Can somebody help me plz this is almost due ?

Can Somebody Help Me Plz This Is Almost Due ?

Answers

Answer 1

Answer:

Bees have been affected by pollution, climate change, and pesticides.

HTWH

Explanation:


Related Questions

A stroke occurs when a blood vessel in the brain becomes blocked or ruptures. One possible symptom of a stroke is the loss of the ability to speak normally.

Based on this symptom, which type of tissue in the brain is most likely affected by a stroke?
connective tissue
epithelial tissue
muscle tissue
nervous tissue
IM TIMED

Answers

The type of brain tissue most affected by stroke: Nervous tissue.

The brain is a complex organ that controls thought, memory, emotions, touch, motor skills, vision, breathing, temperature, hunger, and all the processes that control our body. Together, the brain and spinal cord, which extend from the spinal cord, make up the central nervous system, or CNS.

The brain can be divided into three main units: the forebrain, midbrain, and hindbrain. The hindbrain contains the upper part of the spinal cord, the brainstem, and a folded tissue ball called the cerebellum. The hindbrain controls important bodily functions such as breathing and heart rate. The brain is made up of three main parts: the cerebrum, cerebellum, and brainstem. Cerebrum: The largest part of the brain, consisting of the right and left hemispheres. It performs higher functions such as interpreting touch, sight, and hearing, as well as language, reasoning, emotion, learning, and fine movement control.

Learn more about the brain here: https://brainly.com/question/1247675

#SPJ1

What type of metamorphosis does a monarch butterfly undergo?

1. complete metamorphosis
2. incomplete metamorphosis

Answers

Answer:

1. complete metamorphosis

Answer:

Complete Metamorphosis

Explanation:

This means that there are four distinct stages: an egg, larva (caterpillar), pupa (chrysalis), and adult stage. 

PLEASE HELP ME IST URGENT

Review this image of the H. pylori bacteria:


What inference can be made based on this image?

A localized infection must be treated with antivirals.
Some pathogens may become antibiotic-resistant.
Antibiotics effectively stop viral infections.
Antibodies adapt to enzymatic viruses.

PLEASE HELP ME IST URGENTReview this image of the H. pylori bacteria:What inference can be made based

Answers

Antibiotic resistance can develop in bacterial cells. One approach is through Genetic mutations that happen during cell replication. Resistance can be acquired by bacteria through horizontal gene transfer. Thus, option B is correct.

What cause bacteria to antibiotic resistant?

The misuse and overuse of antibiotics are the main causes of drug-resistant diseases. Lack of clean water, sufficient sanitation, and efficient infection prevention and management encourage the growth of bacteria, some of which may be resistant to antibiotic therapy.

Antimicrobial resistance occurs when bacteria, fungi, and other organisms become resistant to the medications intended to eradicate them. It suggests that the germs endure and grow. Therapy for infections with resistance can be difficult, if not impossible.

Therefore, Some pathogens may become antibiotic-resistant.

Learn more about antibiotic here:

https://brainly.com/question/10868637

#SPJ1

Answer:

Some pathogens may become antibiotic-resistant.

Explanation:

i just know (;

What are the 4 heart layers and where are they located?

Answers

4 heart layers are Endocardium, Myocardium, Epicardium, Pericardium.

The heart is composed of four layers, each of which is essential for proper heart function. These four layers are:

Endocardium: This is the innermost layer of the heart, located closest to the blood. It is made up of a thin, smooth layer of cells that line the interior of the heart chambers.Myocardium: The myocardium is the middle layer of the heart and is responsible for contracting and relaxing to pump blood through the heart and body. This layer is composed of specialized muscle tissue.Epicardium: The epicardium is the outermost layer of the heart and is located directly against the myocardium. It is made up of a thin layer of connective tissue that acts as a protective barrier for the heart.Pericardium: The pericardium is the outermost layer of the heart and is located outside of the epicardium. It is composed of a sac of connective tissue that surrounds and protects the heart. This layer also helps to reduce friction between the heart and the surrounding structures as the heart beats.

Together, these four layers work to maintain the structural integrity of the heart and to ensure proper blood flow. They also play a role in protecting the heart from injury and disease.

To know more about heart click here:

https://brainly.com/question/16566688#

#SPJ11

The fission theory of the moon's origin has been criticized because...

Answers

The fission theory of the moon's origin has been criticized because the moon's composition is different from earth's.

What is the fission theory

The theory that explains how the moon was formed is called the fission theory. It says that the moon was created when the Earth was spinning really fast and a part of it broke off and became the moon.

The conservation of angular momentum is a problem with the fission theory, which many people have criticized. To make the moon by fission, the Earth would need to spin very fast. The Earth spinning really quickly isn't explained by how we think planets form and move.

