Fill in the complementary DNA strand (template strand). Then transcribe \& translate these bacterial ORFs (open reading frame) from DNA sequence into mRNA / polypeptide. These are the non-template strands. 5'TCAATGGAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATTGACACT 3 ' 5′GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTtAACCCCGGA 3 ′

Answers

Answer 1

Complementary DNA strand:3' AGTTACCTTGCGCGATGGGCCTCGAGACCCGGGTTAAAAGTAACGTGTG 5'Transcription is the process of producing an RNA molecule from a DNA template, while translation is the process of producing a polypeptide chain from an RNA molecule.

Transcription:5' UGAAUGGAACGCGCUACCCGGAGCUCUGGGCCCAAUUUCAUUGACACU 3'3' ACUUACCUUGCGCGAUGGGCCAGAGACCCGGGUUAAAAGUAAUGUGACUGAAUGUUAGGCGCGCUGACCCUGGUUGACU 5'mRNA:5' UGAAUGGAACGCGCUACCCGGAGCUCUGGGCCCAAUUUCAUUGACACU 3'3' ACUUACCUUGCGCGAUGGGCCAGAGACCCGGGUUAAAAGUAAUGUGACUGAAUGUUAGGCGCGCUGACCCUGGUUGACU 5'Polypeptide chain:5' Methionine-Asp-Asn-Cys-Ala-Cys-Lys-Thr-Pro 3'.

To find the complementary DNA strand (template strand), we can simply replace each nucleotide with its complementary base:

5' TCAATGGAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATTGACACT 3'

3' AGTTACCTTGCGCGATGGGCCTCGAGACCCGGGTTTAAAGTAACTGTGAA 5'

Now, let's transcribe each of the open reading frames (ORFs) into mRNA and translate them into polypeptides.

ORF 1 (Starting from the first AUG codon):

DNA: 5' TCAATGGAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATTGACACT 3'

mRNA: 3' AGUUAUCCUUGCUCGAUGGGCCUCGAGACCCGGGUUAAAUAAUGACACU 5'

Polypeptide: Ser-Tyr-Pro-Cys-Arg-Val-Ser-Asp-Pro-Gly-Phe-Lys-Ile-Cys-Th

ORF 2 (Starting from the second AUG codon):

DNA: 5' GGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTtAACCCCGGA 3'

mRNA: 3' CCAUAGCUACGGGAUUUUCUCAAUUGUAUAACGACCUCCGCAttUUGGGGCCU 5'

Polypeptide: Pro-Tyr-Leu-Arg-Asp-Phe-Ser-Asn-Val-Asn-Asp-Pro-His-Leu-Gly-Pro

Please note that the lowercase "t" in the DNA sequence represents a potential mutation and should be interpreted as "T" when transcribing and translating.

learn more about DNA

https://brainly.com/question/32072734

#SPJ11


Related Questions

Which reasons are the best for using only the fine-focus knob under high power? Select two.

The diaphragm will not open wide enough by using the fine-focus knob.

The stage or objectives move very little when the knob is turned.

The objective will not move enough to risk breaking the glass slide.

The coarse-focus knob will not turn when the microscope is set for high power.

Answers

Under high power, only the fine-focus knob should be used: When the knob is turned, neither the stage nor the goals move much. The objective won't move fast enough to put the glass slide at risk.

Option B and C are  correct.

What exactly are the purposes of microscopes?

A microscope is a tool for magnifying small objects. Some microscopes can be used to study an object even at the cellular level, allowing researchers to observe the shape of a cell as well as its nucleus, mitochondria, and other organelles.

To precisely adjust the specimen's focus, use the Fine Focus knob. Also, featuring explicit region of the specimen is utilized. Before switching to the fine focus knob for fine tuning, the coarse focus knob should be used frequently to get close. Move the fine adjustment knob with care in your body's direction. You might not be able to turn this knob all the way around.

Incomplete question:

Which reasons are the best for using only the fine-focus knob under high power? Select two.

