Consider an individual with red-green colour deficiency.What is the minimum possible number of the child's GRANDPARENTS who were also red-green colour deficient?*note* Please enter numbers only - (0-4)

Answers

Answer 1

As the character is recesive and humans are diploid, the idividual must have both alleles with the information for red-green colour deficiency if she is a woman, or the only allele with that information if he is a man; this is because the gene for colour deficiency is located on the sexual chromosome X.

Therefore, if both grandmothers have the allele for colour deficiency but they have a heterozygous genotype, neither of the grandparets would have colour blindness, even though, they could give their offspring the red-green colour deficiency allele.

To sum up, 0 grandparents can be red-green colour deficient (but at least one must have the corresponding allele) and have a grandson/daughter with red-green colour deficiency.


Related Questions

Which statement is mostly likely a scientific law

Answers

The first option is correct that Objects that are sitting still tend to stay still until something pushes or pulls them it is called as law of inertia

An example of the law of inertia in everyday life (movement inertia) If the bus suddenly stops, the person will fall forward. When the bus driver brakes hard, the lower body stops and the bus stops, but the upper body continues to move forward due to the inertia of the movement. This is called the law of inertia. This is because all bodies have the property of resisting changes in their states of rest or motion. This property is called inertia.

The question is incomplete the complete question is:-

Which statement is most likely to be scientific law? A. Objects that are sitting still and tend to stay still until something pushes or pulling them. B. Plants are green due to color of the chemicals and that help them use sunlight. C. There are as many kinds of the animals because of the competition and the adaptation over the billions of years. D. Diseases that spread among the people because of the microorganisms can travel through the air.

To know more about law of inertia visit:

https://brainly.com/question/1830739

#SPJ1  

The increase in blood flow to exercising active skeletal muscle relative to other organs is largely caused by the

Answers

Answer:

muscle contraction increases interstitial fluid pressure and compresses the blood vessels within the active muscle. As a consequence, blood flow is highest when muscles relax between successive muscle contractions.

Explanation:

Pulling a block of clay apart, resulting in the middle portion thinning and sinking, is an adequate analogy for

Answers

Pulling a block of clay apart, resulting in the middle portion thinning or sinking, is an adequate analogy for the process of lithospheric thinning and the formation of a rift or divergent plate boundary.

An analogy is a comparison between two different things that highlights their similarities in order to explain or illustrate a concept, idea, or situation. It involves drawing parallels between two domains to enhance understanding. Analogies often use familiar or concrete examples to explain abstract or complex concepts. By highlighting the similarities between the known and the unknown, analogies provide a relatable context that aids in comprehension and allows individuals to apply their existing knowledge to new or unfamiliar situations.

Learn more about analogy here:

https://brainly.com/question/30302605

#SPJ11

The principle of states that, in an undisturbed sequence, the oldest

rocks are at the bottom of the sequence and successive layers are younger than those

below them

A;Lateral Continuity
B;Super position
c;Inclusions
d;Original Horizontality

Answers

Answer:

The principle of states that, in an undisturbed sequence, the oldest

rocks are at the bottom of the sequence and successive layers are younger than those

below them

A;Lateral Continuity

B;Super position

c;Inclusions

d;Original Horizontality

The principle of states that, in an undisturbed sequence, the oldest rock are at the bottom of the sequence and successive layers are younger than those below them is Original Horizontality. Thus option D is correct.

What is rock ?

A rock is formed due to the deposition of different mineral constituents  in the  earth’s crust and different types of rocks are formed based on different factors such as Geological classification, Physical classification, Chemical classification.

On the basis of Geological classification, three types of rocks are observed such as Sedimentary rock formed by the deposition of sediments formed by the process of weathering of pre-existing rocks and the sediments.

These sediments  are transported by external agents like  water, wind, frost, gravity, etc. Examples are Sandstone, limestone, lignite, etc.

Igneous rocks formed by  the process of solidification of magma below the earth’s surface, unable to descend, these magma when cools down  and solidifies into igneous rocks.

Thus option D is correct.

Learn more about rock , here:

brainly.com/question/21634781

#SPJ2

HELP ASAP


Which statement is true of chloroplasts?


