Drag each label into the proper position in order to identify the outcome of each condition on blood calclum. calcium absorption by the Parathyroid Living at a Northem latitude Increased use of sunblock Increased bone resorption Increased urinary excretion of phosphate Increased calcium reabsorption from the kidneys Osteoblastic activity Inhibition of Calcitonin activity Increases blood calcium Decreases blood calcium

Answers

Answer 1

Quantity of calcium in blood is determined via blood test. Too much or too little calcium in the blood may be a symptom of a variety of illnesses, kidney disease, thyroid disease, parathyroid abnormalities, bone disease.

Increases blood calcium

calcium absorption by the ParathyroidIncreased calcium reabsorption from the kidneysIncreased bone resorptionIncreased urinary excretion of phosphate

Decreases blood calcium

Living at a Northern latitudeIncreased use of sunblockOsteoblastic activityInhibition of Calcitonin activity

Learn more about calcium

https://brainly.com/question/12836746

#SPJ4


Related Questions

anatomical structure that appear dark grey to black on a processed radiograph are described as being

Answers

Anatomical structures that appear dark gray to black on a processed radiograph are described as being radiolucent

Radiolucent anatomical structures are those that on a processed radiograph look dark grey to black. Structures that are radiolucent look dark or translucent on a radiograph and permit the passage of X-rays. It is used to describe structures that are significantly less dense and allow the x-ray beam to pass through them.

Structures that are radiolucent look dark or black in the radiography image. Air-filled compartments, including the lungs, as well as other soft tissues and organs, are examples of radiolucent structures. Contrarily, radiopaque structures absorb X-rays and show up on a radiograph as being lighter or more opaque. Bones, teeth, and certain implants or metallic items are examples of radiopaque structures.

Read more about radiolucent on:

https://brainly.com/question/31826368

#SPJ4

In cats the trait for hair length is controlled by gene S, where the dominant allele(S) results in short hair and recessives have long hair. The W gene is known as the "masking" gene because a cat that has a dominant W allele in its genotype will have an all-white coat due to a lack of melanin in its skin. Cats with a ww genotype can have a coat of any color, depending on the inheritance of other genes that determine coat color.


A male with long hair and a white coat is crossed with a female cat with short hair and a white coat. The owner of the cats has heard about the masking gene and believes that the cross will produce a litter of all-white kittens, some with short hair and some with long hair.


(a) is the owner's prediction accurate? give evidence to support your response.

(b) Based on the given information, determine all of the possible genotypes of the kittens in the litter

Answers

(a) The owner's prediction is not accurate.

(b) The possible genotypes of the kittens in the litter are SSWW, SSWw, and SSww.

A. The W gene is a dominant gene that masks the expression of other genes, such as the S gene. Therefore, even if both parents have the same genotype for the S gene, the presence of a dominant W gene will result in all of the kittens having a white coat. Therefore, there will not be any kittens with a long-haired coat in the litter, since the W gene masks the expression of the S gene.

B. The SSWW genotype would result in all of the kittens having short hair and a white coat. The SSWw genotype would result in some kittens having short hair and a white coat and some kittens having long hair and a white coat.

The SSww genotype would result in all of the kittens having long hair and a white coat. Therefore, it is possible that the litter could contain any combination of the three genotypes.

Know more about genotypes here

https://brainly.com/question/12116830#

#SPJ11

Which of the following lists the three steps of translation in their proper sequence? O 1. initiation - elongation -- termination O 2. initiation -- transcription -- termination O 3. transcription - elongation -- termination QUESTION 40 The hydrologic cycle is different from other nutrient cycles in that: O 1. water is chemically unchanged throughout the cycle. O 2. water is not recycled, but flows one-way through ecosystems. O 3. the atmosphere is involved. O 4. the soil is involved.

Answers

The proper sequence of the three steps of translation is initiation, elongation, and termination. The hydrologic cycle is different from other nutrient cycles in that it involves the atmosphere and water is not chemically changed during the cycle ;therefore, option 1 is correct.