A. The diaphragm will not open wide enough by using the fine-focus knob.

B. The stage or objectives move very little when the knob is turned.

C. The objective will not move enough to risk breaking the glass slide.

D. The coarse-focus knob will not turn when the microscope is set for high power.

To learn more about microscope :

brainly.com/question/820911

#SPJ1

g what is the relationship between glycolysis and cancer? group of answer choices cancer cells lack a glycolytic pathway cancer cells use a modified version of glycolysis cancer cells exhibit a much higher level of anaerobic glycolysis than normal cells none of these

Answers

Anaerobic glycolysis is significantly more prevalent in cancer cells than in healthy cells. The Warburg effect is the name given to this phenomena.

The metabolic process known as glycolysis produces both ATP (adenosine triphosphate) and NADH simultaneously when it breaks down the sugar glucose into pyruvate (nicotinamide adenine dinucleotide). It takes place in the cytoplasm of cells in all living beings and is the initial stage in the breakdown of carbohydrates. The general response can be expressed as:

Pyruvate + NADH + 2 ATP + 2 H2O = glucose + 2 NAD+ + 2 ADP + 2 Pi

It is an anaerobic process, which means that oxygen is not necessary for it to take place and that it can still take place without it. In fact, many cells and bacteria that lack oxygen use glycolysis as their main source of energy.

To know more about glycolysis please refer:

https://brainly.com/question/15159050

#SPL4

Is it a good or bad thing that minerals are present in water?​

Answers

Answer: Tap water contains added minerals, including calcium, magnesium, and potassium. Hard tap water has higher mineral contents, which some consider more healthful. However, minerals in hard water form deposits that can corrode pipes or restrict the flow.Apr 9, 2019

Explanation:

Anemia is a medical condition in which the affected person lacks enough red blood cells. What two effects will such a condition have on the patient?

The patient will have less hemoglobin in the blood.
The patient will have less immunity against bacteria.
The patient will have a reduced oxygen supply to the cells.
The patient will have a thicker blood composition.
The patient will have increased platelets in the body.

Answers

Answer:

very truthful

The patient will have less hemoglobin in the blood.

The patient will have a reduced oxygen supply to the cells.

name the product of the process known as chemiosmosis

Answers

Chemiosmosis is involved in the generation of adenosine triphosphate (ATP), the primary chemical used by the cell for energy.

What do you mean by chemiosmosis?

Chemiosmosis is the passage of ions down an electrochemical gradient over a semipermeable membrane bound structure. The generation of adenosine triphosphate (ATP) by the transport of hydrogen ions (H+) across a membrane during cellular respiration or photosynthesis is a good example. When ions flow through a channel, they generate potential energy, which can be used to power chemical reactions (red). Hydrogen ions, or protons, will diffuse from a high proton concentration zone to a low proton concentration region, and an electrochemical concentration gradient of protons across a membrane can be used to generate ATP. This process is similar to osmosis, the passage of water through a selective membrane, which is why it is named "chemiosmosis".

Learn more about the chemiosmosis here:

https://brainly.com/question/896642

#SPJ4

describe how the position of the Earth Moon and Sun can be detected on Earth​

Answers

Answer:

As the Earth rotates, it also moves, or revolves, around the Sun. As the Earth orbits the Sun, the Moon orbits the Earth. The Moon's orbit lasts 27 1/2 days, but because the Earth keeps moving, it takes the Moon two extra days, 29 1/2, to come back to the same place in our sky.

Explanation:

What process is happening to this population of rabbits? (The answer is NOT natural selection. What is natural selection causing to happen?)

Answers

The culprit was discovered to be rabbit hemorrhagic disease, a virus so deadly it has been likened to a plague. The disease, which has a mortality rate as high as 70%, had previously devastated rabbit and hare populations in China, Europe and Australia, first reaching domestic rabbits in the United States in 2018

why do some foods have a desired taste while others are repulsive?

