The property of a neuron that is best exemplified by observing changes in an electrical charge passing down its plasma membrane is its ability to conduct electrical impulses, also known as its excitability or electrical excitability.
Neurons are specialized cells that form the building blocks of the nervous system. One of the key functions of neurons is to transmit electrical signals, known as action potentials, along their plasma membrane. This process is made possible by the neuron's ability to generate and propagate changes in electrical charge.
When a neuron receives a stimulus, such as a chemical signal or sensory input, neurotransmitter it can undergo a change in its membrane potential, resulting in depolarization. This change in electrical charge triggers the opening of voltage-gated ion channels, allowing the flow of ions across the membrane and the propagation of the electrical impulse.
By observing changes in the electrical charge passing down the plasma membrane of a neuron, researchers can study its ability to transmit and process information. This property of neurons, known as electrical excitability or the ability to conduct electrical impulses, is fundamental to their role in transmitting signals within the nervous system and facilitating communication between different parts of the body.
Learn more about neurotransmitter here
https://brainly.com/question/13567672
#SPJ11
Help me pleaseeeeee. This is my last question.
Answer:
I think its Obsidian Extrusive.
Explanation:
Answer:
I think number 4
Explanation:
For the laboratory some students put a strip of shiny metal into a beaker of blue solution and then stored the beaker on a shelf overnight. The next morning , the students recorded observations about the metal and the solution in the box below Based on their observation, can the students correctly conclude that a chemical reaction occurred ?
Answer:
Yes, because a new material of a different color formed on part of the metal strip
Explanation: Good luck!
HELP :/ pleaseeeeeeeeeee
Steep Slopes
Explanation:
Landslides occur when the slope undergoes some processes that changes its condition from stable to unstable.
in a hypotonic Solution, the concentration of solutes outside
the cell is lower than the?
A) concentration of fluid in
membrane
B) concentration or osmosis in membrane
C) concentration of diffusion in membrane
D) concentration of solutes in cell
Answer:
If a cell is placed in a hypotonic solution, there will be a net flow of water into the cell, and the cell will gain volume. If the solute concentration outside the cell is lower than inside the cell, and the solutes cannot cross the membrane, then that solution is hypotonic to the cell.
Explanation:
correct me if I'm wrong thank you
sorry this is only what I know thanks
#rightkeycee
how gender brains differ?
The main biological difference between the brain of women and men it's related to its volume. Since cis women gender (women who identify with the sex they were born with, i.e they have feminine reproductive organs ) is usually smaller than cis man gender ( men who identify with the sex they were born with, i.e masculine reproductive organs), usually their brain (women's) is also smaller than men. This difference of volume usually brings rigged other characteristics too, e.i smaller brains allow a slightly bigger proportion of grey matter compared to white matter, and more connection between both hemispheres (which is related to multitasking) compared with the connections inside each one of them.
When the air inside a school gets warmer (temperature increases) the molecules of air move faster. True or False?
Explanation:
yes this is in fact true
True
Explanation:
The molecules react to the temperature
What are the main types of cells found in blood? (Choose all that apply)
white blood cells
plasma
platelets
red blood cells
Answer:
Red Blood cells
White blood cells
Explanation:
The blood is a initially a colourless pigment that flows through vessels, but because of the haemoglobin in the red blood cells, it makes it a red pigment.
Metabolic syndrome is most strongly associated with which condition?.
Answer: Abdominal obesity
Explanation: Abdominal obesity is the form of obesity most strongly associated with the metabolic syndrome.
REPOST ANSWER FAST PLEASE need help with this question
The steps of the Calvin cycle into the correct order from top to bottom include:
D) Six carbon dioxide molecules combine with six 5-carbon molecules of RuBP to form twelve 3-carbon molecules of 3-PGA.
B) Rubisco converts ten G3P molecules into 5-carbon molecules of RuBP.
C) The chemical energy stored in ATP and NADPH is transferred to the 3-PGA molecules to form twelve G3P molecules.
A) Two G3P molecules leave the cycle to be used for the production of glucose and other organic molecules.
What is the Calvin cycle?A sequence of chemical processes known as the Calvin cycle, also known as the biosynthetic phase, dark reactions, or photosynthetic carbon reduction cycle of photosynthesis, transform carbon dioxide and hydrogen-carrier molecules into glucose.