They protect the plant cell and make it hurt to punch a tree

They convert light energy into chemical energy.


They convert glucose to ATP

They are ONLY in animal cells

Answers

Answer:

The answer is They convert light energy into chemical energy!

Explanation:

Chloroplasts use photons from the sun to react with their chlorophyll, and in turn, photosynthesize, producing oxygen and sugars!...hoped this helped :D

the tiny hairs that keep mucus and dirt out of your lungs are called:

Answers

Answer:

The bronchus in the lungs are lined with hair-like projections called cilia that move microbes and debris up and out of the airways. Scattered throughout the cilia are goblet cells that secrete mucus which helps protect the lining of the bronchus and trap microorganisms.

Explanation:

Answer:

Cilla

Explanation:

Cilla keeps mucus and dirt out of our lungs.


I hope it helps! Have a great day!

Muffin~

Use the drop-down menus to complete the sentences about air pollution. the burning of causes dangerous gases to enter the atmosphere. heavy, dense fog caused by dangerous gases mixing in the atmosphere is called . occurs when dangerous gases mix in the atmosphere and fall back to the surface in liquid form.

Answers

Air pollution is caused the burning of fossil fuels, resulting in the formation of smog and acid rain.

What is air pollution?

Air pollution is the release of harmful substances into the air which makes it unfit and unhealthy for breathing.

Substance which pollute the air are known as air pollutants.

The burning of fossil fuels causes dangerous gases to enter the atmosphere. Heavy, dense fog caused by dangerous gases mixing in the atmosphere is called smog. Acid rain occurs when dangerous gases mix in the atmosphere and fall back to the surface in liquid form.

Therefore, air pollution is caused by releasing pollutants air.

Learn more about air pollution at: https://brainly.com/question/9420026

Answer:

yee

Explanation:

The burning of ✔ fossil fuels causes dangerous gases to enter the atmosphere. Heavy, dense fog caused by dangerous gases mixing in the atmosphere is called ✔ smog

✔ Acid rain occurs when dangerous gases mix in the atmosphere and fall back to the surface in liquid form.

El Niño is caused by __________. A) ocean currents B) the isolation of continents C) orography D) all of the above

Answers

Answer:

A) ocean currents is correct

Explanation:

El Nio is caused by __________. A) ocean currents B) the isolation of continents C) orography D) all

El Niño is caused by ocean currents. So, the correct option is (A).

What are Ocean currents?

An ocean current is a type of continuous, directed movement of ocean water that is generated by a number of forces acting on the water including wind, the Coriolis effect, breaking waves, cabling, and temperature and salinity differences.

These can be caused by density differences in air, water masses that occur due to temperature and salinity variations, gravity, and events such as earthquakes or storms. These are continuous streams of sea water that spread through the ocean.

An El Niño condition typically occurs when surface waters in the equatorial Pacific become warmer than average and easterly winds become weaker than normal.

Thus, El Niño is caused by ocean currents. So, the correct option is (A).

Learn more about Ocean currents, here:

https://brainly.com/question/21654036

#SPJ2

The Pelagic zone is divided into 5 vertical layers.

True
False

Answers

Answer : I thank its True I Hope it Can Help : )

Explanation:

Answer:

false

Explanation:

The vertical zones in the ocean include the epipelagic, mesopelagic and bathypelagic zones. The zones are based on the amount of light that penetrates the ocean waters. The epipelagic zone is also called the sunlit zone because it receives enough sunlight to support photosynthesis.

it is divided into three vertical layers

Select the correct answer from each drop-down menu.
A
is an agent that causes disease. All
are pathogens.

Answers

A pathogens(C) is an agent that causes disease. All viruses(C)  are pathogens.

What are pathogens?

For Part 1, the correct answer is C. Pathogen. A pathogen is an agent that causes disease. All pathogens are infectious agents, but not all infectious agents are pathogens. For example, the common cold is caused by a virus, but the virus is not considered a pathogen because it does not usually cause serious illness.

For Part 2, the correct answer is C. Viruses. Viruses are the smallest and simplest pathogens. They are not cells, and they cannot reproduce on their own. They must infect a host cell in order to replicate.

