The curve will have the points (0, 8.04), (halfway, 8.04), (equivalence point, 8.04), and (endpoint, 14). The points can then be connected to create a graph of the pH over the course of the titration.
At the start of the titration, before any KOH has been added, the concentration of HBrO is 0.200 M and the concentration of KOH is 0.000 M, so the pH can be calculated as:
pH = 8.04 + log ([0.000]/[0.200]) = 8.04 + log (0) = 8.04.
When the equivalence point is reached, the concentrations of the two reactants are equal, so the pH can be calculated as:
pH = 8.04 + log ([0.200]/[0.200]) = 8.04 + log (1) = 8.04.
At the end of the titration, when all of the KOH has been added, the concentration of KOH is 0.140 M and the concentration of HBrO is 0.000 M, so the pH can be calculated as:
pH = 14 + log ([0.140]/[0.000]) = 14 + log (infinity) = 14.
Using these four points, a titration curve can be drawn to represent the pH of the solution throughout the titration. The curve will have the points (0, 8.04), (halfway, 8.04), (equivalence point, 8.04), and (endpoint, 14). The points can then be connected to create a graph of the pH over the course of the titration.
Learn more about pH: brainly.com/question/172153
#SPJ11
A lake is part of the
The lattice energy of CsOH is -724 kJ/mol, and the enthalpy of hydration of one mole of gaseous Cs+ and one mole of gaseous OH- ions is -796 kJ/mol. Calculate the enthalpy of solution per mole of solid CsOH.
The enthalpy of solution per mole of \($\mathrm{NaCl}$\) is \($+3 \mathrm{~kJ}$\).
What is Enthalpy of Solution?When a specific amount of a solute dissolves in a specific amount of solvent at constant pressure, heat is either emitted or absorbed, and this is known as the enthalpy of solution (H soln). The measurement of energy in a thermodynamic system is called enthalpy. The amount of enthalpy is the entire amount of heat contained in a system, which is equal to the sum of the system's internal energy and the product of volume and pressure.It is possible to think of the generation of aqueous ions from a solid as the breakage of its crystal lattice followed by hydration. If the Born-Haber cycle is used to determine the other two processes, the enthalpy of any one of the three processes can be determined.Lattice energy (NaCl solid) = -786 kJ/mol
Hydration enthalpy (sodium and chloride ions) = -783 kJ/mol
The Born-Haber cycle for NaCl dissolution can be given as follows:
Where,
\(- $\Delta_{\text {soln }} \mathrm{H}$\) - solution enthalpy-energy changes when\($1 \mathrm{~mol}$\)solid salt is converted to corresponding aqueous ions.
\(- $\mathrm{U}_1$\)- lattice energy- energy released during solid lattice formation (negative of lattice energy is taken because here, the lattice is ruptured).
\(- $\Delta_{\text {hyd }} \mathrm{H}$\) - hydration enthalpy- energy changes when gaseous ions of a solid salt are hydrated.
The formation of aqueous sodium and chloride ions from \($\mathrm{NaCl}(\mathrm{s})$\)involves the rupture of lattice and hydration. Therefore,
\($$\Delta_{\text {soln }} \mathrm{H}(\mathrm{NaCl})=-\mathrm{U}_1(\mathrm{NaCl})+\Delta_{\mathrm{hyd}} \mathrm{H}\left(\mathrm{Na}^{+}\right)+\Delta_{\mathrm{hyd}} \mathrm{H}\left(\mathrm{Cl}^{-}\right)$$\)
The hydration energy of sodium and chloride ions together is given as \($-783 \mathrm{~kJ} / \mathrm{mol}$\), and the\($\mathrm{NaCl}$\) lattice energy is \($-786 \mathrm{~kJ} / \mathrm{mol}$\).
Therefore,
\(\Delta_{\text {soln }} \mathrm{H} & =-(-786 \mathrm{~kJ} / \mathrm{mol})+(-783 \mathrm{~kJ} / \mathrm{mol}) \\& =+3 \mathrm{~kJ} / \mathrm{mol}\)
Hence, the enthalpy of solution per mole of \($\mathrm{NaCl}$\) is \($+3 \mathrm{~kJ}$\).
