after answering a summons and complaint, shawna receives a set of written questions from the plaintiff's attorney. shawna is directed to respond to the questions in writing under oath. this discovery technique is called
After answering a summons and complaint, Shawna receives a set of written questions from the plaintiff's attorney. Shawna is directed to respond to the questions in writing under oath. this discovery technique is called interrogatories.
Interrogatories are a proper set of written questions propounded by one litigant and required to be answered with the aid of an adversary if you want to make clear subjects of reality and help to decide earlier what information may be presented at any trial in the case.
Interrogatories may be quicker, much less highly-priced, and much less complicated than depositions, but there are downsides. because the questions are written, the witness can also have greater time to assume and craft answers, in place of presenting greater candid solutions during discovery.
Interrogatories are to be raised at a pre-trial degree and ought to have a close reference to the problem in query, while pass examinations have a much wider scope of questions that can be asked.
Learn more about interrogatories here:-https://brainly.com/question/24806658
#SPJ4
Now that you have listened to the first chapter of Common Sense, what do you think of Paine's philosophy? Particularly, what do think about how he views the government? Do you think he is right or wrong, and why?
The police training officer (PTO) programs, in contrast to others, stress _____.
community policing techniques and principles
critical-thinking skills as they apply to police work
the physical work of policing
administrative aspects of police work
B) "critical-thinking skills as they apply to police work" is the right answer
Answer:
critical-thinking skills as they apply to police work
Explanation:
An individual wants to sue an agency in a federal court to stop its action. Rank the actions they can take from first to last, placing the first action at the top of the list the top of the list. Top label: null
Answer:
Our government places a high priority on the public being allowed to speak their minds about elected officials as well as other public figures. People in the public eye get less protection from defamatory statements and face a higher burden when attempting to win a defamation lawsuit.
When an official is criticized in a false and injurious way for something that relates to their behavior in office, the official must prove all of the above elements associated with normal defamation, and must also show that the statement was made with "actual malice."
"Actual malice" was defined in a U.S. Supreme Court case decided in 1988, Hustler v. Falwell. In that case, the court held that certain statements that would otherwise be defamatory were protected by the First Amendment of the United States Constitution.
This meant that public officials could only win a defamation suit when the statement that was made wasn't an honest mistake and was in fact published with the actual intent to harm the public figure. Actual malice only occurs when the person making the statement knew the statement was not true at the time the statement was made or had a reckless disregard for whether it was true or not.
For other people that are in the public eye, such as celebrities, they too must prove that the defamatory statements were made with actual malice.
hope it helps
Which of the following is not related to malpractice insurance limitations?
A. Attorney advertising.
B. The manner in which legal representation must be ended and communicated to the client.
C. Coverage for pre and post-judgement interest.
D. Coverage for disciplinary proceedings.
The statement not defining the malpractice in the limitation of insurance contract is the way in which a legal representation ends and informed to the client about it.
Option B is correct.
What is insurance?Insurance has been taken by a person for getting it indemnified in the case of any damage or loss being suffered.
The representation in the court proceedings through any advocate must be ended and then communicated to the client would be considered as one of the ideal way to get any compensation in respect of an insurance. This is not regarded as the malpractice to be done in the limitation of insurance contract.
Therefore, all the options apart from option B would be the malpractices done in the terms and conditions of an insurance contract.
Learn more about the insurance company in the related link:
https://brainly.com/question/989103
#SPJ2
The state tax incentive is an example of":
Answer:
mortgage interest deduction
24.
Most police academies strive to blend training with education.
25.
Generally, basic preservice training is academy-based training that introduces recruits
to police work, provides an overview of the justice system, and includes classes on
specific skills and knowledge areas related to police work.
In addition to the traditional skill-based subjects (e.g., firearms, defensive tactics) and
concepts (e.g., criminal law) taught in basic pre-service training, recruits should be
required to master subjects related to
26.
27.
Obedience-oriented, military-style, stress recruit training programs
28.