Find out more on pathogens here: https://brainly.com/question/4205913

#SPJ1

Complete question:

Select the correct answer. A __ is an agent that causes disease. All ___ are pathogens.

Part 1

A. Bacteria

B. Germ

C. Pathogen

Part 2

A. Bacteria

B. Fungi

C. Viruses

Write a scientific explanation that explains why factors that are harmful to other plant species are beneficial for the Venus flytrap

Answers

The Venus flytrap is an insectivorous plant native to the Southeastern United States. It is well-known for its carnivorous behavior, capturing and digesting insects to supplement its nutrient intake.

The Venus flytrap is adapted to grow in nutrient-poor environments and, as a result, has developed unique characteristics to survive. In this scientific explanation, we will explore how factors that are harmful to other plant species are beneficial for the Venus flytrap.
The Venus flytrap has evolved to thrive in environments that are low in nitrogen and other essential nutrients. As a result, the plant has developed unique mechanisms to obtain the nutrients it needs. One of the ways the Venus flytrap obtains nitrogen is by capturing and digesting insects. The plant uses specialized leaves that have evolved to form a trap. When an insect lands on the leaves, the plant detects movement and snaps the trap shut, trapping the insect inside. The plant then secretes digestive enzymes that break down the insect's tissues and release the nitrogen and other essential nutrients that the plant needs.
Factors that are harmful to other plant species, such as nitrogen-deficient soil, are actually beneficial for the Venus flytrap. This is because the plant has evolved to obtain nutrients in a unique way, using its carnivorous behavior to supplement its nutrient intake. In environments that are low in nitrogen, the Venus flytrap has a competitive advantage over other plant species because it has a unique way of obtaining the nutrients it needs. As a result, the Venus flytrap is able to survive and thrive in environments that would be inhospitable to other plant species.
For more such questions on Venus flytrap, click on:

https://brainly.com/question/14148170

#SPJ11

help what is the element that was like named after the elemenT HELP PLEASE

help what is the element that was like named after the elemenT HELP PLEASE

Answers

it’s either americium or californium but i think it would be americium

Answer:

Californium

Explanation:

It says US STATE and obviously california is a us state

True vertebrates have a true head that develops from a neural crest of cells and hard structures surrounding the notochord.

Answers

Yes. True vertebrates have a true head that develops from a neural crest of cells and hard structures surrounding the notochord.

The neural crest, which forms early in the development process in vertebrate embryos, is a fold on the neural plate where the neural and epidermal ectoderms converge. As an embryo grows, the neural crest produces neural crest cells (NCCs), which can differentiate into a variety of different cell types and contribute to tissues and organs.

The notochord is a temporary structure that plays a crucial role in higher animals. It secretes substances that communicate with all neighbouring tissues, telling them where they are and what will happen to them.

Therefore, True vertebrates have a true head that develops from a neural crest of cells and hard structures surrounding the notochord.

Learn more about notochord here:

https://brainly.com/question/11871768

#SPJ4

steelhead fish are predators of predatory insects, which in turn feed on midge larvae. the midge larvae feed on algae. if you increased the number of steelhead fish, what would you expect to happen to the algae in the stream by indirect effects? group of answer choices the algae would increase. the algae would decrease. the algae would not be affected by more fish since they are carnivores, not herbivores.

Answers

Answer:

The algae would decrease.

Explanation:

As the number of steelhead fish increases, they will consume more predatory insects, which in turn would consume more midge larvae. As a result, there would be fewer midge larvae to feed on the algae, leading to a decrease in the amount of algae in the stream. This is an example of a trophic cascade, where changes in the population of one species can have cascading effects on other species in the ecosystem through the food web.

It is thought that Chrysotoxum cautum evolved from an insect that did not have any
stripes.
Suggest how these insects became striped.

Answers

The evolution of striping in Chrysotoxum cautum may have occurred through natural selection. One possibility is that the original non-striped insect population had some degree of natural variation in their body coloration. This natural variation could have included a slight pigmentation pattern that was more pronounced in some individuals than in others.