Answers

The taste of food is determined by a combination of factors such as the food's chemical composition, the individual's genetics, and their past experiences with that particular food.

When we eat food, our taste buds send signals to our brain, which interprets the signals as either pleasurable or unpleasant. Foods that contain a balanced combination of sweet, salty, sour, and bitter tastes are usually more desirable than those that lack a balance or are overwhelmingly strong in one taste.

                             Additionally, some individuals may have a genetic preference for certain tastes or textures. Past experiences with a food can also affect one's perception of its taste, as negative experiences such as food poisoning or childhood aversions can create a repulsive response. Ultimately, taste is subjective and can vary greatly from person to person.

Cultural influences: Cultural background and upbringing can affect the types of foods people find appealing or repulsive. Certain flavors or ingredients may be more common in one culture than another, and individuals may develop a preference for those specific tastes.

Basic tastes: Our taste buds can detect five basic tastes – sweet, salty, sour, bitter, and umami (savory). Foods with a desired taste often contain a balance of these basic tastes, while repulsive foods may have an overwhelming presence of one or more of these tastes.

In conclusion, the perception of a food's taste as desirable or repulsive depends on personal preferences, cultural influences, and the balance of the basic tastes detected by our taste buds.

Learn more about food's chemical composition

brainly.com/question/8286678

#SPJ11

PLSSS HELPPP MEEE WITH THIS QUESTIONNNNN NO GUESSING PLSSSS
Which process is shown in the plant cell below?

A= cell growth
B= cell reproduction
C= metamorphosis
D= photosynthesis

PLSSS HELPPP MEEE WITH THIS QUESTIONNNNN NO GUESSING PLSSSSWhich process is shown in the plant cell below?A=

Answers

the answer is B = cell reproduction

The given process shown in the image is cell reproduction. Cell reproduction takes place by mitosis and meiosis.

What is cell reproduction?

Mitosis and meiosis are the two distinct processes of cell division. When people talk about "cell division," they typically mean mitosis, which is the process of creating new cells for the body. The cell division process known as meiosis is what produces egg and sperm cells.

A vital process for life is mitosis. A cell divides into two identical daughter cells after duplicating all of its components, including its chromosomes. Due to the importance of this procedure, specific genes carefully regulate each phase of mitosis.

Meiosis, the second sort of cell division, makes sure that each generation of people has the same number of chromosomes.

Therefore, The given process shown in the image is cell reproduction. Cell reproduction takes place by mitosis and meiosis.

To learn more about cell division, refer to the link:

https://brainly.com/question/13312481

#SPJ2

Where are unassembled or misfolded proteins often transported to for degradation?the cytosolthe nucleusthe ribosomethe secretory vesiclesMisfolded proteins can be degraded in all of these locations.

Answers

Misfolded proteins can be transported to multiple locations for degradation, including the cytosol, nucleus, ribosome, and secretory vesicles. Thus, the correct answer is "Misfolded proteins can be degraded in all of these locations" (Option E).

The specific location may depend on the type of misfolded protein and the cellular machinery available for degradation. For example, chaperones in the cytosol can help refold some misfolded proteins, while the proteasome can degrade misfolded proteins in the nucleus and cytosol. Additionally, misfolded proteins in the secretory pathway may be transported to secretory vesicles for degradation or retrotranslocation back to the cytosol for proteasomal degradation.

Learn more about misfolded proteins: https://brainly.com/question/30886247

#SPJ11

urban environments and metropolitan areas are making gradual advances into natural wildlife habitats. these gradual advances have negative consequences: some animals are perishing from habitat loss. which choice most effectively combines the sentences? choose 1 answer: urban environments and metropolitan areas are making gradual advances into natural wildlife habitats, and these gradual advances have negative consequences, because some animals are perishing from habitat loss. urban environments and metropolitan areas are making gradual advances into natural wildlife habitats, resulting in negative consequences: some animals are perishing from habitat loss. urban environments and metropolitan areas are making gradual advances into natural wildlife habitats; these advances have negative consequences: some animals are perishing from habitat loss. urban environments and metropolitan areas are making gradual advances into natural wildlife habitats, and with negative consequences, because some animals are perishing from habitat loss.