The complete question is,
The lattice energy of\($\mathrm{NaCl}$ is $-786 \mathrm{~kJ} / \mathrm{mol}$\), and the enthalpy of hydration of 1 mole of gaseous \($\mathrm{Na}^{+}$\)and 1 mole of gaseous \($\mathrm{Cl}^{-}$\)ions is\($-783 \mathrm{~kJ} / \mathrm{mol}$\). Calculate the enthalpy of solution per mole of solid \($\mathrm{NaCl}$\).
To learn more about Enthalpy of Solution refer to:
https://brainly.com/question/26954829
#SPJ1
True or false: Mass is conserved in physical but not chemical changes in matter.
idc
Answer:
False matter in conserved in both forms according to the law of conservation of mass.
Explanation:
Answer: well im not sure 100% but ima go with false because matter is the one that doesent change
Explanation: hope it helps :)
A 0.325 g sample of copper was weighed out by a student to start this experiment.
1. How many moles of Cu2+ ions should be produced when the nitric acid was added to the copper metal?
2.When the sodium hydroxide was added to the solution, how many moles of Cu(OH)2 should have formed?
3. The directions require you to add 1.00 g of zinc. If you assume a 100 % yield of copper, how many grams of zinc were added in excess?
4. If magnesium metal were used instead of zinc metal, what is the minimum mass, in grams, of magnesium metal that should be used to ensure that all of the copper ions in the solution is converted back to copper metal?
When sodium hydroxide was added to the 0.325 g sample of copper, approximately 0.00512 moles of \(CuOH_{2}\) should have formed.
To determine how many moles of \(CuOH_{2}\) should have formed when sodium hydroxide was added to the 0.325 g sample of copper, follow these steps:
Step 1: Find the molar mass of copper (Cu)
The atomic mass of copper is approximately 63.5 g/mol.
Step 2: Calculate the moles of copper (Cu) in the sample
To find the moles of copper in the 0.325 g sample, divide the mass of the sample by the molar mass of copper:
Moles of Cu = mass of Cu / molar mass of Cu
Moles of Cu = 0.325 g / 63.5 g/mol
Moles of Cu ≈ 0.00512 mol
Step 3: Determine the chemical equation for the reaction
The balanced chemical equation for the reaction between copper and sodium hydroxide to form copper hydroxide (\(CuOH_{2}\)) is:
2 \(NaOH\) + Cu → \(CuOH_{2}\) + 2 Na
From the balanced equation, you can see that 1 mole of copper reacts with 2 moles of sodium hydroxide to form 1 mole of copper hydroxide \(CuOH_{2}\).
Step 4: Calculate the moles of \(CuOH_{2}\) formed
Since the ratio between moles of Cu and \(CuOH_{2}\) is 1:1, the moles of \(CuOH_{2}\) formed will be the same as the moles of Cu in the sample:
Moles of \(CuOH_{2}\) = moles of Cu
Moles of \(CuOH_{2}\) ≈ 0.00512 mol
In conclusion, when sodium hydroxide was added to the 0.325 g sample of copper, approximately 0.00512 moles of \(CuOH_{2}\) should have formed.
Learn more about Moles:
https://brainly.com/question/16386473
#SPJ4
how many grams are in 4.5 x 10^22 molecules of water
Answer:
1.35 g
Explanation:
water is h2o, so the molar mass is 1.01x2+16.00=18.02. divide 4.5 x 10^22 by 6.022 x 10^23 to get 7.5 x 10^-2 (2 sig figs). 18.02 x 7.5 x 10^-2 is 1.35 g
When Michelle's blood was tested, the chloride level was 0.55 g/dL. Part A What is this value in milliequivalents per liter? Express your answer in milliequivalents per liter to two significant figures. IVAL OO? mEq/L S
The given chloride level in Michelle's blood is 0.55 g/dL. Now we need to convert this value into milliequivalents per liter.
Chloride has a molar mass of 35.45 g/mol. The equation for calculating milliequivalents per liter is:milliequivalents per liter (mEq/L) = (mass in g / molar mass) x 10So, milliequivalents per liter (mEq/L) of Michelle's blood is:0.55 g/dL = 0.55 x 10 / 35.45 mEq/L (since 1 dL = 1000 mL)0.55 x 10 / 35.45 ≈ 0.1561 (rounded to four significant figures)So, the value of chloride level in milliequivalents per liter in Michelle's blood is approximately 0.1561 mEq/L (to two significant figures, the answer is 0.16 mEq/L).Thus, the correct answer is IVAL 0.16 mEq/L.