If the environmental conditions where these insects lived changed, this variation in pigmentation could have had an impact on the insects' survival and reproductive success. For example, if the insects lived in an environment where predators were present and striped patterns offered a protective advantage by camouflaging the insects in their surroundings, then those insects with more pronounced striping would be more likely to survive and pass on their genes to the next generation. Over time, this selective pressure would favor the development of striping in the population.

Alternatively, it is possible that the development of stripes in Chrysotoxum cautum could have been a result of sexual selection. Insects with more pronounced stripes may have been more attractive to potential mates, leading to increased mating success and the passing on of genes that promote striping.

It is also worth noting that the evolution of striping in Chrysotoxum cautum may not have been a simple process and could have involved many other factors beyond natural or sexual selection, such as genetic drift, mutation, or other environmental pressures. Ultimately, it is difficult to know exactly how striping evolved in these insects without direct observations or a comprehensive analysis of the genetic and environmental factors involved.

2. On the islands of Hawaii, approximately 800 species of fruit flies have evolved from just one ancestral species over roughly 8 million years. The heads, forelegs, wings, and mouthparts of different species all look and function very differently.
How could so many species have evolved from one ancestral fruit fly species?

Due to the ____ from the first small population, the population's____ could have differed from the mainland fruit flies. The process of ____ resulted in adaptations and ____ of the island population into new fruit fly ____ over time. Some of the fruit flies traveled to other islands where they were ____ and evolved into more species.

Answers

Answer:

Due to the isolation from the first small population, the population's gene pool could have differed from the mainland fruit flies. The process of natural selection resulted in adaptations and speciation of the island population into new fruit fly species over time. Some of the fruit flies traveled to other islands where they were isolated and evolved into more species.

Which of the following is NOT part of the quadriceps group? *
(1 Punto)
rectus femoris
biceps femoris
vastus medialis
vastus lateralis

Which of the following is NOT part of the quadriceps group? *(1 Punto)rectus femorisbiceps femorisvastus

Answers

Answer:

biceps femoris

Explanation:

the group contains four separate muscles: the vastus lateralis, vastus medialis, vastus intermedius, and the rectus femoris

The option that is not part of the quadriceps group is the biceps femoris.

The quadriceps groups are powerful extensors that are in the knee joint. The quadriceps groups are vital for walking, jumping, running, and squatting.

The quadriceps groups are rectus femoris, vastus medialis, vastus lateralis, and vastus intermedius. The muscles are vital in extending the knees and are vital for any activities that involve the leg.

In conclusion, the one that is not part of the quadriceps group is the biceps femoris.

Read related link on:

https://brainly.com/question/18239163

How do male bears fighting over female bears result in an overall better adapted beat population?

Answers

This phenomenon produces a better generation because competition gives rise to a most adapted population with higher fitness.

What is natural selection?

Natural selection refers to the differential reproduction of individuals in a population which lead to its evolution across time.

The better-adapted individuals will have more chances to reproduce and therefore they will perpetuate their genes in the offspring (next generation).

In conclusion, this phenomenon produces a better generation because competition gives rise to a most adapted population with higher fitness.

Learn more about natural selection here:

https://brainly.com/question/23929271

#SPJ1

quarterback takes a hard hit and is carried off the field on
stretcher. Why might he have a better chance of recovery
than quarterbacks of previous generations?

Answers

The doctor will have more advanced medical equipment than before.

An open system in which the growth rate is maintained by the removal and addition of media at such a rate as to maintain a constant cell density is called a
a. manostat.
b. chemostat
c. turbidostat.
d. culturostat.

Answers

The answer to your question is b. chemostat.

A chemostat (from chemical environment is static) is a bioreactor to which fresh medium is continuously added, while culture liquid containing left over nutrients, metabolic end products and microorganisms is continuously removed at the same rate to keep the culture volume constant.

The principle of chemostat culture is based on the relationship between the specific growth rate and a limiting nutrient concentration that regulates the growth rate in such a way that it matches a preset constant dilution rate.

a) Type I chemostat. (b) Type II chemostat. A mathematical model describing continuous microbial culture and harvest in a chemostat, incorporating a control strategy and defined by impulsive differential equations, is presented and investigated.

to know more about chemostat. click this link -

brainly.com/question/30507563

#SPJ11

why is the digestive tract of the frog well vascularized

Answers

The digestive tract of the frog is well vascularized because it aids in the absorption of nutrients.