The three steps of translation in their proper sequence are: Initiation, Elongation, Termination.

Initiation: Initiation is the first step of translation in which the small ribosomal subunit binds to the mRNA and the initiator tRNA recognizes and binds to the start codon AUG.

Elongation: Elongation is the second step of translation in which the ribosome moves along the mRNA strand, reading each codon and bringing in the appropriate amino acid to the growing polypeptide chain.

Termination: Termination is the final step of translation in which the ribosome reaches the stop codon, and the newly synthesized protein is released.

Translation is a process in which the sequence of nucleotides in mRNA is converted into a sequence of amino acids in the protein. This process takes place in three steps; Initiation, Elongation, and Termination. During initiation, the small ribosomal subunit binds to the mRNA, and the initiator tRNA recognizes and binds to the start codon AUG. Then the large ribosomal subunit binds, and the initiator tRNA is placed in the P-site. During Elongation, the ribosome moves along the mRNA strand, reading each codon and bringing in the appropriate amino acid to the growing polypeptide chain. In the end, the newly synthesized protein is released during Termination when the ribosome reaches the stop codon.The hydrologic cycle is different from other nutrient cycles in that the atmosphere is involved. The hydrologic cycle, also known as the water cycle, involves the continuous movement of water on, above, and below the surface of the Earth. Water evaporates from the surface, forms clouds, and then returns to the Earth as precipitation.

This process is driven by the energy from the sun, and the atmosphere plays an important role in regulating it. Unlike other nutrient cycles, such as the carbon or nitrogen cycle, the hydrologic cycle does not involve any chemical changes in water and it flows in a cyclic manner through ecosystems.

To know more about hydrologic cycle visit:

brainly.com/question/13729546

#SPJ11

One of the plants’ main role in nature is to provide food for animals and man. How the function of each plant organ helps plants fulfill this role?

Answers

To "feed" the organism, leaves take in sunlight and perform photosynthesis which prepare food, while roots delve into the soil to get water and nutrients needed for growth and photosynthesis in plants.

What are the three primary categories of plant tissue and what do they do?

They can be separated into three main groups: dermal, vascular, and ground tissue. Dermal tissue on the plant protects and wraps it. The ground tissue aids in the storage of water and sugars, acts as a site for photosynthesis, and acts as a supporting matrix for the vascular tissue.

What are 4 functions of plants?

Autotrophs are the plants. Through photosynthesis, they produce their own food. As they breathe in carbon dioxide, they exhale oxygen. They guarantee that their surrounds are clean and that the nearby species are breathing properly.

To learn more about plant organs visit:

brainly.com/question/29530292

#SPJ1

Which statement is FALSE about epigenetic modifications?
a. The tails of the nucleosome octamer components can be modified with methylation
b. The tails of the nucleosome octamer components can be modified with acetylation
c. Only non-DNA components of chromatin are modified with epigenetic markers
d. Epigenetic modifications control whether a region is euchromatin or heterochromatin

Answers

The false statement about epigenetic modifications is:
c. Only non-DNA components of chromatin are modified with epigenetic markers.

Epigenetic modifications refer to changes in gene expression that do not involve changes to the underlying DNA sequence. These modifications can be inherited and can influence how genes are turned on or off in different cells or at different stages of development.

a. The tails of the nucleosome octamer components can be modified with methylation: This statement is true. Methylation of the tails of nucleosome octamer components, which are made up of histone proteins, can affect gene expression by either activating or repressing the associated genes.

b. The tails of the nucleosome octamer components can be modified with acetylation: This statement is also true. Acetylation of histone tails is another type of epigenetic modification that can influence gene expression. Acetylation generally leads to gene activation by relaxing the chromatin structure and allowing transcription factors to access the DNA.

d. Epigenetic modifications control whether a region is euchromatin or heterochromatin: This statement is true. Epigenetic modifications play a crucial role in determining whether a region of DNA is in a euchromatin state, which is more accessible for gene expression, or a heterochromatin state, which is more condensed and less accessible for gene expression.

In summary, the false statement is c. Only non-DNA components of chromatin are modified with epigenetic markers. Epigenetic modifications can occur on both DNA and non-DNA components of chromatin, such as histone proteins. These modifications can have significant impacts on gene expression and are essential for cellular development and function.

Learn more about non-DNA components here:-

https://brainly.com/question/32988546

#SPJ11

What is the cell labeled X

What is the cell labeled X

Answers

Answer:

im assuming stomata or guard cells. need the whole picture though

What do viruses do??

Answers

Viruses cause disease and are mostly known as pathogens. It multiplies by highjacking a cell of a host organism. Then, the infected host cell will reproduce more viruses inside the body. The infection will then spread. Eventually, the host organism will feel sick.

describe the evolution of land plants from aquatic algae, and connect it to the advantage(s) you identify.

Answers

The advantage of these evolutionary steps is that it allowed land plants to successfully colonize and adapt to a variety of terrestrial environments. This led to an increase in biodiversity and the development of complex ecosystems, which ultimately supported the evolution of various other life forms, including animals and fungi.

The evolution of land plants from aquatic algae can be described in several key steps:
1. Transition from water to land: The first step in the evolution of land plants was the colonization of land by their aquatic ancestors. This transition required the development of adaptations to overcome challenges such as desiccation, gravity, and UV radiation.
2. Development of a protective outer layer: To protect against water loss and UV radiation, early land plants evolved a waxy outer layer called the cuticle. This cuticle provided a barrier that helped to prevent desiccation and damage from UV radiation.
3. Evolution of vascular tissues: In order to transport water and nutrients throughout the plant, land plants evolved vascular tissues such as xylem and phloem. Xylem transports water and minerals from the roots to the rest of the plant, while phloem transports sugars and other organic compounds synthesized during photosynthesis.
4. Development of specialized structures: Over time, land plants evolved specialized structures for reproduction, nutrient acquisition, and support. These include roots for anchoring and absorbing water and minerals, stems for support and transportation of nutrients, and leaves for capturing sunlight and photosynthesis.
5. Evolution of seeds and pollen: To adapt to the challenges of reproduction on land, plants evolved seeds and pollen. Seeds allowed for the protection and dispersal of embryos, while pollen facilitated fertilization without the need for water.
6. Diversification: As land plants continued to evolve, they diversified into various groups such as mosses, ferns, gymnosperms, and angiosperms. Each group has unique characteristics and adaptations that have enabled them to survive and thrive in various terrestrial environments.

For more such questions on biodiversity , Visit:

https://brainly.com/question/20935770

#SPJ11



Cattle egrets forage (feed) in fields among cattle. The egret gets easy access to flying insects stirred up by the cattle, and the cattle don’t care if they are there or not. This is an example of which of the following?

Answers

Cattle egrets forage (feed) in fields among cattle. The egret gets easy access to flying insects stirred up by the cattle, and the cattle don’t care if they are there or not. This is an example of commensalism. The correct option is B.

What is commensalism?

In biology, commensalism is a connection between members of two different species in which one species uses the other for food or other purposes without causing the other any harm or gaining anything in return.

Long-term biological interactions known as commensalism occur when members of one species benefit while those of the other species suffer neither benefits nor harm.

A symbiotic relationship in which one creature gains and the other suffers is known as parasitism. A symbiotic relationship in which both organisms profit is known as mutualism.

Thus, the correct option is B.

For more details regarding commensalism, visit:

https://brainly.com/question/14224704

#SPJ1

Your question seems incomplete, missing options are:

A. Mutualism

B. Commensalism

C. Parasitism

active transport of nutrients occurs when nutrients need to move from higher concentration to lower concentration. True/False ?

Answers

False, Active transport of nutrients occurs when nutrients need to move from a lower concentration to a higher concentration, against their concentration gradient.

This process requires energy in the form of ATP and is facilitated by transport proteins, such as ion pumps and transporters. Active transport is necessary for the uptake of certain essential nutrients, such as ions, amino acids, and sugars, into cells. These nutrients may be present in low concentrations within the cell, and active transport allows them to be accumulated against their concentration gradient.

Passive transport, on the other hand, occurs when nutrients move from an area of higher concentration to an area of lower concentration, down their concentration gradient. This process does not require energy and occurs spontaneously.

In summary, active transport is important for the uptake of essential nutrients into cells and occurs when the concentration gradient is against the direction of flow. Passive transport occurs spontaneously and does not require energy.

Learn more about nutrients:

brainly.com/question/1268939

#SPJ4

chemical molecules for odor bind with olfactory receptors located in the

Answers

Nasal Cavity

I found the answer.

                                                                                                                                                                                     

Chemical molecules for odor bind with olfactory receptors located in the Olfactory Epithelium.

The olfactory epithelium is a special type of epithelial tissue located in the nasal cavity.

The olfactory epithelium has different types of olfactory receptor cells that sense odors.

These olfactory receptor cells are characterized to have small prolongations known as cilia.

In conclusion, chemical molecules for odor bind with olfactory receptors located in the Olfactory Epithelium.

Learn more in:

https://brainly.com/question/7305139

Why would “The year without a summer” be considered destructive (no using gogle)

Answers

The year without a summer” be considered destructive it is because as we all know that summer is the season of growing wheat who is very important food crop .....That's why

How to improve air quality?

Answers

Reduce the amount of automobile journeys you take. Reduce or eliminate the usage of fireplaces and wood stoves. Keep leaves, rubbish, and other things from being burned. Use of gas-powered lawn and garden equipment should be avoided.

Government agencies use an air quality index (AQI) to communicate to the public how filthy the air is now or how polluted it is expected to become. The AQI is calculated by averaging data from an air quality sensor, which might rise due to car traffic, forest fires, or any other source of air pollution. Among the pollutants evaluated were ozone, nitrogen dioxide, and sulphur dioxide.

As the AQI rises, so do the threats to public health, particularly for children, the elderly, and anyone with respiratory or cardiovascular difficulties. During these periods, governments often recommend citizens to limit their outdoor physical activity or perhaps avoid going out completely. Face masks, such as cotton masks, may also be advised.

To learn more about air quality, here

https://brainly.com/question/5757344

#SPJ4

An individual heterozygous for cystic fibrosis
a) Will have children who are all carriers of cystic fibrosis.
b) Cannot have children with cystic fibrosis.
c) has cystic fibrosis
d) is a carrier

Answers

An individual who is heterozygous for cystic fibrosis is a carrier of the disease, so the correct answer is in option d, as it is mentioned that it is a carrier and cystic fibrosis is an autosomal recessive genetic disorder.

What is cystic fibrosis?

The CFTR gene provides information for making a protein that regulates the movement of salt and water in and out of cells in the body, and any mutation in the CFTR gene results in the production of a defective protein that leads to the buildup of thick, sticky mucus in the lungs and pancreas; this condition is called cystic fibrosis.

Hence, an individual who is heterozygous for cystic fibrosis is a carrier of the disease, so the correct answer is in option d.

Learn more about cystic fibrosis here.

https://brainly.com/question/7618757

#SPJ1

Which of the following statements describes a law?


A law is based on a tested hypothesis.


A law explains how the process occurs.


A law describes something about the natural world.


A law is subject to change as new evidence is discovered.

Answers

Answer:

A law is subject to change as new evidence is discovered

The following statement describes a law: "A law is subject to change as new evidence is discovered that is present in the last option." The law is created to protect the rules and regulations that allow society to function properly.

What is the importance of the law?

There are different laws for everyone, such as laws for humans and laws for animal care, etc., and these are made for the protection of society and nature from destruction. When a change occurs, the law can be amended, making it more effective in protecting humans from criminals who do not follow government rules and regulations or violate animal protection laws, etc.

Hence, The following statement describes a law: "A law is subject to change as new evidence is discovered that is present in the last option." The law was created to protect the rules and regulations that allow society to function properly.

Learn more about the law here.

https://brainly.com/question/6590381

#SPJ6

all pandemics are caused by infectious virus or bacteria that cross from animals to humans.
a. true
b. false

Answers

The given statement is FALSE. Many infectious diseases are caused by viruses and bacteria. But there are also other types of pathogens that cause illness.

A pandemic is the global unfold of a brand new disease. Viral breathing diseases, consisting of the ones because of a brand new influenza virus or the coronavirus COVID-19, are the maximum possibly to show right into a pandemic. A pandemic isn't always similar to an epidemic. Coronaviruses are a massive own circle of relatives of viruses. Some coronaviruses purpose cold-like ailments in people, even as others purpose contamination in positive styles of animals, consisting of cattle, camels, and bats. Some coronaviruses, consisting of dog and tom cat coronaviruses, infect handiest animals and do now no longer infect people. Bacterial infections are because of micro organism, and viral infections are because of viruses. Perhaps the maximum essential difference among micro organism and viruses is that antibiotic pills normally kill micro organism, however they are not powerful towards viruses.

To learn more about viruses check the link below:

https://brainly.com/question/25236237

#SPJ4

Compare directional selection and disruptive selection.

Answers

Answer:

Directional selection vs Disruptive Selection

Explanation:

Directional selection leans to a phenotype that is more fittest to the environment of a species, directional selection favors a phenotype extreme values for a trait over medium ones

Imagine a species of coral reef fish that is threatened by both overfishing and pollution. Design an observational study (or possibly a pair of studies) that you could use to understand the relative importance of these two threats. Be sure to specify whether you would use a control-impact, BACI, or regression approach. Describe how your study would deal with any potentially confounding variables.

Answers

In this ecological coral reef study, we used a control impact approach, BACI.

What kind of threats do coral reefs face?

Unfortunately, coral reefs suffer from a number of threats, ranging from

Overfishing to coastal developmentAgricultural runoff and Shipping.

Furthermore, climate change further exacerbates these local threats.

A species of coral reef fish that is threatened by both overfishing and pollution. the observational study that we can use to understand the relative importance of these two threats would be observation over a certain period of time. this study would deal with any potentially confounding variables using reference articles.

Learn more about coral reef in brainly.com/question/364711

Which of the following is true about the structure of DNA?

A.Hydrogen bonds form between the phosphate groups while the sugar and nitrogen bases form the backbone of the double helix
B.Hydrogen bonds form between the nitrogen bases while the sugar and phosphate groups form the backbone of the double helix
C.The sugar and phosphate groups form the rungs of the ladder with nitrogen bonded together by hydrogen bonds forms the rails
D.Nitrogen bases form the backbone of the double helix, while hydrogen bonds between the sugar and phosphate groups form the ladder

Answers

Answer:

B option is correct.

Explanation:

hydrogen bond forms between nitogenous bases and sugars and phosphates forms the backbone.

What kind of antibody does a baby receive from its mother’s colostrums (first milk)?
a. igd
b. iga
c. igm
d. igb
e. igg

Answers

iga and igg antibody present in Colostrum, the first breast milk.

Primary immunoglobulin in human milk is IgA .Immunoglobulin A (IgA) is an antibody blood protein that's part of your immune system. Your body makes IgA and other type of antibodies to help fight off sickness. Antibodies like IgG antibodies in breast milk help shape infants' gut bacteria and immunity. Researchers have known for some time that maternal breast milk provides critical nutrients for newborns, and antibodies from mothers vaccinated against a specific disease-causing bacterium or virus can be transferred via breast milk to babies. These antibodies provided  infants with high grade of protection from infection for approximately 3 to 6 months, giving their own immune systems time to mature.

To learn more  about antibodies , here

https://brainly.com/question/13981216

#SPJ4

In pea plants, tall stems are dominant to short stems, and purple flower color is dominant to white flower color.
a. If a homozygous tall, white plant is crossed with a homozygous short, purple plant, what will be the phenotype of the F1 generation?
b. If an F1 plant from this cross is then crossed with to a homozygous tall white plant, what will be the possible phenotypes of the offspring, and in what expected proportions?

Answers

a. If a homozygous tall, white plant is crossed with a homozygous short, purple plant, the phenotype of the F1 generation will be heterozygous tall, purple plants. b. If an F1 plant from this cross is then crossed with to a homozygous tall white plant, the possible phenotypes of the offspring will be heterozygous tall, purple plants and heterozygous tall, white plants in 1:2 expected proportions.

a. Homozygous tall, white plant is crossed with a homozygous short, purple plant, the phenotype of the F1 generation will be heterozygous tall, purple. A Punnett square can be used to determine the F1 offspring. The genotype of the homozygous tall, white parent would be TTWW and the genotype of the homozygous short, purple parent would be ttww.

Therefore, the F1 offspring will be heterozygous tall, purple plants (TtWw).

b. If an F1 plant from this cross is then crossed with a homozygous tall white plant, the possible phenotypes of the offspring would be heterozygous tall, purple plants and heterozygous tall, white plants. The expected proportions of the offspring are:

1/4 of the offspring would be homozygous tall, white (TTWW).

1/4 of the offspring would be homozygous short, purple (ttww).

1/2 of the offspring would be heterozygous for both traits (TtWw).

A Punnett square can be used to determine the offspring of the cross.

Learn more about Phenotype:

https://brainly.com/question/902712

#SPJ11

Illustrated below is a model summarizing Cas9/sgRNA-DNA interactions. Shown below it is the start of a coding region within the first exon of a gene. The bracketed codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. You wish to use CRISPR/Cas9 to make a double-stranded DNA break within the open reading frame (ORF) of this gene.

Suppose you use 5' AGG as the PAM sequence, which sequence could you use for your sgRNA?

...CTGAGATCTCATGTACTAGTCCGTCATTACTGTACTTCTCTTGACAGGCTGTGTCGTGGAATATCTAAGAGCT-3'
...GACTCTAGAGTACATGATCAGGCAGTAATGACATGAAGAGAACTGTCCGACACAGCACCTTATAGATTCTCGA-5'

a) 5' CTGTGTCGTGGAATATCTAA 3'
b) 3' GACACAGCACCTTATAGATT 5'
c) 5' ATTACTGTACTTCTCTTGAC 3'
d) 3' TAATGACATGAAGAGAACTG 5'

Answers

Correct sgRNA sequence for making a double-stranded DNA break within the ORF of this gene using CRISPR/Cas9 is 3' GACACAGCACCTTATAGATT 5'.

The correct option is B .

To design the sgRNA sequence for targeting the open reading frame (ORF) of the gene using CRISPR/Cas9, we need to identify the appropriate sequence that complements the PAM sequence (5' AGG) and is located adjacent to the target site.

In this case, we want to find the sequence that pairs with the PAM sequence (5' AGG) in the lower strand of the gene. The sgRNA sequence should be complementary to the target DNA sequence adjacent to the PAM sequence.

Comparing the given options with the lower strand of the gene sequence, we can see that option (b) 3' GACACAGCACCTTATAGATT 5' is the correct sgRNA sequence. This sequence pairs with the PAM sequence (5' AGG) and is located adjacent to the target site within the open reading frame (ORF) of the gene.

Hence , B is the correct option

To learn more about  CRISPR/Cas9,  here

brainly.com/question/32177722

#SPJ4

Which of the following is a function of the cell wall? (from khan academy~ need asap~ will make brainiest)
Choose 1 answer:
Choose 1 answer:

(Choice A)
A
To package proteins

(Choice B)
B
To give the cell a rigid structure

(Choice C)
C
To carry out photosynthesis

(Choice D)
D
To provide energy for the cell

Answers

According to the research, the correct option is (Choice B). A function of the cell wall is to give the cell a rigid structure.

What is the cell wall?

It refers to an extracellular structure composed of proteins that has an important structural role in prokaryotic cells and plant cells.

In this sense, they serve as mechanical support and provide rigidity to the cell, which in turn allows it to withstand variations in tension, which protects the content of the cell and is responsible for the mediation between the cell and its environment.

Therefore, we can conclude that according to the research,  the correct option is (Choice B). A function of the cell wall is to give the cell a rigid structure.

Learn more about the cell wall here: https://brainly.com/question/18662393

#SPJ1

PLEASE HELP NO POINT THEFTING PLEASEE! Which statement describes the relative age of a fossil that has formed inside a layer of rock?(1 point)

A.The fossil is older than the layer of rock right below it.

B.The fossil is younger than the layer of rock it was formed in.

C.The fossil is older than the layer of rock it was formed in.

D.The fossil is younger than the layer of rock right above it.

Answers

Answer:

Should be B.The fossil is younger than the layer of rock it was formed in.

Explanation:

What is the role of xylem in a vascular plant?
A. Transports salt to the roots of the plant
B. Transports chloroplasts to the leaves of the plant
C. Transports carbohydrates from the leaves to the roots
D. Transports material from the roots up into the plant
SUBMIT

Answers

the correct answer is D

The role of the xylem in a vascular plant is to transport material from the roots up into the plant.

What do you mean by Vascular plants?

Vascular plants may be defined as those plants that have a specialized conducting system that includes xylem and phloem.

Xylem is known to transport water and all essential nutrients and minerals from the roots to the leaves.

Phloem on the other hand transport food from the leaves to the roots.

Therefore, the role of the xylem in a vascular plant is to transport material from the roots up into the plant.

To learn more about Vascular plants, refer to the link:

https://brainly.com/question/20980359

#SPJ2

help me please please​

help me please please

Answers

Answer:

Convection

Explanation:

Definition

convection- the movement caused within a fluid by the tendency of hotter and therefore less dense material to rise, and colder, denser material to sink under the influence of gravity, which consequently results in transfer of heat.

pomeschool GQ
Suomi Test
Pezde TC
Previous
24
Next →
Unit Post Test
24
Select the correct answer.
An unknown solution has an it concentration of 10-12 moles per liter. Which of the following statements correctly describes this solution?
OA The solution is basic in nature
OB. The solution is acidic in nature.
ОС
The solution is neutral in nature.
Reset
Next

Answers

Answer:

A

Explanation:

pH value of these kind solution in 7

Which of the following best describes chromosomes?
OA. Chromosomes are long strands of DNA that carry genetic information in the form of genes.
OB. Chromosomes are one possible form of the gene for a particular trait of an organism.
OC
Chromosomes are the cellular product formed when DNA sequences are transcribed and translated.

Answers

OA. Is the correct answer.
Chromosomes are long strands of DNA that carry genetic information in the form of genes.

describe amendments 3 in 3 sentences

Answers

A constitutional amendment to the documents of a government, organization, other type of entity. A constitution is often amended by inserting the necessary wording straight into the relevant parts.

What does amendment mean?

The provisions of a contract or other instrument may be amended or supplemented. An amendment is a new addition or change that largely maintains the integrity of the original document. The most important and frequent basis for constitutional amendments is the limiting of the charter of fundamental rights.

What is an example of a amendment?

A change, addition, or rephrasing of something with the goal of improvement is what is meant by the definition of an amendment. The amendments adopted to the United States Constitution are one example.

To know more about Amendment visit:

https://brainly.com/question/12124635

#SPJ13

for an enzyme with a kcat of 560 s, how many substrates are converted to product

Answers

An enzyme with a kcat of 560 s^-1 can convert 560 substrate molecules into product molecules per second, under optimal conditions. The kcat value represents the enzyme's catalytic efficiency or turnover number.

The kcat value of an enzyme represents the maximum number of substrate molecules that can be converted to product per unit time when the enzyme is fully saturated with substrate. For an enzyme with a kcat of 560 s^-1, this means that 560 substrate molecules can be converted to product in one second by one molecule of the enzyme. The exact number of substrates that will be converted to product will depend on the concentration of substrate and enzyme in the reaction mixture, as well as other factors such as temperature and pH.

Learn more about enzyme here :-

https://brainly.com/question/29771201

#SPJ11

Other Questions
x = -3y + 14x - 3y = -11pls help :))))))))))))))) in this location of the highway 100 vehicles arrive in an hour. for analysis purposes, we are interested in 1-minute counts. taking that into consideration, answer the following questions using 4 decimal places: a. what is the expected number of vehicles on 1 minute? b. what is the probability that exactly 0 vehicles arrive on 1 minute? c. what is the probability of between 1 and 4 vehicles arrive (including 1 and 4) on 1 minute? d. what is the probability of more than 4 vehicles arrive on 1 minute? e. what is the probability that 5 vehicles or more arrive on 1 minute? explain the historical circumstances that led to the historical development depicted in the mp above Programs remember numbers and other data in the computer's memory and access that data through program elements called? what are two favorite classes you like and why (up to 10 sentences) jackson is new to his daycare. when his mother puts him down on the mat to play, he looks up at her as a means to understand how to act or feel in his situation. this is called social . Can someone help me with this ASAP Pleasee !! which aspects of seasonality are caused by either revolution or rotation Find the equation of the line that passes through (-1,2) and is perpendicular to y =2x+1 . Leave your answer in the form y = m x + c How is the line item veto act connected to president clinton's actions in the balanced budget act? -D 2.Find the value of 'x' in the given figures: A sun in a distant galaxy has an estimated Mass of 1.55272 x 101 kg and the earth has a mass of5.972 x 1024kg, how many earths would it take to equal the mass of the sun? Write your answer inscientific notation.It would takeearths to equal the mass of the sun 1 /2 + 3/ 4 1/3 1( they are fractions) 24) If the Fed sells Treasury bonds, this will shift the A) money supply curve to the right. money supply curve to the left. C) money demand curve to the right. money demand curve to the left. 25) A decrease in the money supply will A) decrease the equilibrium quantity of money. B) decrease the interest rate C) have no effect on the interest rate. increase the interest rate C. decrease in payroll tax. in proportional taxes. D) 26) If the government collects $82 billion in tax revenues and total spending is $93 billion, the result is: A) budget supply of 11 billion B) budget deficit of 11 billion B. 23.60% B) C. 19.29% D) 27) If government tax policy requires Mike to pay $40,000 in taxes on annual income of $300,000 and John to pay $20,000 in tax on annual income of $150,000, then the tax policy is: A) regressive. B) proportional. C) progressive. D) optional. D. decrease 28) A government collects 700B in tax revenue. It allocates $40B to the justice system and $95B for its own administrative costs. True or false. (Pls help) Place the levels of the ecological pyramid in order from the least to the greatest amount of biomass (total number of organisms). 1) 2) 3) 4) Drag and drop the correct choice into the blank spaces above Place the levels of the ecological pyramid in order from the least to the greatest amount of biomass (total number of organisms).1) 2) 3) 4) Drag and drop the correct choice into the blank spaces abovePlace the levels of the ecological pyramid in order from the least to the greatest amount of biomass (total number of organisms).1) 2) 3) 4) Drag and drop the correct choice into the blank spaces above read the quotation to the left. which of these adjectives best describes jurgiss attitude? check all of the boxes that apply. confident afraid fearle suppose x is 2 - distribution with degrees of 20. find a point a such that p(x < a) = 0.025 If there is something floating in a liquid, what is the best way to separate the two chemicals?-distillation-evaporation-filtration-sorting If 9 exercise books cost$540.00. how much will14 of such cost?