The C3 cycle is another name for the Calvin cycle. The process through which sugars are formed out of the carbon from the carbon cycle.
Learn more about Calvin cycle on:
https://brainly.com/question/920840
#SPJ1
In what way might the introduction of the invasive species of feral cats and red foxes, affect the native species on the island?
Cats can contribute to conflict because of the direct and indirect effects they have on local wildlife, including affects on species survival, disease transmission, competition, and predation.
What exactly qualifies as a disease?Any undesirable variation from an organism's normal physiological or structural condition is referred to as a disease. Diseases typically have specific signs and symptoms or are different from physical injuries in nature. A diseased organism frequently displays symptoms or indicators that point to its aberrant condition.
What triggers illness?The five types of pathogenic organisms include viruses, bacteria, fungus, protozoa, and helminths. Often considered parasites, protozoa and worms are the focus of the field of parasitology, whereas microbiology studies viruses, bacteria, and fungi.
To know more about Disease visit:
https://brainly.com/question/8611708
#SPJ1
Turtles, alligators, and crocodiles are thought to be related to dinosaurs. What is the main source of evidence that scientists use to show this relationship and how these organisms may have changed over time?
Hair samples
Fossil records
Photographs of dinosaurs
Direct observations
Answer:
Fossil record
Explanation:
This is because fossil record has been the main evidence of evolution in Biology
What would happen if a small butterfly became extinct?
Answer:
it would become extinct and everyone would be very sad
Explanation:
Answer:
hmm.......Without them, people will not enjoy chocolates, apples, coffee and other foods that have become vital in our daily existence. Nearly 75 percent of the food crops worldwide depend on these pollinators, therefore, their existence and health affect the food production.
Explanation:
which of the following components form part of a company's macro-environment?
The components that form part of a company's macro-environment are; Legal/regulatory conditions, Political factors, and Sociocultural forces. Option A, B, and E is correct.
Legal/regulatory conditions; These encompass the laws, regulations, and policies established by the government or regulatory bodies that affect the operations and activities of a company. They include areas such as labor laws, environmental regulations, consumer protection laws, and industry-specific regulations.
Political factors; These refer to the political environment in which a company operates, including government stability, political ideology, trade policies, taxation policies, and political influence on business operations.
Sociocultural forces; These represent the social and cultural aspects that influence a company's operations, such as demographics, social values, consumer attitudes, lifestyle trends, cultural norms, and societal expectations.
Hence, A. B. E. is the correct option.
To know more about macro-environment here
https://brainly.com/question/29528341
#SPJ4
--The given question is incomplete, the complete question is
"Which of the following components form part of a company's macro-environment? A. legal/regulatory conditions B. political factors C. ancillary communications D. historical incentives E. sociocultural forces."--
what process occurs in the cytoplasm at the ribosome in the process of protein synthesis
Answer:
translation
Explanation:
The molecule of mRNA then leaves the nucleus and goes to a ribosome in the cytoplasm, where translation occurs. During translation, the genetic code in mRNA is read and used to make a protein. These two processes are summed up by the central dogma of molecular biology: DNA → RNA → Protein.
what do smooth muscle cells look like under a microscope?
a. smooth, 1 nuclei, and connected by gap junctrions
b. small, striated, and 1-2 nuclei per cell
c. long and thin with striations and multiple nuclei
how many protons are pumped out of the mitochondrial matrix for each pair of electrons extracted by the enzyme isocitrate dehydrogenase??
Isocitrate dehydrogenase is not directly involved in pumping protons, it plays a crucial role in generating electron carriers.
Isocitrate dehydrogenase is an enzyme involved in the citric acid cycle, which generates electron carriers such as NADH and FADH2 that are used in the electron transport chain. While this enzyme is not directly involved in pumping protons. In electron transport chain in the mitochondria, the enzyme complexes I, III, and IV pump protons (H+) from the mitochondrial matrix to the intermembrane space. The exact number of protons pumped depends on the specific complex and the number of electrons passing through it.
Also, number of protons pumped per pair of electrons passing through the electron transport chain varies depending on the specific electron carrier and the efficiency of the electron transport chain.
To learn more about Isocitrate dehydrogenase , here
brainly.com/question/14203079
#SPJ4
Do animal cells always have to be placed in isotonic solutions? Why?