The digestive tract of a frog is a hollow long tube that extends from the mouth to the anus which helps in the ingestion and digestion of food.

The digestive tract of frog has the following characteristics:

alimentary canal of the frog is not long, that is, it is short. It has accessory organs of digestion such as liver, gall bladder and pancreas.

All the digested food substances are absorbed at the small intestine due to the presence of microvilli.

This microvilli is made up of a central core that is vascularized, that is, it contains artery, vein and lymphatic capillary.

Therefore, the vascularized microvilli of the small intestine of frog help in the absorption of nutrients.

Learn more here:

https://brainly.com/question/12993303

why do we use the term cfu instead of reporting bacterial per ml?
A) Because only colonies are seen.
B) It can't be proven that a colony arose from a single cell.
C) All organisms form colonies.
D) Contaminants might be present.

Answers

We use the term CFU (colony-forming unit) instead of reporting bacteria per ml for several reasons, one of which is option B: it can't be proven that a colony arose from a single cell.

When we count bacteria using colony-forming units, we are assuming that each colony on a petri dish originated from a single viable bacterium.

However, it is possible for multiple bacteria to cluster together and form a single colony, making it inaccurate to equate one colony with one bacterium.

Moreover, option D is also relevant: contaminants might be present. When counting bacteria directly as cells per ml, it is challenging to differentiate between the target bacteria and other microorganisms or debris that may be present in the sample.

CFU allows us to count only the viable and potentially pathogenic bacteria that have the ability to form colonies under specific conditions, thereby excluding non-viable cells or contaminants.

In summary, using CFU instead of reporting bacteria per ml accounts for the uncertainty of colony origin and helps focus on viable and potentially pathogenic bacteria, disregarding contaminants and non-viable cells.

Thus, Option B) It can't be proven that a colony arose from a single cell is correct

Learn more about CFU:

https://brainly.com/question/28936779

#SPJ11

The net number of atp molecules produced durign glycolysis from the metabolism of a single glucose molecule is closest to which of the followig

Answers

Scientists investigated the effect of oxygen levels on the net rate of carbon fixation in two types of plants.

The net rate of carbon fixation refers to the overall rate at which plants convert carbon dioxide (CO2) into organic compounds through photosynthesis. In this study, researchers examined how different oxygen levels affected this process in two types of plants.

Photosynthesis involves two main processes: the light-dependent reactions and the light-independent reactions (also known as the Calvin cycle). During the light-dependent reactions, oxygen is produced as a byproduct, while the light-independent reactions involve the fixation of carbon dioxide into organic molecules.

The oxygen levels in the environment can affect the net rate of carbon fixation in plants. Higher oxygen levels can inhibit the activity of the enzyme RuBisCO, which is crucial for the fixation of carbon dioxide. This inhibition can lead to a decrease in the net rate of carbon fixation. However, different plants may have different abilities to adapt to varying oxygen levels. Some plants, known as C4 plants, have mechanisms that minimize the inhibition of RuBisCO by oxygen, allowing them to continue fixing carbon efficiently even under higher oxygen conditions.

By investigating the effect of oxygen levels on carbon fixation in different types of plants, scientists can gain insights into the adaptations and physiological mechanisms that enable plants to thrive in various environments.

Learn more about photosynthesis here :

https://brainly.com/question/29775046

#SPJ11

PLS HELP ME WITH THIS!!!

What is the nucleotide sequence of the mRNA strand you built?

Answers

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

Answer:

AUG CUG ACC UAG

Explanation

If this question is on the gizmo "RNA and Protein Synthesis" then this is the answer for that.

At ground level, how are rain and hail similar?

Answers

Answer:

Sleet and hail are similar forms of precipitation. ... Sleet is partly frozen rain, and precipitation in the form of hail is basically ice balls. Graupel is formed from ice-coated snow crystals that fall to the Earth's surface. After falling to the ground, graupel is generally called snow pellets.

Sleet and hail are similar forms of precipitation. ... Sleet is partly frozen rain, and precipitation in the form of hail is basically ice balls. Graupel is formed from ice-coated snow crystals that fall to the Earth's surface. After falling to the ground, graupel is generally called snow pellets.