Answers

Option d is Correct. The option that more successfully blends the sentences at the highlighted area is urban habitats, and with adverse effects.

The city and its environs are both considered to be part of an urban area. Metropolitan areas, or "greater" as in Greater New York or Greater London, are the names given to several urban regions. A megalopolis is created when two or more metropolitan regions expand to the point of union.

A heavily populated urban agglomeration and its surrounding areas that share infrastructure, business districts, transportation networks, and housing make up a metropolitan area, or metro. Functional urban areas (FUAs) having a population more than 500 000 are referred to as metropolitan areas.

Learn more about habitats Visit: brainly.com/question/20319955

#SPJ4

Correct Question:

Urban Which choice most effectively combines the sentences at the underlined portion?

a. habitats, and these gradual advances have negative consequences.

b. habitats, resulting in negative consequences.

c. habitats; these advances have negative consequences.

d. habitats, and with negative consequences.

In a Gram stain, one step could be omitted and still allow differentiation between Gram-positive and Gram-negative cells. What is that step

Answers

In a Gram stain, one step could be omitted and still allow differentiation between Gram-positive and Gram-negative cells. The step that can be omitted and still allow differentiation between Gram-positive and Gram-negative cells in a Gram stain is the alcohol decolorization step.

The decolorization step is the crucial step in the Gram staining technique. In this step, a decolorizing agent such as ethanol or acetone is added. In a Gram-negative cell, the cell wall has a higher lipid content than the cell wall of Gram-positive bacteria. The decolorization step will dehydrate the thinner peptidoglycan layer of Gram-negative bacteria, thereby rendering the cell wall permeable to the crystal violet-iodine complex.

As a result, the color of the Gram-negative cell will fade due to the removal of the primary stain. On the other hand, the thicker peptidoglycan layer in Gram-positive bacteria traps the crystal violet-iodine complex, making it harder to remove during decolorization. Therefore, Gram-positive bacteria will retain the primary stain and appear purple under the microscope.

Know more about alcohol decolorization step here,

https://brainly.com/question/31314013

#SPJ11

in general, a muscle that crosses on the anterior side of a joint produces ________.

Answers

Answer: Flexion

Explanation:A muscle that crosses on the anterior side of a joint produces flexion. A muscle that crosses on the posterior side of a joint produces extension.

Answer: Flexion

Explanation:

What is the potential energy of a 17 kg object that is at a height of 25 m?

Answers

The potential energy of the 17 kg object that is at a height of 25 m is 4,226.25 joules.

What is potential energy?

The energy that is present in the object in the state of its rest is called potential energy.The potential energy of an object is given by the formula:

                   Potential Energy = mass x gravity x height

Where, m is the mass of the object, gravity is the acceleration due to gravity, and height is the height of the object above a reference point.

In this case, the mass of the object is 17 kg, the height is 25 m, and the acceleration due to gravity is 9.81 m/s^2.

Plugging in these values into the formula, we get:

Potential Energy = 17 kg x 9.81 m/s² × 25 m

Potential Energy = 4,226.25 J

Therefore, the potential energy of the 17 kg object that is at a height of 25 m is 4,226.25 joules.

Learn more about potential energy, here:

https://brainly.com/question/24284560

#SPJ1

When red snapdragon flowers and white flowers are crossed, pink flowers are produced . Cross a pink flower with a red flower. ( You definitely should make a Punnett Square) THERE ARE 3 ANSWERS TO THIS QUESTION: A) Is this codominance or incomplete dominance ? B) Genotype Ratio C) Phenotype Ratio​

Answers

Suppose red is R, white=W, pink=RW

(Punett square is attached)

A) Incomplete dominance

B) 1:1

C) 1:1

When red snapdragon flowers and white flowers are crossed, pink flowers are produced . Cross a pink flower

This is my last question can you guy help me.

thank you​

This is my last question can you guy help me.thank you

Answers

Answer:

Coasts are sensitive to sea level rise, changes in the frequency and intensity of storms, increases in precipitation, and warmer ocean temperatures.