Learn more about   fission theory  from

https://brainly.com/question/9961905

#SPJ4

An investigator has a strand of chromosomal DNA whose sequence is shown. She wants to use polymerase chain reaction (PCR) to amplify and isolate the DNA fragment defined by the highlighted segment. Her first step is to design two PCR primers, each 20 nucleotides long, that can be used to amplify this DNA segment. The final PCR product generated from the primers should include no sequences outside of the highlighted segment. 5' --- AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG TTAGATTGATTGTTAGGTTCTTAGGTTTAGGTTCTGGTATT GGTTTAGGGTCTTTGATGCTATTAATTCTTTGGTTTTGATTT GGTCTTTATATGGTTTATGTTTTAAGCCGGGTTTTGTCTGG- GATGGTTCGTCTGATGTGCGCGTAGCGTGCGGCG ---3' What are the sequences of the investigator's forward and reverse primer? Enter them 5' to 3'. forward primer: reverse primer:

Answers

The forward primer would be: 5'-ATGCTGGTAACTTGGGGTAT-3' . The reverse primer would be: 5'-CCAGACAAAACCGGCTTAAA-3'

The method that uses a chain of reactions is called a polymerase chain reaction. In vitro procedures that polymerise or create more precise copies of the DNA from a tiny sample are carried out.

The DNA replication process, which includes DNA primers and a specific DNA polymerase enzyme called Taq polymerase, provides the basis for the PCR technique reverse primer.

Denaturation, annealing, and extension are the three steps of the PCR process. During denaturation, the DNA is broken down to release its hydrogen bonds, primers are added at both ends (called reverse and forward primers), DNA is synthesised, and the sample is cooled before extension.

Learn more about polymerase chain  here

https://brainly.com/question/14227755

#SPJ11

In an experiment about enzyme and catalyst. If you grind the radish, you will get what?

Answers

Try this class experiment to detect the presence of enzymes as they catalyse the decomposition of hydrogen peroxide

Enzymes are biological catalysts which increase the speed of a chemical reaction. They are large protein molecules and are very specific to certain reactions. Hydrogen peroxide decomposes slowly in light to produce oxygen and water. The enzyme catalase can speed up (catalyse) this reaction.

In this practical, students investigate the presence of enzymes in liver, potato and celery by detecting the oxygen gas produced when hydrogen peroxide decomposes. The experiment should take no more than 20–30 minutes.

Equipment

Apparatus

Eye protection

Conical flasks, 100 cm3, x3

Measuring cylinder, 25 cm3

Bunsen burner

Wooden splint

A bucket or bin for disposal of waste materials

Chemicals

Hydrogen peroxide solution, ‘5 volume’

Small pieces of the following (see note 4):

Liver

Potato

Celery

Health, safety and technical notes

Read our standard health and safety guidance.

Wear eye protection throughout. Students must be instructed NOT to taste or eat any of the foods used in the experiment.

Hydrogen peroxide solution, H2O2(aq) – see CLEAPSS Hazcard HC050 and CLEAPSS Recipe Book RB045. Hydrogen peroxide solution of ‘5 volume’ concentration is low hazard, but it will probably need to be prepared by dilution of a more concentrated solution which may be hazardous.

Only small samples of liver, potato and celery are required. These should be prepared for the lesson ready to be used by students. A disposal bin or bucket for used samples should be provided to avoid these being put down the sink.

Procedure

Measure 25 cm3 of hydrogen peroxide solution into each of three conical flasks.

At the same time, add a small piece of liver to the first flask, a small piece of potato to the second flask, and a small piece of celery to the third flask.

Hold a glowing splint in the neck of each flask.

Note the time taken before each glowing splint is relit by the evolved oxygen.

Dispose of all mixtures into the bucket or bin provided.

Teaching notes

Some vegetarian students may wish to opt out of handling liver samples, and this should be respected.

Before or after the experiment, the term enzyme will need to be introduced. The term may have been met previously in biological topics, but the notion that they act as catalysts and increase the rate of reactions may be new. Similarly their nature as large protein molecules whose catalytic activity can be very specific to certain chemical reactions may be unfamiliar. The name catalase for the enzyme present in all these foodstuffs can be introduced.

To show the similarity between enzymes and chemical catalysts, the teacher may wish to demonstrate (or ask the class to perform as part of the class experiment) the catalytic decomposition of hydrogen peroxide solution by manganese(IV) oxide (HARMFUL – see CLEAPSS Hazcard HC060).

If students have not performed the glowing splint test for oxygen for some time, they may need reminding of how to do so by a quick demonstration by the teacher.