In an experiment, a scientist decides to study the effect of exercise on cholesterol levels in people. He studies two set of people—those who exercise every day for an hour and those who don’t exercise at all. In this case, the statement that people who exercise for an hour may have lower cholesterol levels is
. To test this statement, the scientist would measure cholesterol levels in exercisers and non-exercisers. The cholesterol levels would be
.

Answers

The statement that people who exercise for an hour may have lower cholesterol levels is a hypothesis. The cholesterol level would be the dependent variable.

What are hypotheses?

In science, hypotheses are tentative statements made regarding natural phenomena. These statements are untested. They can be tested using relevant experiments.

Thus, hypotheses are usually made before relevant experiments are conducted.

Thus, in the illustration, the statement that people who exercise for an hour may have lower cholesterol levels is considered a hypothesis.

Also, in experiments, there are different types of variables:

Independent variablesDependent variables

Independent variables are supplied by researchers and can be manipulated to produce different outcomes.

Dependent variables are a measure of the effects of the independent variables.

Thus, in the illustration, the level of exercise is the independent variable. The variable that the exercise was hypothesized to affect is the cholesterol level. Meaning that cholesterol level is the dependent variable.

More on research variables can be found here: https://brainly.com/question/28526414

#SPJ1




Compare and contrast genetic engineering to the process of natural selection. Select all statements that
are true.
tinn aonetic engineer

Answers

Answer:

Explanation:

Genetic engineering is faster than the process of natural selection.

Natural selection is natural process and it works over generations, while genetic engineering involves desired modification of traits.

Both genetic engineering and natural selection work on all organisms, including humans.

Match the type of rock with its correct it’s description

Match the type of rock with its correct its description

Answers

Answer: metamorphic is high pressure, igneous is lava formation, and sediment is by minerals

Explanation:

part a - concept review photosynthesis is a process that converts solar energy into chemical energy. can you fill in the following statements about photosynthesis? place the terms in the appropriate blanks to complete the sentences. resethelp 1. photosynthesis converts blank energy into blank energy.target 1 of 6target 2 of 6 2. molecules that absorb specific colors of light are called blank.target 3 of 6 3. the light reactions absorb solar energy and transfer it to molecules of blank and blank.target 4 of 6target 5 of 6 4. the calvin cycle uses energy from atp and nadph to synthesize blank.target 6 of 6

Answers

Photosynthesis is the process that converts solar energy into chemical energy by absorbing specific colors of light through molecules. The absorbed solar energy is transferred to molecules of ATP and NADPH during the light reactions, which are then used by the Calvin cycle to synthesize organic molecules.

Photosynthesis is a process that converts solar energy into chemical energy. The following statements about photosynthesis are as follows :

1. Photosynthesis converts solar energy into chemical energy.

2. Molecules that absorb specific colors of light are called pigments.

3. The light reactions absorb solar energy and transfer it to molecules of ATP (adenosine triphosphate) and NADPH (nicotinamide adenine dinucleotide phosphate).

4. The Calvin cycle uses energy from ATP and NADPH to synthesize carbohydrates (specifically, glucose).

The light reactions are the first stage of photosynthesis, and they occur in the thylakoid membranes of the chloroplasts. During these reactions, pigments (such as chlorophyll) absorb solar energy and use it to create high-energy molecules such as ATP and NADPH. These energy-rich molecules are then used in the second stage of photosynthesis, the Calvin cycle.

The Calvin cycle takes place in the stroma of the chloroplasts and uses the energy from ATP and NADPH to fix carbon dioxide and synthesize carbohydrates, specifically glucose. This process involves a series of enzyme-catalyzed reactions that ultimately result in the creation of glucose, which can be used by the plant for energy or stored for later use.

Overall, photosynthesis is a vital process that allows plants to produce their own food and provides oxygen as a byproduct, which is essential for the survival of many organisms.

To know more about the photosynthesis refer here :

https://brainly.com/question/29776072#

#SPJ11

What type of cell is illustrated here?

What type of cell is illustrated here?

Answers

Prokaryote because it don’t have nucleus
Other Questions
Read this passage FDR's speech to congress after the attack on Pearl Harbor: Indeed, One hour after Japanese air squadrons had commenced bombing in the American island of Oahu, the Japanese ambassador to the United states and his colleague delivered to our Secretary of state a Formal reply to a recent American message. And while this stated that it seemed useless to continue the existing diplomatic negotiations, it contained no threat or hint of war or of armed attack.Which Idea from this passage is implicit? What is the exponential expression for the numerical expression 66666? 56^5 5^6. 6^5. 30^5 32 POINTS Q5-6 (Two questions)5.A primary difference between modernism and postmodernism isSelect one:a. Postmodernist works are more likely to use a first person narrator.b. Modernist works are more likely to use a first person narrator.c. One glorifies the features like fragmentation while the other does not.d. One uses fragmentation and the other does not.6.In A sample contains 300 grams of carbon-11, which has a half-life of 20 minutes.Write a function, A, to represent the amount of carbon-11 remaining in the sample after T minutes. An oxygen gas tank holds 1 mole of gas at 10.0 atm of pressure. In order to reduce the pressure of the tank to 2.5 atm, moles must be released. How many moles will be left Why would abigail adams support the reasons later listed in the declaration of independence for separating from england?. Which of the following is a renewable resource? a. coal b. trees c. oil d. natural gas what is the most common level of education that Film and Video Editors have? bachelors degreesome college, no degreeassociate degreehigh school diploma or equivalent Consider the financial data for a project given in the following table Initial investment $100,000 Project life 5 years Annual revenue $32,000 Annual expenses $6,000 What is i* for this project? (If you use a computational tool such as Excel please make sure that your reasoning is clearly stated on your solution file) A) 7.20% B) 9.43% C) 16.74% D Answers A.B and C are not correct Find the maximum value |r| and any zeros of r. r=20-20 sin theta which phrase in paragraph 3 of "The pit and the Pendulum" most strongly contributes to a mood of tradeF fecuent and thoughts endeavors to remember6 buod reason of a later epoch= a vague homer at my heartcall to mind fitness and dampness does an angle pair have to be supplementary or complementary to be considered adjacent? The supply curve for product X is given by QXS = 360 + 10PX.The supply curve for product \( X \) is given by \( Q_{X} S^{-3}=-360+10 P X \). a. Find the inverse supply curve. \[ P=\nabla+\otimes Q \] b. How much surplus do producers receive when \( Q_{X}=450 \ A bullet of mass 32g is fired from a gun. The graph above shows the variation of the force F on the bullet with time T as it travels along the barrel of the gun. The bullet is fired at time T=0 and the length of the barrel is 0.70m. (a) State and explain why it is inappropriate to use the equation S = ut + 1/2 a(t^2) to calculate the acceleration of the bullet. (b) Use the graph to:(i) Determine the average acceleration of the bullet during the final 2.0ms of the graph (ii) show that the change in momentum of the bullet, as the bullet travels along the length of the barrel, is approximately 9Ns. (c) Use the answer in (b)(ii) to calculate the (i) speed of the bullet as it leaves the barrel(ii) average power delivered to the bullet (d) Use Newtons third law to explain why a gun will recoil when a bullet is fired ........................ PLS HELP GIVING BRAINLIEST FOR THE CORRECT ANSWER (NEEDS ANSWER IN 5 MINUTES OR ELSE NO BRAINLIEST)What is the last digit of the sum of 11+21+31+...+991? What is true of the basic organization and machinery of the cell cycle?A. It is essentially the same in all eukaryotes.B. It is fundamentally different in plant and animal cells.C. It is essentially the same in all living things.D. It is essentially the same in all single-celled organisms. You need to buy canning jar. They cost $15 a box, and you only have $150 to spend. You also have a coupon that will give you a $25 discount on your total. What is the maximum number of boxes you can buy? Use this chart of words roots and affixes, which is the most likely meaning of the word dermatology? consider the combustion of hydrogen for the next two questions. 2 h2 (g) o2 (g) 2 h2o (g) reaction is at standard temperature and pressure and all reagents are in the gas phase. if we react 10 moles of hydrogen with 6 moles of oxygen. what is the limiting reagent and how much water is produced?