To know more about molar mass , visit ;
https://brainly.com/question/837939
#SPJ11
Which traits does the common garter snake have that might be adaptive for the environment where it lives?
Answer:
As the garter snake can be found almost in any kind of habitat, what makes them be able to survive in any environment include:
1. They hibernate to increase their chances of survival in unfavorable weather conditions.
2. They can blend with the background of any environment especially grass to escape being eaten.
3. They produce an odor that is usually unpleasant especially when about to be attacked.
Explanation:
The garter snakes are distinguished by the three stripes running the length of their body and can often be found in forests, places that are even close to water bodies, and almost any place, even in holes.
Answer:
Because it'll live in the desert!
Explanation:
It probably won't survive on time!
1. A group of chemistry students wants to find out if hydrochloric acid (HCl) is stronger than sulfuric acid
(H₂SO4) by observing how they react with baking soda. They plan to measure out equal amounts of
baking soda and place them into two identical test tubes. They will then add three drops of each acid
and use a stopwatch measure how long the reaction lasts in seconds.What is the independent variable, dependent variable, and hypothesis?
Hydrochloric acid is a stronger acid than sulphuric acid because the \(pK_a\)value of HCl is smaller than H₂SO₄
Why is hydrochloric acid stronger than sulphuric acid?Acids are substances that contain hydrogen and can donate H⁺ ions to another substance.
Hydrochloric acid and sulphuric acid both are stronger acids as compared to other acids
HCl dissolves in an aqueous solution to give out H⁺ and Cl⁻ and is completely dissociated.
H₂SO₄ dissolves in an aqueous solution to give out H₃O⁺ and HSO₄⁻ but the ions are partially dissociated
However, HCl is a stronger acid than H₂SO₄ because of the difference between the pKa values of both acids.
The \(pK_a\) value of HCl is -6.3 and the \(pK_a\) of H₂SO₄ is -2.8.
The smaller the \(pK_a\) value, the stronger the acid.
When HCl reacts with baking soda it gives out common salt, water, and carbon dioxide as gas. The reaction is exothermic
\(NaHCO_3 + 2HCl \rightarrow NaCl +H_2O + CO_2\)
Also, when H₂SO₄ reacts with baking soda it gives out sodium sulfate, water, and carbon dioxide as gas. The reaction is exothermic
\(2NaHCO_3+H_2SO_4 \rightarrow Na_2SO_4 +2H_2O + 2CO_2\)
Hence, HCl is a stronger acid than H₂SO₄ because of its \(pK_a\) value.
Learn more about acid:
https://brainly.com/question/25148363
#SPJ9
(b) Describe how copper sulfate solution is obtained from the plants used in
phytomining.
Plants are grown in soil that contains low grade ore. the plants absorb metal ions through their roots and concentrate these ions in their cells. the plants are harvested and burnt. the ash left behind contains metal compounds.
I hope this helps :)
if the reaction begins with 95.00 grams of cr2o3 and 183.0 grams of silicon, how many grams of the excess reactant will be used?
The limiting reactant is the one that is used up first and sets a limit on the quantity of product(s) that can be produced. Calculate the moles of each reactant present and contrast this ratio with the mole ratio of the reactants in the balanced chemical equation to determine the limiting reactant.
When a chemical reaction is complete, the limiting reagent—also known as the limiting reactant or limiting agent—is the reactant that has been completely consumed. Since the reaction cannot proceed without this reagent, the amount of product that can be produced is constrained. Excess reagents or excess reactants are any reagents that are present in amounts greater than those necessary to cause a reaction with the limiting reagent (sometimes abbreviated as "xs"). Since the amount of product produced when the limiting reagent interacts entirely is defined as the theoretical yield, the limiting reagent must be identified in order to calculate the percentage yield of a reaction. There are various equivalent techniques to determine the limiting reagent and assess the excess amounts of other reagents given the balanced chemical equation that describes the reaction.
Learn more about limiting reactant here
https://brainly.com/question/14222359
#SPJ4
An important industrial route to extremely pure acetic acid is the reaction of methanol with carbon monoxide:
The heat of reaction:
There has been a -22 kJ/mol heat of reaction. This is an exothermic reaction as the reaction has been indicated by the negative sign.