Stress-related training in police academies, where it exists, should
29.
The Field training officer (FTO) is a knowledgeable, seasoned, and competent officer
trained in adult education and evaluation procedures, who supervises recruits' on-the-job
(field) training
Answer:
29 the field training officer fto
For California purposes, a "firm" means: A sole proprietorship A corporation O A limited liability
company O All of the above O Both a. and b.
For the sake of California a firm would mean : All of the above. Option 4
What is a firm?A firm is a for-profit business entity that offers professional services, such as a corporation, limited liability company (LLC), or partnership.
A company, such as a corporation, is a business organization that manufactures and sells products and services with the intention of generating income and turning a profit.
A "firm" is defined as a partnership, a limited partnership, a corporation, a limited liability company, or any other combination or entity in Section 7068 of the California Business and Professions Code.
Read more on firms here: https://brainly.com/question/1151291
#SPJ1
Abuse-of-authority rules are found in
A.each states penal code
B. Title 42 of of the U.S. Code
C. The Police Code of conduct
D.The Bill of rights
What can be derived from a firearm and its projectiles?
Firearms and their projectiles can provide important clues and evidence in criminal investigations and can help experts better understand the performance and characteristics of firearms.
What informs firearms and their projectiles?Firearms and their projectiles can provide a wealth of information to investigators and forensic experts in criminal investigations, as well as to engineers and researchers studying the performance and characteristics of firearms.
From a firearm, one can determine its make, model, and caliber. The firearm's serial number can also be used to trace its ownership and history. The condition of the firearm can provide information about its maintenance and use.
From the projectile, one can determine the caliber, type of bullet, and the angle of impact. The projectile's trajectory can be used to determine the location of the shooter and the direction of the shot.
Forensic experts can also analyze the gunshot residue left on the firearm and the shooter's hands to determine if the person fired the weapon. The presence of fingerprints or DNA on the firearm can also be used to identify the shooter.
Overall, firearms and their projectiles can provide important clues and evidence in criminal investigations and can help experts better understand the performance and characteristics of firearms.
learn more about Firearms and their projectiles: https://brainly.com/question/30244650
#SPJ1
Should there be an obligation to recognize same sex marriage entered into in another state which that is lawful even if the state itself constitutionally does not recognize Sam sex marriage
first,it's forbidden by religions
Following arrest, agents can promise an arrestee only that in exchange for cooperation, they will not have to do jail time!
Group of answer choices
Answer: There are several rights assigned with the arrestee or prisoner.
Explanation:
The following are the rights of the prisoner:
1. The statement given by the prisoner cannot be recorded and but can be used to get leads as people under the police pressure make false statements.
2. The prisoner cannot be taken into remand or no physical offense is allowed.
During the exchange for the cooperation the prisoner can expect that there will be no physical violence against him or her during interrogation.
The outside wall of the Town Court has a mural of the American flag, Twin Towers, and screeching bald eagle painted on it by members of the Veterans of Foreign Wars. One night, Russ Toleum spray paints a message over every aspect of the mural. The message is, “Canada – like America but Better, Eh.” The security cameras on the property clearly pick up Russ’s face and he is charged with defacing public property. Russ claims he was merely adding to the mural that was already there and that his right to free speech has been violated. The case makes its way to the Supreme Court.
Answer:
It is a crime to deface public property, because it isn't yours personally. How would Russ like it if someone spray painted something offensive on his car? They were just expressing free speech! "Free Speech" Is not an excuse to commit a crime, Free Speech is just the liberty of saying what you want whether it's controversial or not.
Explanation:
Explain how debt is actually a product that is bought and sold.
Debt is bought and sold because you produce the debt and so different offers are available in and say if you be part of their company they're going to pay off your debt, however you only get yourself into a lot of and a lot of debt with the a lot of businesses you move into with.
Debt is something owed by one person to a different person. Debt will involve real estate, money, services, or different thought. In finance, debt is a lot of narrowly outlined as cash raised through the provision of bonds. And a loan may be a kind of debt however, a lot of specifically, is an agreement during which one party lends cash to a different party.
