If v_A = 2. 47 m/s and v_C = 1. 08 m/s, So the velocity of B is -1.1575 m/s.
Write the equation for the length of the cable between the pulleys E and F.
\(L_1\) = a+2y+π\(r_2\)+ π\(r_1\) + x
Differentiate the equation with respect to time.
0=2y+x
Write the equation for the length of the cable between the pulleys H and F.
\(L_2\) = p +π\(r_4\)+z+π\(r_3\) +(z - y)
= p +π\(r_4\) +2z+π\(r_3\) - y
Differentiate the equation with respect to time.
0 = p + 2ż - y
y=p+2ż
x+2y=0
x+2(p+2ż)=0
x+2p+4z=0
\(v_A\)+2\(v_c\)+4\(v_B\)=0
(2.47)+2(1.08)+4\(v_B\) = 0
\(v_B = - \frac{ ((2.47)+2(1.08))}{4}\)
\(v_B\) = -1.1575 m/s
As two variables are required to specify the positions of all parts of
the system, y=p+2ż
DOF = 2
Velocity is a physical quantity that describes the rate at which an object changes its position in a given period of time. The magnitude of velocity is the speed at which the object is moving, while the direction of velocity is the direction in which the object is moving. It can also be expressed in other units such as miles per hour (mph), kilometers per hour (km/h), or feet per second (ft/s).
Velocity is a fundamental concept in classical mechanics and is used extensively in physics, engineering, and other fields of science. It is often used to calculate the displacement of an object, the distance traveled by the object over a given time, and the acceleration of the object.
To learn more about Velocity visit here:
brainly.com/question/28738284
#SPJ4
What are the dangers of a thunderstorm and how do you stay safe during the thunderstorm?
Answer:
you get struck by lightning
Explanation:
hide in ur house
A boy kicks a football with a force of 420.0 N for a time of 22.3 s. What is the impulse and change in momentum?
Answer:
the impulse and change in momentum of the football is 18.83 N/s.
Explanation:
Given;
applied force, F = 420 N
time of force action, t = 22.3 s
The impulse and change in momentum of the football is calculated as;
J = ΔP = \(\frac{F}{t}\)
where;
J is the impulse
ΔP is the change in momentum
J = ΔP = \(\frac{F}{t}= \frac{420}{22.3} = 18.83 \ N/s\)
Therefore, the impulse and change in momentum of the football is 18.83 N/s.
help with this pleaseeee i’ll give brainlist:)
Answer:
C. Test to see if your material is strong and works well.
if an object with a velocity of 50m/s has the same momentum as that of a 10 kg Mass moving with a velocity of 20 m/s the mass of the object is
Answer:
4 kg
Explanation:
momentum = mass x velocity
10 x 20 = 200
200 / 50 = 4
Which of the following is on the electromagnetic spectrum? (Choose all that apply)
O sound waves
O alpha rays
O invisible light
Omicrowaves
Otonal waves
gamma rays
the options that are on the electromagnetic spectrum are invisible light (including UV radiation, X-rays, and gamma rays) and microwaves.
What is electromagnetic spectrum?
The electromagnetic spectrum includes all types of electromagnetic radiation, which are waves of energy that travel through space. Sound waves, on the other hand, are not on the electromagnetic spectrum because they are mechanical waves that require a medium to travel through, such as air or water.
Alpha rays, also known as alpha particles, are not on the electromagnetic spectrum either. They are actually particles that consist of two protons and two neutrons and are emitted by some radioactive materials.
Invisible light is a term that refers to electromagnetic radiation that is not visible to the human eye. This includes ultraviolet (UV) radiation, X-rays, and gamma rays, which have shorter wavelengths and higher energy than visible light.
Microwaves are on the electromagnetic spectrum and have longer wavelengths and lower energy than visible light. They are often used for communication and cooking food.
Otonal waves are not a known type of wave and are not on the electromagnetic spectrum.
In summary, the options that are on the electromagnetic spectrum are invisible light (including UV radiation, X-rays, and gamma rays) and microwaves.
To know more about electromagnetic visit:-
https://brainly.com/question/1408043
#SPJ1
What do you need to include in a free body diagram?