Definition of Heat of reaction:
The amount of energy that the system absorbs or releases to create the products is described as the heat of reaction.
The heat of reaction has been provided by:
ΔH = ΔH\(_{reactant}\) - ΔH\(_{product}\)
Calculation of Heat of reaction:
On the basis of the bond energies, the heat of the reaction has been estimated. The heat of the reactant served as the energy component of each bond in the reactant, while the heat of the product served as the energy of the product.
Step 1:
The heat of the reactant has been given as:
Reactant molecules: CH\(_{3}\)OH and C≡O
ΔH\(_{reactant}\) = 3 x C-H + C-O + O-H + C≡O
ΔH\(_{reactant}\) = 3 x 413 +358 +465 + 1070 kJ/mol
ΔH\(_{reactant}\) = 3134 kJ/mol
Step 2:
The heat of the product has been given as:
Product molecule: CH\(_{3}\)COOH
ΔH\(_{product}\) = 3 x C-H + C-O + O-H + C-C + C=O
ΔH\(_{product}\) = 3 x 413 + 358 + 467 + 347 + 745 kJ/mol
ΔH\(_{product}\) = 3156 kJ/mol
Step 3:
The heat of reaction has been given as:
ΔH = ΔH\(_{reactant}\) - ΔH\(_{product}\)
ΔH = 3134 - 3156 kJ/mol
ΔH = -22 kJ/mol
NOTE: Your question is incomplete, but most probably your full question was that an important industrial route to extremely pure acetic acid is the reaction of methanol with carbon monoxide. Use bond energies to calculate the heat of the reaction. Is the reaction exothermic or endothermic?
Learn more about bond energy here,
https://brainly.com/question/26141360
#SPJ4
3. Industrial strength laundry bleach is an aqueous solution containing 1.34 M sodium hypochlorite by mass. What is the mass percent of sodium hypochlorite of this solution
To find the mass percent of sodium hypochlorite in the industrial strength laundry bleach solution, we need to calculate the mass of sodium hypochlorite and the total mass of the solution.
First, let's assume we have 100 grams of the industrial strength laundry bleach solution. This means we have 100 grams of the solution containing 1.34 moles of sodium hypochlorite (NaOCl), as the solution has a concentration of 1.34 M.
The molar mass of sodium hypochlorite (NaOCl) is:
Na: 22.99 g/mol
O: 16.00 g/mol
Cl: 35.45 g/mol
So, the molar mass of NaOCl is:
22.99 g/mol + 16.00 g/mol + 35.45 g/mol = 74.44 g/mol
Now, let's calculate the mass of sodium hypochlorite in 1.34 moles:
Mass of sodium hypochlorite = 1.34 mol × 74.44 g/mol = 99.79 g
Therefore, in 100 grams of the industrial strength laundry bleach solution, there are 99.79 grams of sodium hypochlorite.
To find the mass percent, we divide the mass of sodium hypochlorite by the total mass of the solution (100 grams) and multiply by 100:
Mass percent of sodium hypochlorite = (99.79 g / 100 g) × 100% = 99.79%
The mass percent of sodium hypochlorite in the industrial strength laundry bleach solution is approximately 99.79%.
Learn more about hypochlorite ,visit;
https://brainly.com/question/6667369
#SPJ11
After hockey practice, Carissa and Keenan were playing a game where they were pushing some objects to get them to crash. They were using a cone and two different pucks—a black one with more mass for Crash 1 and a blue one with less mass for Crash 2. They want to know what happened to the cone. Use the information from the diagram to answer. In which crash did the cone experience a stronger force? How do you know?
The crash where the cone experience a stronger force is option D because: Crash 1: the force on the black hockey puck was stronger in this crash, so the force on the cone was also stronger.
Does it take a stronger force to slow something down?The ball is drawn back to Earth by gravitational force. The ball returns to Earth as a result of friction. The ball is forced back toward Earth by magnetic force.
A puck's velocity changes when a player makes contact with it when it is still. He causes the puck to speed up, in other terms. The hockey stick's force, which causes the acceleration, is responsible. The velocity grows as long as this force is in motion.