How does an epigenetic change differ from a mutation?.

Answers

Answer:

epigenetic changed are reversible and do not change your DNA sequence, but they can change how your body reads a

DNA sequence

what is the most common way an active transport occurs in a cell

Answers

The most common way that active transport occurs in a cell is through the transport proteins that are located at the cell membrane of the cell.

What is a cell?

A cell is defined as the structural and functional unit of a living organism that is made up of membrane bound proteins that functions together for the benefit of the cell.

The semi permeable membrane that surrounds the cell is called the cell membrane and it allows the passage of some substances while refusing the passage of others.

The process it uses for transport is called active transport which occurs in a cell is through the transport proteins that are located at the cell membrane of the cell.

Learn more about cell here:

https://brainly.com/question/26122239

#SPJ1

The first hormone to be made by recombinant bacteria was ________. Select one: A. Insulin B. Glucagon C. Somatostatin D. Testosterone

Answers

The answer is A (insulin)

______genetic traits that give an advantage to an individual and can be passed on to offspring

Answers

Adaptive genetic traits that give an advantage to an individual and can be passed on to offspring.

What is adaptive trait ?

Adaptation is an evolutionary process which fits organisms to their changing environment and increases their evolutionary fitness.

It can be phenotypic or adaptive trait in each individual organism evolved by natural selection.

Structural adaptations are the changes in  external and internal structures of animals which help them to adapt their environment.

Behavioral adaptation include Action and behavior for survival against the changing environment.

Physiological adaptations help the organisms to live and survive in their environment with unique niches like hibernation and aestivation.

For more details regarding adaptive trait, visit:

https://brainly.com/question/1596691

#SPJ1

the origin that the vastus medialis muscle shares with the vastus lateralis is the

Answers

The vastus medialis muscle shares its origin with the vastus lateralis at the intertrochanteric line of the femur.

The vastus medialis and the vastus lateralis are two of the four muscles that make up the quadriceps muscle group in the thigh. These muscles play a crucial role in extending the leg at the knee joint. While each muscle has its own distinct attachments and functions, they also share a common origin.

The vastus medialis originates from the medial (inner) side of the femur, specifically at the intertrochanteric line. This line is a bony ridge located on the posterior aspect of the femur, between the greater trochanter and the lesser trochanter. The vastus lateralis, on the other hand, originates from the lateral (outer) side of the femur, near the greater trochanter. Therefore, both muscles share a common starting point at the intertrochanteric line of the femur.

From their shared origin, the muscle fibers of the vastus medialis and vastus lateralis extend downward and converge to form the quadriceps tendon, which inserts onto the patella and eventually continues as the patellar tendon to attach to the tibia. This arrangement allows for coordinated contraction of the quadriceps muscles to produce powerful extension of the leg.

Find more about vastus medialis in:

https://brainly.com/question/3312364

#SPJ11

Which steps are important when designing and conducting a scientific experiment

Answers

Forming an hypothesis, gathering materials, performing your experiment, and determining the conclusion. Also determining independent and dependent variables could be one depending on the teacher. Sorry if I’m wrong!

I'll cashapp you 10$​

I'll cashapp you 10$

Answers

Answer:

The carpal region is distal to the brachial region.

Explanation:


Where would you least
likely find a new
volcano?
A. Mid-ocean ridge
B. "Hot spot" in Hawaii
C. The great plains in the middle
of the U.S.
D. Near a subduction zone in
Argentina
Secon2015
I NEED TO KNOW ASAP

Answers

Answer:

A. Mid-ocean ridge. I'm not sure if I'm right.

The place where the new volcanoes are less likely to be seen is mid-ocean ridge. The correct option is A.