Explanation:
because If a cell is placed in an isotonic solution, there will be no net flow of water into or out of the cell, and the cell's volume will remain stable
Please answer the question which I attached to this fileQuestion 6
The relationship between individuals II-5 and II-6 is that they are a couple that has two children. This can be assumed because there is a horizontal line that bonds them from the side, and a vertical line goes down their union to part sideways into two individuals (III-4 and III-5).
reasons for celebrating religious festivals
Answer:
Festivals have both social and economic angles. In the chaotic and stressful planet we inhabit, happiness is overshadowed by negativity and insecurity and so the need for something that could bring positivity has been felt time and again. Thus, festivals that give us the opportunity to forget all our worries and celebrate the positive side of life, even if it is for a few days, came into existence.
Explanation:
An astronaut is planning a trip to a newly-discovered planet according to the law of universal gravitation, the astronaut weight in the new planet will be greater than his weight on earth if:
The new planet has more mass than Earth but the same radius. The mass of the astronaut will be calculated by the use of Newton's gravitational equation. The weight of the astronaut depends completely on its mass and the gravitational acceleration of the planet.
Gravitational acceleration is directly proportional to the mass of the planet and indirectly proportional to the radius of the planet. Hence, when the gravitational acceleration increases the planet's mass will increase therefore the radius will decrease. The astronaut's mass will depend on these factors.
Learn more about Gravitational acceleration, here
https://brainly.com/question/3009841
#SPJ1
A collision domain is a network segment shared a data transmissions collide with one another. Give an example S of the Multiple Access Protocol:
channel partitioning protocols
random access protocols
"taking turns" protocols
Multiple Access Protocols are used in network communication to manage access to a shared medium. They provide a set of rules for devices to transmit data without collisions. Three examples of Multiple Access Protocols are channel partitioning protocols, random access protocols, and "taking turns" protocols.
Channel partitioning protocols divide the available channel or bandwidth into separate time slots or frequency bands, allowing different devices to transmit data during their designated time or frequency slot. An example of a channel partitioning protocol is Time Division Multiple Access (TDMA), where each device is allocated a specific time slot to transmit data.
Random access protocols do not divide the channel but instead, allow devices to transmit data whenever they have data to send. Examples of random access protocols include Carrier Sense Multiple Access with Collision Detection (CSMA/CD), used in Ethernet networks, and Carrier Sense Multiple Access with Collision Avoidance (CSMA/CA), used in wireless networks.
"Taking turns" protocols, also known as controlled access protocols, allow devices to take turns in accessing the shared medium. An example of a "taking turns" protocol is the Token Ring protocol, where a token is passed from one device to another in a sequential manner, granting the device holding the token the right to transmit data.
These Multiple Access Protocols help regulate access to a collision domain, ensuring efficient and fair data transmission among multiple devices sharing the same network segment.
Learn more about data
https://brainly.com/question/27948394
#SPJ11
All nine essential amino acids can be found in meat. By employing the nutritional principle of complementarity, a vegetarian gets all nine. What is complementarity
Answer:
All 9 essential amino acids can be found in meat. By employing the nutritional principle of complementarity, a vegetarian gets all nine. What is complementarity? Combining foods that complement each others essential amino acids.
Explanation:
I hope this helps!
in discussing patterns of biodiversity over long timescales, we focused on the two determining factors: the rate at which new species originate, and the rate at which species go extinct. are rates of origination of new taxa random? is the extinction of lineages a random process? explain.
While both the origination of new taxa and the extinction of lineages involve some degree of randomness, they are also influenced by various ecological, environmental, and evolutionary factors that affect the rates of biodiversity change over time. Understanding these factors is essential for predicting and mitigating the impacts of human activities on global biodiversity.
In discussing patterns of biodiversity over long timescales, the two determining factors are the rate at which new species originate and the rate at which species go extinct. The origination of new taxa is not entirely random, but it is influenced by various factors such as environmental changes, speciation events, and genetic mutations. The rate of origination can be affected by natural selection, which favors the survival and reproduction of certain traits and genetic variations that may lead to the emergence of new species.