Therefore, the force applied to an object must be larger than what is required for a progressive slowing down if the object must be slowed down quickly. For instance, a bicycle's brakes will slow or stop it more quickly the more force is given to it.
Learn more about Force from
https://brainly.com/question/12785175
#SPJ1
See full question below
After hockey practice, Carissa and Keenan were playing a game where they were pushing some objects to get them to crash. They were using a cone and two different pucks—a black one with more mass for Crash 1 and a blue one with less mass for Crash 2. They want to know what happened to the cone.
Use the information from the diagram to answer.
In which crash did the cone experience a stronger force? How do you know?
answer choices
There was no force on the cone. In both crashes, only the hockey puck experienced a force.
The diagram doesn’t tell you anything about the force on the cone. It only gives information about the force on the pucks.
It was the same force in both crashes; the hockey puck changed speed by the same amount in each crash, so the force on the cone was the same each time.
Crash 1; the force on the black hockey puck was stronger in this crash, so the force on the cone was also stronger.
The hottest place in California is Death Valley with a record temperature of 130 ⁰F. Calculate the temperature in ⁰C and K.
Answer:
54.(4)° C (the 4 in the parentheses means the 4 goes forever), 327.594°K
Explanation:
When you convert 130°F to °C, you will get 54.(4)°C, and the 4 in the parentheses goes forever, and 130°F to °K is 327.594°K, hope it helps!
What kind of intermolecular forces act between a chloromethane molecule and a chloroacetylene molecule
Dipole to Dipole force
Explanation:
A dipole to dipole forces exists between these molecules
Is the c2cl4 molecule polar
Answer:
no
Explanation:
A NON-polar, totally symmetrical molecule like C2Cl4, known as tetrachloroethene, is used for DRY CLEANING clothes because it attracts to the non-polar grease stains that are NOT effectively removed by polar water molecules. The dry cleaning process is NOT dry at all (C2Cl4 is a liquid).
According to the molecular geometry,as C₂Cl₄ molecule is symmetrical it is non-polar.
What is molecular geometry?
Molecular geometry can be defined as a three -dimensional arrangement of atoms which constitute the molecule.It includes parameters like bond length,bond angle and torsional angles.
It influences many properties of molecules like reactivity,polarity color,magnetism .The molecular geometry can be determined by various spectroscopic methods and diffraction methods , some of which are infrared,microwave and Raman spectroscopy.
They provide information about geometry by taking into considerations the vibrational and rotational absorbance of a substance.Neutron and electron diffraction techniques provide information about the distance between nuclei and electron density.
Learn more about molecular geometry,here:
https://brainly.com/question/24232047
#SPJ2
The SI unit of weight is the same as that of force. What does this tell us about weight? Explain.
What is the biggest force this force meter can measure?
How big is the force lifting this stool?
.Draw a diagram to show yourself, standing on the ground. Add a force arrow to show your weight.
Answer:
It shows that weight is a form of force.
Explanation:
Basically, weight is the force exerted by your mass multiplied by the gravitational acceleration of the place you're standing in.
Question.05: (3 mrks) Neon gas in luminous tubes radiates red light-the original "neon light." The standard gas containers used to fill the tubes have a volume of 1.0 L and store neon gas at a pressure of 101 kPa at 22 °C. A typical luminous neon tube contains enough neon gas to exert a pressure of 1.3 kPa at 19 °C. If all the gas from a standard container is allowed to expand until it exerts a pressure of 1.3 kPa at 19 °C, what will its final volume be? If Lilia's sister Amelia is adding this gas to luminous tubes that have an average volume of 500 mL, what is the approximate number of tubes she can fill?
Answer:
Answer: The final volume of the gas will be 8.07 L.
Approximate number of tubes Amelia can fill = 8.07 L/500 mL = 16.14 tubes.
Balance the equation:THANK U IF U FIND IT!!
Answer:
\( ZnSO_4 + Li_2CO_3 \longrightarrow ZnCO_3 + Li_2SO_4 \)
Explanation:
Here a reaction is given to us and we need to balance the equation . The given reaction is ,
\( ZnSO_4 + Li_2CO_3 \longrightarrow ZnCO_3 + Li_2SO_4 \)
So here , we can make a table as ,
\(\begin{array}{c|c} \\ LHS & RHS \\\\ Zn = 1 & Zn = 1 \\\\ SO_4 = 1 & SO_4 =1\\\\ Li = 2 & Li= 2 \\\\ CO_3 = 1 & CO_3 = 1 \end{array}\)
We can see that the number of elements and ions is same on both LHS and RHS . Hence the reaction is already balanced .