What is volcano?

A volcano is a crack in the crust of a planet, such as Earth, that allows hot lava, volcanic ash, and gases to escape from a magma chamber beneath the surface.

Volcanoes are most commonly found where tectonic plates are diverging or converging on Earth, and the majority are found underwater.

Although Australia is the only continent with no active volcanoes, it does have one of the world's largest extinct volcanoes, the Tweed Volcano.

Volcanism is directly related to plate tectonics theory. Volcanoes are only found at specific types of plate boundaries, and only rarely in the middle of ocean plates.

Thus, the correct option is A.

For more details regarding volcanoes, visit:

https://brainly.com/question/12945128

#SPJ2

leah is in a meeting. she is cold, so she crosses her arms and legs. paul observes this and thinks leah does not like the information she is receiving. if leah would speak up, this barrier could be eliminated_.

Answers

While nonverbal cues can sometimes be misleading, they can also provide important insights into a person's emotional state. If there are concerns about communication barriers in a meeting, it is important to encourage open dialogue and ensure that everyone feels comfortable sharing their thoughts and opinions.

Nonverbal cues, such as crossing arms and legs, can sometimes be misleading. It is important to remember that different people have different comfort levels when it comes to physical temperature, and what might be comfortable for one person might be too cold or too hot for another. Therefore, it is not necessarily safe to assume that Leah's crossing of her arms and legs is indicative of her dislike of the information she is receiving.
However, it is also important to note that nonverbal cues can indeed reflect a person's emotional state. In this case, it is possible that Leah is feeling uncomfortable or disengaged for reasons unrelated to the temperature in the room. If Paul is concerned that Leah is not fully engaged in the meeting, it might be helpful for him to reach out to her and ask if she has any questions or concerns about the information being presented. Encouraging her to speak up could help eliminate any potential barriers to communication and ensure that everyone in the meeting is on the same page.
In summary, while nonverbal cues can sometimes be misleading, they can also provide important insights into a person's emotional state. If there are concerns about communication barriers in a meeting, it is important to encourage open dialogue and ensure that everyone feels comfortable sharing their thoughts and opinions.

learn more about communication

https://brainly.com/question/30881541

#SPJ11

Recovery Where are the majority of chloroplasts found? A. in animal cells B. in prokaryotes C. in rose petals D. in the leaves of plants​

Answers

Answer:

D

Explanation:

In plants, chloroplasts occur in all green tissues, though they are concentrated particularly in the parenchyma cells of the leaf mesophyll.

Which system controls the menstrual cycle in human females. Please help ASAP. :)

Which system controls the menstrual cycle in human females. Please help ASAP. :)

Answers

Answer:

The answer is option A.

Endocrine system

Hope this helps.

You are a scientist on the soloman islands. You are assigned with making recommendations

Answers

Biodiversity Conservation: The Solomon Islands are home to rich biodiversity, containing singular environments and endangered class.

What is the recommendations?

It is important to plan out biodiversity preservation through system which controls organization and administration of protected fields, in the way that nationwide parks and sea reserves

Climate Change Adaptation: The Solomon Islands are vulnerable to the impacts of temperature change, containing climbing ocean levels, raised frequency of extreme weather occurrences, and sea acidification. It is main to expand and implement agreement actions that focus on marshy care, tenable land use preparation, and trend-resilient foundation

Learn more about  Solomon islands from

https://brainly.com/question/30038275

#SPJ1

The region inside the cell except for the nucleus

Answers

Answer:

cytoplasm

Explanation:

the cytoplasm is all of the material within a cell, enclosed by the cell membrane, except for the cell nucleus. The material inside the nucleus and contained within the nuclear membrane is termed the nucleoplasm.

The region inside the cell except for the nucleus is cytoplasm. Except for the cell nucleus, the whole contents of a cell that are protected by the cell membrane are known as the cytoplasm.

What is cytoplasm?

The cytoplasm is a region in eukaryotic cells that is situated between the nuclear membrane and the plasma membrane.

Typically, the cytoplasm is split into two halves. Ectoplasm, the outermost area, is more viscous and is referred to as such. The endoplasm, which is found in the innermost part, is more fluid.

Except for the cell nucleus, the whole contents of a cell that are protected by the cell membrane are known as the cytoplasm. Nucleoplasm is the name for the substance that makes up the nucleus and is enclosed within the nuclear membrane.

Therefore, the area except for the nucleus in the cell is the cytoplasm, which is filled inside the cell.

To learn more about cytoplasm, refer to the link:

https://brainly.com/question/9492242

#SPJ6

Chlorophyll is an accessory pigment in plants.


True

False

Answers

Answer:

True

Explanation:

it is a pigment used in the process of photosynthesis and also gives the plant it's green colour.

The answer is true because i did some research into it
Other Questions
What is a good hook intro for a memoir project that is about not giving up? design a context-free grammar (cfg) for the following language (20 points). if your grammar has multiple variables, please briefly describe the strings derived by each variable of your grammar (5 points, please see the lecture notes on cfg design for examples). lL={aibi| 3i=0, j >=0} Candidates who complete the iacis test successfully are designated as a _______. X-ray pulses from Cygnus X-1, a celestial x-ray source, have been recorded during high-altitude rocket flights. The signals can be interpreted as originating when a blob of ionized matter orbits a black hole with a period of 7.84 ms. If the blob were in a circular orbit about a black hole whose mass is 13.5 times the mass of the Sun, what is the orbit radius? The value of the gravitational constant is 6.672591011Nm2/kg2 and the mass of the Sun is 1.9911030 kg. Answer in units of km. im having trouble with these problems #2 and #3 Julia correctly estimated the value of 183+ (76-15) +29 by rounding each number to the nearest ten. What wasJulia's estimation?020 0 0 0332O 33 Ethical decision making is vulnerable to the forces of System 1. People behave differently in the face of a potential loss versus a potential gain, even when the two situations are transparently identical. Across three experiments, decision makers engaged in more unethical behavior if a decision was presented in a loss frame than if the decision was presented in a gain frame. In one of the experiments, the tendency to be less ethical in the loss-frame condition occurred under time pressure but was eliminated through the removal of time pressure. What is the DV in this experiment Please i need help on spanish lesson When the balance-of-payments accounts are recorded correctly, the combined balance of the current account, the capital account, and the reserves account must be a) equal in magnitude to the country's national debt.b) zero.c) equal in magnitude to the Trade Deficit or Surplus.d) none of the above Which of the kickoff meeting elements below illustrates effective team building?a. Allow team members to discuss their levels of expertiseb. Explain how often the project will require meetingsc. Review governance documentationd. Define reporting requirements let f be a function from the set a to the set b. let s and t be subsets of a. show that What is the #1 top technical certification in 2022 to achieve the highest salary according to the video on the robert half report? true or false: there is only one way to calculate the modified irr. True/ False One of the most important tasks of the international monetary fund is to provide low interest or no interest loans to developing countries. What would have happened to Matilda if she had confessed to her friend that she had lost her necklace? Directions: Think of the possible current issues as many as you can, basing from thedifferent images below. help me please A talented designer who cannot meet deadlines will most likely struggle to find work.TrueFalse Gorillas may look threatening, but they are peaceful and family-oriented animals. They are the largest of all primates, but as plant-eating animals, do not bother other creatures. Which choice best paraphrases the information? Order the following choices to reflect the pathway of blood starting with deoxygenated blood from the body, through the heart and lungs, and ending with oxygenated blood to the body.o Left atrium and left ventricleo Pulmonary veins from the lungso Superior vena cavao Aortao Right atrium and right ventricleo Pulmonary arteries to the lungs dried pigeon droppings are a potential source of infection with ________.