On the other hand, the extinction of lineages is not entirely random either. It can be influenced by factors such as changes in climate, geological events, competition with other species, and human activities. Some species may be more vulnerable to extinction than others due to their ecological niche, habitat range, and population size. Therefore, the extinction of lineages is a complex process that involves both random and non-random factors.
Learn more about biodiversity change here:-
https://brainly.com/question/3780016
#SPJ11
a compound is subjected to the ames test to evaluate its ability to cause mutation. if the substance is a mutagen, what results are expected?
The Ames test is a bacterial assay used to evaluate the potential of a chemical substance to cause genetic mutations.
The test involves exposing a specific strain of bacteria to the compound being tested and observing whether it causes a genetic mutation that results in the bacteria being able to grow on a medium that it previously could not grow on.
If the substance being tested is a mutagen, then the results of the Ames test will show an increased number of bacteria that have undergone genetic mutations and can now grow on the previously non-permissive medium.
This increase in mutation frequency suggests that the substance has the potential to cause mutations in living organisms and therefore may be harmful to human health.
However, it is important to note that the Ames test is just one of many tests used to evaluate the safety of chemicals, and further studies may be needed to fully understand the potential risks associated with exposure to a mutagenic compound.
to know more about genetic mutations refer here:
https://brainly.com/question/1282397#
#SPJ11
In the Ames test, if a substance is a mutagen, you can expect an increased number of revertant colonies compared to the negative control. This result indicates that the compound has the potential to cause mutations in the tested organism's DNA, suggesting it might be a potential carcinogen or have other harmful effects.
If a compound is subjected to the Ames test and is found to be a mutagen, it is expected to cause an increase in the number of revertant colonies compared to the negative control. This indicates that the compound has the ability to cause mutations in DNA, which can lead to adverse health effects such as cancer. It is important to note that the Ames test is not a definitive indicator of a compound's mutagenic potential in humans, but it is a widely used screening tool for identifying potential mutagens.
Learn more about mutagen here:-
https://brainly.com/question/1728110
#SPJ11
_____ - is the study of how things work; gathering new information, new investigations.
Q: What's the answer?
Answer:
science
Explanation:
All of the following may be found in the walls of the respiratory bronchi except:
A. Smooth muscle
B. Surfactant-producing glands********
C. Goblet cells
D. Ciliated cells
Respiratory bronchi are the smallest branches of the bronchial tree and are responsible for transporting air to the respiratory zone of the lungs. "Surfactant-producing glands," is the correct answer to this question.
They differ from terminal bronchioles in that they contain alveoli in their walls. All of the following may be found in the walls of the respiratory bronchi except surfactant-producing glands. The respiratory bronchioles have smooth muscle, ciliated cells, and goblet cells in their walls.
The respiratory bronchi are the first set of tubes that carry air into the lungs. The respiratory bronchioles are the tiniest and final branches of the bronchial tree, with the alveoli contained within them. Therefore, the option B, "Surfactant-producing glands," is the correct answer to this question.
Learn more about respiratory
https://brainly.com/question/31875140
#SPJ11
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
Which statement is not true of mitosis?
Answer:
you didnt put anything for me to solve
Explanation:
put something for me to solve
The statements are:
A There are four stages of mitosis
B It is the division of genetic material of a dividing eukaryotic cell into two parts
C it is a process that takes an average of eight minutes for any cell to complete the process
D each daughter cell receives a full set of chromosomes identical to the parent cell
Which structures are most important in determining evolutionary relationships between organisms-analogous, homologous or vestigial? Rank the
structures from most to least important with the most important at the top.
=Analogous
Homologous
Vestigial
The structures that are most important in determining evolutionary relationships between organisms-analogous, homologous or vestigial from most to least important with the most important at the top will be:
Homologous.VestigialAnalogousHow to illustrate the evolution?Analogous traits lack the shared evolutionary history of homologous traits, which allowed them to arise. Because they show evidence of evolutionary relationships, homologous structures are more significant to evolutionary biologists than analogous structures.
The retention of genetically determined traits or structures that no longer serve their original purpose in a given species is known as vestigiality.
In conclusion, the ranking is illustrated above.
Learn more about evolution on:
https://brainly.com/question/26502157
#SPJ1
Which human action has not lead to significant changes in earth’s biomes? a. agriculture b. burial practices c. pollution d. large-scale fishing