Therefore the final reaction would be same as before that is ,
\( ZnSO_4 + Li_2CO_3 \longrightarrow ZnCO_3 + Li_2SO_4 \)
I hope this helps .
what someone in your chosen speciality does(one to two sentence)
Answer:
They breathe
Explanation:
Which of the following elements
is most likely to pair with sulfur
in a 1:1 relationship based on
valence electron trends?
A. Mg (2 valence
electrons)
B. Na (1 valence
electron)
C. Al (3 valence
electrons)
D. Li (1 valence
electron)
Answer:
A. Mg (2 valence
electrons)
Explanation:
combined they make what is commonly known as
milk of magnesia
used for indigestion
The chemical equation for a reaction is shown below.
2 NO2(g) → N2O4(g)
What is the standard free energy change (ΔGo) in this reaction at 298 K? (NOTE: At 298 K, ΔGfo for NO2 is 51.84 kJ/mol, and for N2O4 is 98.28 kJ/mol.)
The standard free energy change (∆Gº') is the energy released when the products are created from the reactants. The (∆Gº') at 298 K is -5.40kJ.
What is standard free energy change?The standard free energy change is given by the sum of the standard free energies of the products subtracted from the sum of the standard free energies of the reactants, given as,
ΔG = ∑nΔG°products − ∑mΔG°reactants
Given,
ΔG°(NO₂) = 51.84 kJ/mol
ΔG°(N₂O₄) = 98.28 kJ/mol
Substituting values:
ΔG = ∑nΔG°products − ∑mΔG°reactants
= ΔG°(N₂O₄) − 2ΔG°(NO₂)
= 98.28 − 2(51.84)
= - 5.4
Therefore, -5.40 kJ is the standard free energy.
Learn more about standard free energy here:
https://brainly.com/question/20351258
#SPJ1
___+___=__KOH+H2 It Is chemistry question
Answer:
It's from the quation:
\( \boxed{ \mathsf{ \underline{2K} +\underline{2 H_2O} \rightarrow \:\underline{2}KOH + H_2 }}\)
(How did I know?)
I learnt it while studying the elements of group 1.
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
Group 1 elements:K, here, is Potassium. It's position in the periodic table is Group 1, Period 4.
Group 1 elements are also called Alkali metals. Group 1 elements have 1 electron in their valence shell(outermost shell), the electron that takes part in chemical reactions.Valance electrons of elements of this group contribute to the valency of the group's elements I.e.,
valency of Alkali metals is 1!
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
Reaction with water:Alkali metals react vigorously with cold water to form their hydroxides alongwith the evolution of Hydrogen gas.What are hydroxides?
Hydroxides of an element comprises one atom each of oxygen and Hydrogen bonded together, acting as an anion, the hydorxide anion — OH-.
Example:
KOH (hydroxide of Potassium) NaOH (Hydroxide of Sodium)- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
Back to the question:In the question, The reactants are missing but the products are known, that are, Potassium Hydroxide and water.
Keeping the above mentioned property in mind, the reactants come clear as Potassium(K) and Cold water(H2O).
that makes the equation:
\( \mathsf{K + H_2O \rightarrow \: KOH + H_2 }\)
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
Balancing the equation:For an equation to be balanced, the number of atoms of each elements on both side of the equation must be equal.
Number of atoms of each element on the LHS:
K = 1 H = 2O = 1(subscript in front of an atom represents its number of atoms in the compund)
Number of atoms of each element on the LHS:
K = 1 H = 1 + 2 = 3O = 1The number of Hydrogen atoms on boths sides is NOT balanced!
Hit and trial method:
If we add a "2" in front of K, H2O and KOH
\( \mathsf{ \underline{2K} +\underline{2 H_2O} \rightarrow \:\underline{2}KOH + H_2 }\)
Number of atoms on both the sides become equal.