To learn more about Debt here
brainly.com/question/11033370
#SPJ1
Merck, in fact, epitomizes the ideological nature--the pragmatic idealism--of highly visionary companies. Our research showed that a fundamental element in the "ticking clock" of a visionary company is a core ideology--core values and a sense of purpose beyond just making money--that guides and inspires people throughout the organization and remains relatively fixed for long periods of time.References:Collins, J. C.,
Because the student properly cited (in--text) the source of the quote relating to research, and also included the full details of the author in the bibliography, the issue of plagiarism, therefore, is nullified.
What is plagiarism?The act of copying another person's work without acknowledging them, citing them properly or including their names in the bibliography of the work is called plagiarism.
One of the ways to correct the above or avoid it altogether is to ensure that one's work is as original as possible. All citations must be noted that properly acknowledged according to the source form from which it came.
Learn more about plagiarism:
https://brainly.com/question/24405302
#SPJ1
Full Question:
Original Source Material
Merck, in fact, epitomizes the ideological nature--the pragmatic idealism--of highly visionary companies. Our research showed that a fundamental element in the "ticking clock" of a visionary company is a core ideology--core values and a sense of purpose beyond just making money--that guides and inspires people throughout the organization and remains relatively fixed for long periods of time.
References:
Collins, J. C., & Porras, J. I. (2002). Built to last: Successful habits of visionary companies. New York, NY: Harper Paperbacks.
Student Source Material
Research conducted by Collins and Porras (2002) highlights the importance of establishing and committing to an ideology comprised of two parts: (1) core values; (2) a core purpose. In my personal experience it seems easier to define a core ideology than to live it consistently.
References:
Collins, J. C., & Porras, J. I. (2002). Built to last: Successful habits of visionary companies. New York, NY: Harper Paperbacks.
Which of the following is true for the Student Version above?
Word-for-Word plagiarismParaphrasing plagiarismThis is not plagiarismHints: Item 2
What was the outcome of the trial, Madrigal v. Quilligan? Do you feel it was a just verdict? Why or why not?
Answer:
The verdict in Madrigal v. Quilligan was ultimately in favor of the defendants.
Explanation:
The case Madrigal v. Quilligan was a landmark reproductive rights case heard in the United States in 1978. The case involved a group of 10 Latina women who sued the doctors and hospital that sterilized them without their full knowledge or informed consent while they were giving birth. The women argued that they had been sterilized due to their ethnicity and were not given the opportunity to make an informed decision about the permanent sterilization procedure.
The verdict in Madrigal v. Quilligan was ultimately in favor of the defendants, with the judge ruling that the women's constitutional rights had not been violated. The judge argued that the women had given their consent to the sterilization procedure, and that there was no evidence that the doctors and hospital had acted with discriminatory intent.
Many people, including reproductive rights activists, believed that the verdict was unjust. They argued that the women had not been fully informed about the consequences of the sterilization procedure and that they had been coerced into signing consent forms. Additionally, they argued that the women's race and ethnicity had played a role in the doctors' and hospital's decision to sterilize them, even though there was no direct evidence of discriminatory intent.
In summary, the verdict in Madrigal v. Quilligan was controversial and has been widely criticized as unjust by many reproductive rights advocates. The case highlighted the importance of informed consent and the need for protections against discrimination in medical procedures, particularly for marginalized communities.
Careful———-
is the BEST way to gather information needed to sell alcohol responsibly.
Coordination
Questioning
Observation
Communication
The BEST way to gather needed information to sell alcohol responsibly is through careful C. Observation.
What does it entail to sell alcohol responsibly?Communicate with the buyer and make observations to satisfy that the person demanding to buy alcohol is sober.
Alcoholism has been found to be a chronic disease that demands treatment at rehabilitation clinics and support groups, including Alcohol Anonymous.
However, the alcohol seller does not need to antagonize their customers when refusing to sell. But they can offer customers help when they ask. Diligence is required to avoid alcohol sale offenses.
In gathering information to sell alcohol responsibly, you do not require careful coordination, questioning, or communication but Option C.
Learn more about selling alcohol responsibly at https://brainly.com/question/4818130
#SPJ1
Paying taxes, voting, jury duty and obeying the laws are all examples of-
Personal Responsibilities
O Government Responsibilities
O Civic Responsibilities
O Mandatory Responsibilities
Answer:
Civic Responsibilities
Explanation:
A duty (also called an obligation) is something that a citizen is required to do, by law. Examples of duties/obligations are: obeying laws, paying taxes, defending the nation and serving on juries. Rule of Law: Everyone is under the law. To obey the law, you must know the law.
Answer:
Civic Responsibility
Explanation:
What major political events near the turn of the century contributed to the political polarization in current U.S. political discourse? How did events such as the impeachment of President Clinton and the election crisis of 2000 increase animosity between the political parties? Explain.
During the turn of the century, major political events contributed to the political polarization in current U.S. political discourse.
One of the significant events that led to an increase in animosity between political parties was the impeachment of President Clinton and the election crisis of 2000.The impeachment of President ClintonThe impeachment of President Clinton in 1998 marked one of the most significant political events in the United States. The impeachment had a lasting effect on the political discourse of the country.
The impeachment led to a massive division between the Democrats and Republicans.The Republicans, who controlled Congress, accused President Clinton of perjury and obstruction of justice in a lawsuit that alleged he had engaged in sexual harassment. The Democrats, on the other hand, were concerned that the impeachment process was politically motivated and constituted a threat to the presidency.
To know more about polarization visit:
https://brainly.com/question/3092611
#SPJ11
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
Answer:
The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.
what program is organized and operated by citizens whose missions involve canvasing the neighborhood to reduce certain types of crimes?
Neighborhood Watch program is organized and operated by citizens whose missions involve canvassing the neighborhood to reduce certain types of crimes.
The Neighborhood Watch program is a community-based crime prevention initiative aimed at promoting safety and security within neighborhoods.
It involves residents voluntarily organizing and collaborating with local law enforcement agencies to create a network of vigilant individuals who look out for suspicious activities and report them to the authorities.
The program encourages neighbors to be proactive in preventing crime by fostering a sense of community and fostering communication between residents and law enforcement.
Neighborhood Watch programs typically involve regular meetings, training sessions, and the dissemination of crime prevention information to empower residents to actively participate in keeping their neighborhoods safe.
Learn more about Neighborhood Watch program here:
https://brainly.com/question/31671387
#SPJ4
For this assignment, you will describe and compare the powers and responsibilities of each branch of the federal government. To do this, you will complete the following steps:
Reflect: Identify the institutions, powers, and responsibilities of each branch of the federal government.
Analyze: Answer questions about the roles each branch plays in carrying out the powers of government.
To get the best grade possible, follow the instructions in the assignment closely and answer all the questions completely. This assignment is worth 20 points.
Based on what you've learned about the three branches of the federal government, answer the following questions. If you need help remembering the details about each branch, go back through the contents of this unit. This section is worth 9 points.
1. List the responsibilities and powers of each branch of the federal government. (6 points)
Branch of government
Executive
Legislative
Judicial
Responsibilities
Powers (identify at least two powers for each branch)
2. Describe at least one way in which the executive branch is able to influence the actions of the legislative branch and at least one way in which it is able to influence the actions of the judicial branch. (1 point)
3. Describe at least one way in which the legislative branch is able to influence the actions of the judicial branch and at least one way in which it is able to influence the actions of the executive branch. (1 point)
4. Describe at least one way in which the judicial branch is able to influence the actions of the legislative branch and at least one way in which it is able to influence the actions of the executive branch. (1 point)
Now that you have reflected on the powers and responsibilities of each branch, answer the following questions. This section is worth 11 points.
1. The federal government creates the laws that govern the entire nation. Compare the role each branch of government plays in this process and explain which branch plays the most important role in creating laws. (3 points)
2. The federal government is responsible for enforcing laws and carrying out policies. Compare the role each branch of government plays in this process and explain which branch plays the most important role in enforcing laws and carrying out policies. (3 points)
3. The federal government was established by the U.S. Constitution, which created a system of check and balances. Compare the ways each branch balances out the other branches' powers and explain how the judicial branch plays a critical role in maintaining the system of checks and balances. (3 points)
4. Based on what you have learned, which branch of government do you believe has the most power overall? Support your opinion with examples. (2 points)
A legislature is a deliberative assembly with the authority to make laws for a political entity such as a country or city. Legislatures form important parts of most governments; in the separation of powers model, they are often contrasted with the executive and judicial branches of parliamentary government.
Laws enacted by legislatures are usually known as primary legislation. In addition, legislatures may observe and steer governing actions, with authority to amend the budget involved.
The members of a legislature are called legislators. In a democracy, legislators are most commonly popularly elected, although indirect election and appointment by the executive are also used, particularly for bicameral legislatures featuring an upper chamber.
The executive is the branch of government exercising authority in and holding responsibility for the governance of a state. The executive executes and enforces law.
In political systems based on the principle of separation of powers, authority is distributed among several branches —an attempt to prevent the concentration of power in the hands of a single group of people. In such a system, the executive does not pass laws or interpret them . Instead, the executive enforces the law as written by the legislature and interpreted by the judiciary. The executive can be the source of certain types of law, such as a decree or executive order
The judiciary is the system of courts that interprets, defends, and applies the law in the name of the state. The judiciary can also be thought of as the mechanism for the resolution of disputes. Under the doctrine of the separation of powers, the judiciary generally does not make statutory law or enforce law, but rather interprets, defends, and applies the law to the facts of each case. However, in some countries the judiciary does make common law.
In many jurisdictions the judicial branch has the power to change laws through the process of judicial review. Courts with judicial review power may annul the laws and rules of the state when it finds them incompatible with a higher norm, such as primary legislation, the provisions of the constitution, treaties or international law. Judges constitute a critical force for interpretation and implementation of a constitution, thus in common law countries creating the body of constitutional law.
A legislative body is responsible for the ongoing power to enact laws for a political unit, such as a nation or city. Usually referred to as primary legislation, laws passed by legislatures.
What is The legislative branch?The legislative branch can approve presidential appointments, manage the budget, impeach the president, and force him or her to resign from office by using their power and authority.
The ability to veto laws that the legislative branch adopts belongs to the executive branch and the president. The judicial branch has the power to invalidate legislation that the legislative branch has passed.
When state laws and regulations are found to be incompatible with a higher standard, such as primary legislation, courts having judicial review authority may revoke those laws and regulations.
Learn more about the legislative branch, here:
https://brainly.com/question/8338696
#SPJ3
the creation of new crime legislation and the size of criminal justice agency budgets are decided by legislators responding to the demands of
The creation of new crime legislation and the size of criminal justice agency budgets are decided by legislators responding to the demands of voters.
Agency is the capability of individuals to have the strength and resources to satisfy their capacity. for instance, structure is composed of those elements of impact that determine or restriction sellers and their choices.
Man or woman organization is whilst someone acts on their personal behalf, while proxy corporation is whilst an person acts on behalf of someone else (including an organization). Collective organisation happens while people act together, along with a social movement.
Learn more about agency here:https://brainly.com/question/28043694
#SPJ4
in applying a long-arm statute, a court must ensure that exercising jurisdiction over that defendant meets the constitutional requirements of fairness and
In applying a long-arm statute, a court must ensure that exercising jurisdiction over that defendant meets the constitutional requirements of fairness and due process.A long-arm statute is a law that permits a state court to hear a case against an out-of-state defendant.
A court can exercise personal jurisdiction over an individual or company that does not live or operate in the court's jurisdiction through the use of a long-arm statute.Long-arm statutes vary by state, but they generally allow a court to exercise jurisdiction over an out-of-state defendant who has sufficient connections to the state where the court is situated, such as minimum contacts. Personal jurisdiction over out-of-state defendants is necessary for plaintiffs to hold them responsible for their actions.What are the constitutional requirements for fairness and due process?The United States Constitution protects the right to fairness and due process in legal proceedings. A court cannot exercise personal jurisdiction over an individual or company unless it meets the constitutional requirements of fairness and due process. The Due Process Clause in the Constitution's Fourteenth Amendment requires courts to give fair warning to parties and to provide them with a fair opportunity to be heard before taking action. The constitutional standards for fairness and due process include:Notice: The defendant must receive notice of the proceedings and have a chance to respond.Fairness: The court must be impartial and unbiased and must not discriminate against any party.Equitable: The court must decide the case equitably and based on the facts presented.Due Process: The court must follow proper procedures and respect the defendant's rights throughout the legal process.
To know more about opportunity , visit;
https://brainly.com/question/29887118
#SPJ11
which group led the charge of the change to incarceration instead of corporal punishment
Answer:
The prison population began to grow in the 1970s, when politicians from both parties used fear and thinly veiled racial rhetoric to push increasingly punitive policies.
Explanation:
As a general rule, a person making a report in good faith and under statutory command e.g. child abuse,communicable diseases, births, deaths, is
a. no protected from liability claims
b. subject to penalties imposed by federal law
c. subject to pealties imposed by state law
d. protected
As a general rule, a person making a report in good faith and under statutory command is protected from liability claims.
Many laws require individuals to report certain types of information, such as suspected child abuse or communicable diseases. If a person makes such a report in good faith and under statutory command,
they are generally protected from liability claims. This means that they cannot be sued or held legally responsible for any negative consequences that result from their report.
The protection from liability claims is important to encourage individuals to make such reports without fear of retaliation or legal consequences. However, it is important to note that the protection only applies if the report is made in good faith and under statutory command.
If a person makes a false report or violates any laws in the process of making the report, they may be subject to penalties imposed by federal or state law.
In addition to protecting individuals from liability claims, many laws also provide confidentiality protections for those who make certain types of reports.
For example, laws that require reporting of communicable diseases often have provisions that protect the confidentiality of the person making the report.
These protections help to ensure that individuals feel comfortable making necessary reports without fear of retaliation or violation of their privacy.
To know more about legal click here
brainly.com/question/30088290
#SPJ11
before every judicial conference, what do the supreme court justices do?
what should you include in the opening of a direct claim message? a justification of your request an explanation of the problem followed by a threat a clear statement of the problem
When opening a direct claim message, it is important to include a clear statement of the problem. This helps to ensure that the recipient understands the issue at hand and can take appropriate action to resolve it. It is also important to provide a justification for your claim.
which explains why you feel entitled to the resolution you are seeking. However, it is not advisable to include a threat in your opening message, as this can come across as confrontational and unprofessional. Instead, focus on presenting your case in a clear and concise manner, and allow the recipient to respond before considering any further action. In the opening of a direct claim message, you should include a clear statement of the problem. This approach helps to effectively communicate the claim and ensures that the recipient understands the issue without introducing threats or unnecessary justifications.
learn more about recipient
https://brainly.com/question/10570062
#SPJ11
What can you say about the Filipino culture ?
One country has a comparative advantage over another country in the production of a good if it.
A country has a comparative advantage over another country as regards production of goods when that country is able to produce the goods at lower cost.
What is comparative advantage?
In economic , comparative advantage can be regarded as an advantage that a country get over the other when that country can produce at lower cost.
In the law of demand and supply, it is established that consumer will definitely go for product with lower price.
Countries that usually specialize as regards comparative advantage usually have a gain from trade.We can conclude that at lower cost of production , a country will have comparative advantage.
Learn more about comparative advantage at;
https://brainly.com/question/14846093