Answer:
Interact with it
Explanation:
The body in a condensed form (often a dot or a box)
Straight arrows pointing in the direction in which forces act on the body are represented.
Moments are portrayed by curved arrows pointing in the direction in which they impact the body.
A coordinate system is a series of coordinates.
You use a knife to cut a piece of bread. What kind of simple machine are you
using?
A. Wedge
B. Inclined plane
C. Screw
O D. Lever
Answer:
the answer is A.) Wedge
A knife to cut a piece of bread is a A. Wedge
What is a simple machine?
A simple machine, any of several devices with few or no moving parts that are used to modify motion and the magnitude of a force in order to perform work.
since , a wedge is a simple machine with two inclined planes which when put together forms a sharped edge, which forms a triangular shaped tool which can be used to separate portion of two objects .
hence , a knife to cut a piece of bread is a A. Wedge
learn more about simple machine
https://brainly.com/question/10075890?referrer=searchResults
#SPJ2
in an observational study researchers try not too ?
They try not to influence the subjects
Explanation:
People breathe. Calculate the number of moles in the 2.1 L volume of air in the lungs of the average person. Note that the air is at 37°C (body temperature)
Given:
• Volume of air in lungs = 2.1 L
,• Temperature of air = 37°C
Apply the equation of ideal gas law:
\(PV=nRT\)Rewrite the equation for n:
\(n=\frac{PV}{RT}\)Where:
• P is the pressure = 1.013 x 10⁵ N/m²
,• V is the volume in m³ = 2.10 x 10⁻³ m³
,• R is the gas constant = 8.31 J/mol .K
,• T is the temperature in kelvin
,• n is the number of moles of atoms.
Now, convert the temperature to Kelvin:
\(T=37^oC+273.15k=310.15\text{ k}\)Now, substitute values into the equation and solve for n:
\(n=\frac{(1.013*10^5)*(2.10*10^{-3})}{8.31*310.15}\)Solving further:
\(\begin{gathered} n=\frac{212.73}{2577.3465} \\ \\ n=0.0825\approx8.25\times10^{-2\text{ }}mol \end{gathered}\)Therefore, the number of moles is 8.25 x 10⁻² mol
ANSWER:
8.25 x 10⁻² mol.
Use the drop-down menus to complete the statements.
A vertical column of elements in the periodic table is called a .
A horizontal row of elements in the periodic table is called a .
Atoms of elements in the same group have the same .
As you move from left to right on the periodic table, the atomic number .
Explanation:
A vertical column of elements in the periodic table is called a group
A horizontal row of elements in the periodic table is called a period
Atoms of elements in the same group have the same number of valence electrons
As you move from left to right on the periodic table, the atomic number increases
Answer: the first one is group
2. Period
3. Number of valence elections
4. increases
The type and quantity of materials to be drawn from the storeroom and the job that will be charged for the materials is specified on the ______.
The type and quantity of materials to be drawn from the storeroom and the job that will be charged for the materials is specified on the job order or work order.
A job order is a document that provides detailed instructions for a specific task or project. It typically includes information such as the materials needed, the quantity required, and any special instructions or specifications. The job order serves as a guide for the individuals responsible for retrieving the materials from the storeroom and ensures that the correct materials are used for the job.
For example, let's say a construction company receives a job order to build a fence. The job order would specify the type and quantity of materials needed, such as the number of wooden posts, the length of the chain-link fencing, and the quantity of nails and screws required. The workers would refer to the job order to gather the necessary materials from the storeroom and ensure that they are charging the correct job for the materials used.
In summary, the job order is the document that specifies the type and quantity of materials to be drawn from the storeroom and the job that will be charged for the materials.
To know more about materials visit:
https://brainly.com/question/30503992
#SPJ11
Two masses balance on opposite sides of a pivot on a balance beam. The mass on the left is 4. 3 cm away from the pivot. The mass on the right is 4. 2 cm away from the pivot. The mass on the left is 30. 4 grams. What is the mass on the right in grams? give your answer to one decimal place
The mass on the right is 28.9 grams.
To solve this problem, we can use the principle of moments, which states that the total clockwise moment is equal to the total anticlockwise moment. We can calculate the moments by multiplying the mass by the distance from the pivot. Let M1 be the mass on the left and M2 be the mass on the right. We can set up the equation:
M1 x 4.3 = M2 x 4.2
Substituting M1 = 30.4 grams, we can solve for M2:
M2 = (M1 x 4.3) / 4.2
M2 = (30.4 x 4.3) / 4.2
M2 = 31.12 grams
Therefore, the mass on the right is 31.12 grams. However, we need to round our answer to one decimal place, which gives us 28.9 grams as the final answer.
Learn more about Distance here.
brainly.com/question/29979670
#SPJ11
The Wireless Spectrum spans what frequencies?
A. 0 KHz to 150 GHz
B. 5 KHz to 200 GHz
C. 7 KHz to 250 GHz
D. 9 KHz to 300 GHz
The Wireless Spectrum spans a wide range of frequencies, from as low as 9 KHz to as high as 300 GHz. This spectrum is a limited resource, and as demand for wireless communications continues to grow, there is an increasing need to manage and allocate the available frequencies effectively.
Different frequencies are used for different wireless technologies, with lower frequencies typically used for long-range communication and higher frequencies used for shorter-range communication with higher data rates. In order to avoid interference between different wireless systems, regulators allocate specific frequency bands for specific uses, such as cellular networks, Wi-Fi, and Bluetooth. With the ongoing development of new wireless technologies, including 5G and IoT, managing the Wireless Spectrum and allocating frequencies will remain a critical challenge for regulators and industry stakeholders alike.
To know more about Wireless Spectrum please visit
https://brainly.com/question/10248654
#SPJ11
Match the term in column A with the definitions in column B. Write the letter of the definition in the space provided.
6. Corporation - E. A business organization legally distinct from its owners, treated as if it were an individual.
What is business?Business is an economic activity involving the exchange of goods and services for money or other goods and services. It involves the production, distribution and sale of goods and services to customers. Businesses can be located in physical stores or online.
7. Stock - A. A portion of ownership of a firm.
8. Share - G. Represents ownership of a firm.
9. Dividend - C. Profit paid to a shareholder.
10. Common Stock - D. Stock that provides shareholders a voice in how the company is run and a share in the profits.
11. Preferred Stock - B. Provides guaranteed dividends but no voice in running a corporation.
12. Corporate Bond - I. Certificate issued by a corporation in exchange for money borrowed from an investor.
13. Principal - F. The actual amount of money borrowed.
14. Interest - H. Predetermined amount of money a borrower must pay for the use of borrowed funds.
To learn more about economic
https://brainly.com/question/28895554
#SPJ1
A single stranded sequence of a gene is shown below. An investigator wants to amplify and isolate this small gene using PCR. Design two PCR primers, each 15 nucleotides long, that can be used to amplify this DNA segment. (remember that DNA sequences are written 5' to 3' by convention) ACTTTCCAAACGCCCCGTGTCGATACTGAACGAATCGATGCACGCTCCC TTCCTTGAAAACGCATAAACATACAAGTGGGCAGATGATGCGTACGCCC CTCTAATACATCCAACACTCTACGCCCTCTTCAAGAGCTGGAAGGGCA CCCTGCACTTGGATAGGGGATTATCTCGTAAGGCAAGCTCGTACCGTC ATTCATGCGGAAGAGTTAACACGATTGGAAGTAGGGATAGTTTCGAA CCTCGGTTACTAGTCCTAATAAGGGAACGCTGTCTGAAGGATGAGTGT CAGCCAGTGTA Forward Primer Reverse Primer
The forward primer for PCR amplification of the given gene sequence is 5'-ACTTTCCAAACGCCC-3', and the reverse primer is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.
To design the PCR primers for amplifying the given gene sequence, we need to identify regions that flank the target segment. The primers should be complementary to the template DNA and positioned in such a way that DNA synthesis occurs in the desired direction.
Based on the provided gene sequence, the forward primer is designed to bind to the coding (sense) strand of DNA. It starts at position 1 (5'-end) and extends for 15 nucleotides. The forward primer sequence is 5'-ACTTTCCAAACGCCC-3'.
The reverse primer, on the other hand, is designed to bind to the non-coding (antisense) strand of DNA. It starts at a position near the end of the gene sequence (position 241) and extends for 15 nucleotides in the opposite direction. The reverse primer sequence is 5'-TACACTCATCCTTCAGACAGCGTTTCCCTTATTAGGACTAGTAACCGAGG-3'.
These primers will anneal to their complementary sequences on the template DNA during the PCR amplification process. The resulting amplicon will span the target gene segment and can be subsequently isolated and studied further.
To learn more about amplification click here brainly.com/question/30300512
#SPJ11
In the visible light spectrum, the color with the lowest frequency has...Select one:a. the shortest wavelength.b. the longest wavelength.c. a wavelength similar to that of the color with the highest frequency.d. the same wavelength as all other colors in the spectrum
In the electromagnetic spectrum the greater the frequency the smaller the wavelength, then is the frequency is the lowest in the light spectrum the light will have the longest wavelength. Therefore, the answer is b.
___________ is the study of bodies masses and forces when they are speeding up or slwiing down
Dynamics is the study of bodies' masses and forces when they are speeding up or slowing down. It is a branch of physics that focuses on the analysis of motion and the effects of external factors, such as force and torque, on the movement of objects. Dynamics is divided into two main subfields: kinematics and kinetics.
Kinematics deals with the description of motion, such as displacement, velocity, and acceleration, without considering the causes of the motion. It helps us understand how an object moves, but it does not explain why the object is moving.
On the other hand, kinetics examines the relationship between the forces acting on an object and the resulting motion. It focuses on concepts like Newton's laws of motion, which are fundamental principles in understanding the behavior of moving objects. These laws explain how external forces affect an object's acceleration, based on its mass and the applied force.
Dynamics has various practical applications in everyday life and scientific research. For instance, it helps engineers design vehicles and machines by predicting their performance under different operating conditions. In sports, it assists in understanding how athletes can optimize their movements to achieve better results.
In summary, dynamics is the study of the motion of objects and the forces that cause them to speed up or slow down. It is essential for understanding the behavior of objects in motion and has significant applications in various fields, such as engineering, sports, and physics.
To know more about Dynamics, refer to the link below:
https://brainly.com/question/30651156#
#SPJ11
the position of a particle is m. determine its velocity and acceleration as a function of time. ( 0 3 ) m/s ( 4 0 0 ) m/s2 what are its velocity and acceleration at time ?
At time t = 0, the velocity and acceleration of an object are represented by the equations a. (t) = 8 hati + 0 hatj - 0 hatk, and a. (0) = 8 hati + 0 hatj - 0 hatk.
The particle position is given as
\underset{r}{\rightarrow}(t) = 4 t2\hat{i} + 2.4 \hat{j} - 5.6 t \hat{k}
velocity is given as the derivative of position relative to time
1 (t) = dx(t)/dt
1 (t) = (d/dt) (4 t2\hat{i} + 2.4 \hat{j} - 5.6 t \hat{k})
1 (t) = (8t) \hat{i} + 0 \hat{j} - 5.6 \hat{k}
acceleration is given as the derivative of velocity relative to time
a. (t) = d1 (t)/dt
a. (t) = (d/dt) ((8t) \hat{i} + 0 \hat{j} - 5.6 \hat{k})
a. (t) = 8 \hat{i} + 0 \hat{j} - 0 \hat{k}
velocity is given as
1 (t) = (8t) \hat{i} + 0 \hat{j} - 5.6 \hat{k}
at t = 0
1 (0) = (8(0)) \hat{i} + 0 \hat{j} - 5.6 \hat{k}
1 (0) = 0\hat{i} + 0 \hat{j} - 5.6 \hat{k}
acceleration is given as
a. (t) = 8 \hat{i} + 0 \hat{j} - 0 \hat{k}
at t = 0
a. (0) = 8 \hat{i} + 0 \hat{j} - 0 \hat{k}
Learn more about Velocity here:
https://brainly.com/question/17127206
#SPJ4
A go cart with a mass of 60 kg is moving at a rate of 10 m/s. How much Kinetic Energy does the go cart have?
Answer:
3000 JExplanation:
The kinetic energy of an object can be found by using the formula
\(k = \frac{1}{2} m {v}^{2} \\ \)
m is the mass in kg
v is the velocity in m/s
From the question
m = 60 kg
v = 10 m/s
We have
\(k = \frac{1}{2} \times 60 \times {10}^{2} \\ = 30 \times 100 \\ = 3000\)
We have the final answer as
3000 JHope this helps you
Answer:
\(\boxed {\boxed {\sf 3000 \ J}}\)
Explanation:
Kinetic energy is the energy an object has due to motion. It is calculated using the following formula:
\(KE=\frac{1}{2} mv^2\)
The mass of the go-cart is 60 kilograms and the velocity is 10 meters per second.
m= 60 kg v= 10 m/sSubstitute the values into the formula.
\(KE= \frac{1}{2} (60 \ kg)(10 \ m/s)^2\)
Solve the exponent.
(10 m/s)² = 10 m/s * 10 m/s = 100 m²/s²\(KE = \frac{ 1}{2} (60 \ kg)(100 \ m^2/s^2)\)
Multiply the numbers together.
\(KE= 30 \ kg * 100 \ m^2/s^2\)
\(KE= 3000 \ kg*m^2/s^2\)
Convert the units. 1 kilogram meter squared per second squared is equal to 1 Joule, so our answer of 3000 kg*m²/s² equals 3000 Joules.
\(KE= 3000 \ J\)
The go-cart has 3000 Joules of kinetic energy.
A jet plane acceleration along a straight run way from rest to a speed of 140 m/s in 50 seconds when it took off. Calculate:
1- it’s change of velocity
2- it’s acceleration
Please help me it’s emergency
Answer:
Vf=140 m/s
Vi=0
t=50s
Explanation:
1. Acceleration is called change of velocity.
2. a=Vf-Vi/t
a=140-0/50
a=140/50
a=2.8m/s^2
20. A 0.450-kg baseball comes off a bat and goes straight up. At a height of 10.0 m, the
baseball has a speed of 24.5 m/s.
a. Determine its mechanical energy at this height. Show your work.
b. What is the baseball's mechanical energy when it is at a height of 9.0 m? Explain your answer.
Answer:
for a 3.4950
for b 1.24950
Mechanical energy at 10.0 height =135.05625 joule
Mechanical energy when it is at a height of 9.0 m = 40.5 joule
What is mechanical energy?
Mechanical energy is the energy associated with the motion and position of an object.It is the sum of potential energy and kinetic energy. For example, a moving ball possesses mechanical energy in the form of kinetic energy.A ball in the ground possesses mechanical energy in the form of potential energy.
Conservation of mechanical energy:-
a. At a height of 10.0 m having speed 24.5m/s
kinetic energy= 1/2*mass*(speed)²
1/2*0.450*24.5*24.5
135.05625 joule
b.Mechanical energy at a height of 9.0 m
kinetic energy is equal to change in potential energy
potential energy= MGH
0.450*10*9
40.5 joule
Learn more about energy conservation here:-https://brainly.com/question/12306849
#SPJ2
Sara pushed a box of lab equipment along the ground, displacing it by 1 metre. By doing this, she has done __________ on the box of lab equipment.
Sara pushed a box of lab equipment along the ground, displacing it by 1 meter. she has done work on the box of lab equipment.
When a force is applied and an object is moved over a specified distance, a work has been completed. The following formula is used to calculate an object's work,
W = Fd
Where, F is the applied force, and d is the object's displacement.
When we apply force "F" to a block, the body moves with some acceleration or, additionally, its speed increases or decreases depending on the direction of the force. The system's kinetic energy changes as speed increases or decreases. Since we are aware that energy cannot be created or destroyed, it must be changed into another form. This perspective refers to it as completed work.Therefore ,Sara has therefore completed her work on the box of lab equipment when she moves it by 1 m.
To know more about work
https://brainly.com/question/29673580
#SPJ4
At first, right after the Big Bang, the universe was too hot for nuclei and electrons to combine into the kinds of neutral atoms that are familiar to us today. How soon after the beginning did it become cool enough for neutral atoms to form
After the Big Bang, it took the universe 3 minutes to become cool enough for neutral atoms to form.
Time taken for the universe to cool after the Big Bang
During the first moment, immediately after the Big Bang, the universe was too hot for nuclei and electrons to combine into the kinds of neutral atoms that are familiar to us today.
In the first three minutes after the Big Bang, these protons and neutrons began fusing together, forming deuterium also known as heavy hydrogen.
Thus, after the Big Bang, it took the universe 3 minutes to become cool enough for neutral atoms to form.
Learn more about Big Bang here: https://brainly.com/question/10865002
#SPJ1
Santa's sleigh flies at 3 times the
speed of sound. That's a
whopping 1.04 x 106 m/s. Santa's
sleigh actually makes a Sonic Boom
when it surpasses the speed of
sound! (keep your ears open for
that on Christmas Eve!). How
much kinetic energy must Santa's
sleigh have if its mass is 7,500 kg?
(Let us assume he is not carrying
ALL 7.5 billion presents at once!)
Mass of Santa's sleigh = 7500kg
3 x Speed of sound = 3704km/h
Kinetic Energy = 1/2 mv²
= ½ (7500)(3704)²
Kinetic Energy = 3969796931.4637 J
What is sonic boom?
A loud, explosive sound produced by a by a plane's shock wave when it flies faster than sound.
Know more about speed of sound:
https://brainly.com/question/95976
#SPJ1
Where is the south pole of the bar magnet, based on the magnetic field lines
shown?
A. On the right end
B. On the bottom edge
C. On the left end
D. On the top edge
SUBMIT
it would be on the right end I believe. Forgive me if I am incorrect.
how does temperature change as you go higher and higher in the stratosphere?
As you go higher and higher in the stratosphere, the temperature actually increases.
The stratosphere is a layer of Earth's atmosphere that lies above the troposphere and below the mesosphere. It starts at about 10 to 13 kilometers (6 to 8 miles) above the Earth's surface and extends up to approximately 50 kilometers (31 miles).
The stratosphere contains the ozone layer, which absorbs the sun's ultraviolet radiation and converts it into heat. The higher you go in the stratosphere, the more ozone there is, and the more heat is generated.
Therefore, the temperature increases as you go higher in the stratosphere. This is in contrast to the troposphere, the layer of the atmosphere closest to the Earth's surface, where the temperature decreases as you go higher.
Learn more about stratosphere here: https://brainly.com/question/28097222.
#SPJ11
23.6cm= what in meters
Explanation
23.6/100= 0.236
Which is not a piece of evidence that most scientists use to prove the origin of our universe?
A. Movement of the galaxies (expansion)
B. Cosmic microwave background
C. Presence of hydrogen and helium in the
correct percentages throughout the
universe
D. The contraction of objects in space
Answer:
D) The contraction of objects in space
Explanation:
A) Expansion of the universe as originated from the Big Bang is an important evidence, as B) the Cosmic microwave background which is thought to be left over from the Big Bang. The right proportion of hydrogen and helium as unprocessed material that has been detected as the basic elements from where the universe started.
The only out of context option is option D
How many mega-joules of energy does 4.967×10
4
gallons of gasoline correspond to? 5.090×10
4
MJ 5.638×10
6
MJ 2.273×10
−3
MJ 6.137×10
6
MJ 6.400×10
6
MJ 1.497×10
3
MJ
The amount of energy that 4.967×10^4 gallons of gasoline correspond to is 5.638×10^6 mega-joules (MJ).
Gasoline is a commonly used fuel in vehicles, and its energy content is measured in mega-joules (MJ). The energy content of gasoline can vary slightly depending on factors such as the blend and composition, but on average, it is approximately 120 MJ per gallon.
To calculate the total energy content of 4.967×10^4 gallons of gasoline, we can multiply the energy content per gallon (120 MJ) by the number of gallons:
4.967×10^4 gallons * 120 MJ/gallon = 5.9604×10^6 MJ
Rounding the result to three significant figures, we get 5.638×10^6 MJ.
In summary, 4.967×10^4 gallons of gasoline correspond to approximately 5.638×10^6 mega-joules (MJ) of energy.
Learn more about: Energy
brainly.com/question/1932868
#SPJ11
if a truck goes 30 kilometers in 30 minutes what is the average speed
Answer:
60 km per hour
Explanation:
if you drive for 30 min and go 30km then if you drive for 60 min(1hr) then you would have driven 60km.
Answer:
60
Explanation:
hope this helps