(TIP: This comes thru practice:/. but main point is even out the oxygen and Hydrogen atoms first. like if it's 3 multiply it by 2 and you get an even number, I.e., 6)
Number of atoms of each element on the LHS:
K = 2H = 4O = 2Number of atoms of each element on the LHS:
K = 2H = 2 + 2 = 4 O = 2- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
Answer:Hence, the balanced form of the equation is:
\( \boxed{ \mathsf{ \underline{2K} +\underline{2 H_2O} \rightarrow \:\underline{2}KOH + H_2 }}\)
Which substance is completely consumed in a chemical reaction?.
1. What volume of oxygen is needed to react with solid sulfur to form 3.5L SO2?
S + 02 > SO2
Answer:
Explanation: in same temperature amounts of moles are proportional
To volumes of gases. When one mole Oxygen reacts with Sulphur,
One mole Sulphur dioxide is formed. Thus 3,5 litres O2 is needed to produce same volume SO2
Calculate the concentration (m) of sodium ions in a solution made by diluting 50. 0 ml of a 0. 874 m solution of sodium sulfide to a total volume of 250. 0 ml.
The , ~0.350 M is the concentration (m) of sodium ions in a solution made by diluting 50. 0 ml of a 0. 874 m solution of sodium sulfide to a total volume of 250. 0 ml.
What is concentration ?
A solution's concentration is determined by the amount of solute it contains in a specific volume of solution.
What is volume ?
A solid shape's capacity is measured using volume, a three-dimensional quantity. It implies that a closed figure's volume determines how much three-dimensional space it can fill.
From the question it is clear that,
Initial volume of sodium sulphide solution is (v1) = 50mL
Initial concentration of sodium sulphide solution is (s1) =0.874 M
Final volume of sodium sulphide solution is (v2) = 250mL
Let, the final concentration of sodium sulphide solution is s2, then according to acidimetry-alkalimetry,
v1 * s1 = v2 *s2
Or, s2 = v1 * s1/v2
= 50 * 0.874 / 250
= 0.1748 M
Therefore, concentration of 250mL sodium sulphide solution is 0.1748 M
Since one mole Na2S ionized to give 2moles Na+ ion, hence concentration of sodium ion in the solution is (2 * 0.1748)M = 0.3496 M
~0.350 M
Therefore, ~0.350 M is the concentration (m) of sodium ions in a solution made by diluting 50. 0 ml of a 0. 874 m solution of sodium sulfide to a total volume of 250. 0 ml.
Learn more about concentration from the given link.
https://brainly.com/question/17206790
#SPJ4
How many fluorine atoms are present in 125.0g of phosphorus pentafluoride?
molar mass of PF5 = 125.966 g/mol
125 g PF5 × (1 mol PF5/125.966 g PF5) = 0.992 mol PF5
0.992 mol PF5 × (6.022 × 10^23 molecules PF5);
= 5.97 × 10^23 molecules PF5
Since there 5 fluorine atoms per molecule of PF5,
(5.97.× 10^23 molecules PF5) × (5 atoms F/1 molecule PF5)
= 2.99 × 10^24 atoms F
Which element is likely to react violently with water?
a) carbon
b) beryllium
c) cesium
d) sulfur
I think the answer is beryllium.
because it's not sulfur or carbon and probably not cesium
L.
Use a pencil and draw a line in the sequences below for
species A and species B to show where the catalyst
would cut the DNA.
Species A AATTGGCCTAATTAATTCGG CCTAG
Species B: AATTCCTACGG CCTAGCCTTTAATT
The catalyst BamH1 will cut the DNA as follows:
Species A: AATTG | GCCTAATTAATTCG | GCCTAG
Species B: AATTCCTACG | GCCTAGCCTTTAATT
What are restriction endonucleases?Restriction endonucleases or restriction enzymes are enzymes that cleave DNA into pieces at or close to particular recognition regions inside molecules called restriction sites.
EcoRI, BamH1, and smaI are some examples of restriction endonucleases.
BamHI is a type II restriction enzyme that recognizes the DNA sequence "GGATCC" and cuts the DNA at in between G and G.
Learn more about restriction endonucleases at: https://brainly.com/question/1127662
#SPJ1
Describe how
electrical energy is used in a printer
pls help me ASAP
Answer:
The primary principle at work in a laser printer is static electricity, the same energy that makes clothes in the dryer stick together or a lightning bolt
Explanation: