) The reforms succeeded in reducing ethnic tensions in the Russian Empire but did little to address Russia's economic backwardness.D) The reforms served as a model for the Soviet industrialization and collectivization campaigns of the 1920s and 1930s. Which of these is a negative impact of lobbying?