Additional information

This is a resource from the Practical Chemistry project, developed by the Nuffield Foundation and the Royal Society of Chemistry. This collection of over 200 practical activities demonstrates a wide range of chemical concepts and processes. Each activity contains comprehensive information for teachers and technicians, including full technical notes and step-by-step procedures. Practical Chemistry activities accompany Practical Physics and Practical Biology.

Which of these mutations will decrease the ability of a cell to breakdown lactose? 1. Nonsense mutation in lacA (transacetylase gene). 2. Missense mutation in lac) which affects operator-binding domain (cannot bind operator) 3. Mutation in operator (such that repressor can no longer recognize and bind) 4. Mutation in lacl (so that repressor cannot bind inducer)

Answers

Mutation in lacl (so that repressor cannot bind inducer) will decrease the ability of a cell to breakdown lactose. The lac operon is responsible for lactose metabolism in E. coli, and the gene that codes for the lac repressor protein is lacl.

When lactose is present, it binds to the lac repressor protein, causing a conformational change that prevents the repressor from binding to the operator region of the operon. This allows RNA polymerase to transcribe the genes necessary for lactose metabolism. If there is a mutation in lacl that prevents the repressor from binding to the inducer, then the repressor will remain bound to the operator region, preventing RNA polymerase from transcribing the necessary genes and decreasing the ability of the cell to breakdown lactose.

The lac operon is a cluster of genes in bacteria that are involved in the breakdown of lactose, a sugar found in milk. The operon consists of three structural genes (lacZ, lacY, and lacA) and a regulatory gene (lacI). The regulatory gene encodes the lac repressor, a protein that binds to the operator region of the operon and prevents transcription of the structural genes in the absence of lactose.

If lactose is present in the environment, it can bind to the repressor, causing a conformational change that prevents it from binding to the operator region. This allows RNA polymerase to bind to the promoter and initiate transcription of the structural genes. lacZ encodes the enzyme β-galactosidase, which breaks down lactose into glucose and galactose, while lacY encodes lactose permease, which facilitates the uptake of lactose into the cell.

Based on this information, the mutation that will decrease the ability of a cell to break down lactose is a nonsense mutation in lacA (transacetylase gene). This is because lacA encodes the enzyme transacetylase, which is involved in the metabolism of lactose but is not directly involved in its breakdown. Mutations in lacZ or lacY would affect the ability of the cell to transport or break down lactose, respectively, while mutations in lacI or the operator would affect the regulation of the operon and could potentially increase or decrease the expression of the structural genes.

To know more about Mutation

brainly.com/question/17130462

#SPJ11

in order, the three nested levels bronfenbrenner describes in his ecological-systems approach are:

Answers

In his ecological systems approach, Urie Bronfenbrenner describes three nested levels. They are microsystem, mesosystem, and macrosystem.

Microsystem: The microsystem refers to the immediate and direct environments in which an individual interacts on a regular basis. It includes the people and settings that have a direct influence and impact on the individual's development. Examples of microsystem elements include family, peers, school, and community. The microsystem represents the closest and most influential level of the individual's ecological system.

Mesosystem: The mesosystem encompasses the connections and interactions between the different elements of the microsystem. It involves the relationships and linkages between various settings and individuals in the microsystem. For instance, the relationship between a child's family and their school or between parents and teachers. The mesosystem recognizes the influence and impact that these interconnections can have on an individual's development.

Macrosystem: The macrosystem represents the broader cultural, societal, and ideological contexts in which the individual and their micro- and mesosystems are embedded. It encompasses the cultural values, norms, laws, customs, and broader social systems that influence and shape the micro- and mesosystems. Factors such as societal beliefs, political ideologies, economic systems, and cultural practices are all part of the macro system.

These three levels—microsystem, mesosystem, and macrosystem—describe the different layers of environmental influences and systems that interact and shape an individual's development according to Bronfenbrenner's ecological systems approach.

Know more about laws here:

https://brainly.com/question/6590381

#SPJ11

consider the differences in solids, liquids and gasses, and their surface area. which state of matter do you think would usually have the greatest rate of reaction, and why?

Answers

Answer:

el que tendrá mayor velocidad de reacción son los líquidos

Explanation:

How do the cells get to be so different from each other?

Answers

Answer:

The cell types in a multicellular organism become different from one another because they synthesize and accumulate different sets of RNA and protein molecules. They generally do this without altering the sequence of their DNA.

Explanation:

[cm.02]in your own words, explain how a weather balloon can be used to predict future weather conditions in a location.

Answers

A weather balloon is a type of high-altitude balloon made of latex or neoprene balloons and typically filled with hydrogen or helium. It carries sensors in the air in order to transmit data on air pressure, temperature, humidity, and wind speed using a radiosonde, a tiny, disposable measuring device.

Every one to two seconds, a transmitter on the radiosonde transmits the information back to ground-based tracking devices. We can determine wind direction and speed by monitoring the radiosonde's location. Computerized NWS numerical forecast models get these data as input. The models employ mathematics together with current and historical meteorological data to give our meteorologists forecast information.

To learn more about weather balloon and radiosonde here,

https://brainly.com/question/2279714

#SPJ4

please help! Really stuck​

please help! Really stuck

Answers

Metaphase is the third phase of mitosis, the process that separates duplicated genetic material carried in the nucleus of a parent cell into two identical daughter cells. ... There is an important checkpoint in the middle of mitosis, called the metaphase checkpoint, during which the cell ensures that it is ready to divide.

suppose a firm pays total dividends of $250,000 out of net income of $2 million. what would the firm's payout ratio be?

Answers

The payout ratio measures the proportion of a company's earnings that are distributed as dividends to its shareholders.

To calculate the payout ratio, we divide the total dividends paid by the net income of the company. In this case, the firm paid total dividends of $250,000 out of a net income of $2 million, resulting in a payout ratio of 12.5% ($250,000 divided by $2 million). This means that the firm distributed 12.5% of its earnings to shareholders in the form of dividends, while retaining the remaining 87.5% for reinvestment in the business. A high payout ratio can indicate that a company is prioritizing dividend payments over investments in growth, while a low payout ratio may suggest that a company is retaining earnings to fund future growth opportunities.

The payout ratio is a financial metric that shows the proportion of earnings a company pays its shareholders in the form of dividends. In this case, the firm pays total dividends of $250,000 out of a net income of $2 million. To calculate the payout ratio, you would divide the total dividends by the net income:

Payout ratio = (Total dividends / Net income) * 100

Payout ratio = ($250,000 / $2,000,000) * 100 = 12.5%

So, the firm's payout ratio would be 12.5%. This means that 12.5% of the company's net income is paid out as dividends to shareholders.

To know about ratio visit:

https://brainly.com/question/13419413

#SPJ11

Our primary defense against invasion of pathogens into the body is by.

Answers

Our primary defense against invasion of pathogens into the body is by our immune system. It is a complex system that includes various cells, tissues, and organs working together to recognize and destroy harmful invaders such as viruses and bacteria. The immune system is essential for maintaining good health and preventing infections from spreading throughout the body.

Answer:

The immune system

Explanation:

The immune system defends humans from pathogens. Physical and chemical barriers prevent infection. White blood cells attack pathogens. Immunisations usually involve injecting inactive pathogens.

discuss one rule of naming muscles and cite example that illustrates the rule (in your own words)

Answers

Answer:

A rule Anatomists follow to name the muscles is to name them after a description of the muscle in some way. These include naming the muscle after its shape, its size compared to other muscles in the area, its location in the body

Explanation:

Some examples are flexor (decreases the angle at the joint), extensor (increases the angle at the joint), abductor (moves the bone away from the midline), or adductor (moves the bone toward the midline).

Please analyze the advantages and disadvantages of generating syngas by fixed-bed reactor.

Answers

Fixed-bed reactors offer versatility, high conversion efficiency, simplicity, and cost-effectiveness for syngas generation. However, they may face challenges related to heat transfer, catalyst deactivation, scale-up difficulties, and potential bed clogging.

Generating syngas using a fixed-bed reactor offers several advantages and disadvantages.

Advantages:

Versatility: Fixed-bed reactors can handle a wide range of feedstocks, including coal, biomass, and waste materials, making them versatile for syngas production.

High Conversion Efficiency: Fixed-bed reactors typically offer high conversion efficiencies, resulting in a higher yield of syngas per unit of feedstock.

Simple Operation: Fixed-bed reactors are relatively simple in design and operation, requiring less maintenance and supervision compared to other types of reactors.

Cost-Effective: The simplicity and robustness of fixed-bed reactors can contribute to cost-effectiveness, as they may require lower capital and operational costs compared to more complex reactor designs.

Disadvantages:

Limited Heat Transfer: Fixed-bed reactors may have limitations in terms of heat transfer, as the feedstock must pass through a fixed bed, which can result in uneven temperature distribution and potential hot spots.

Potential Catalyst Deactivation: If catalysts are used in the fixed-bed reactor, there is a risk of catalyst deactivation due to fouling, coking, or poisoning from impurities present in the feedstock.

Difficult Scale-up: Scaling up fixed-bed reactors can be challenging due to potential issues related to pressure drop, mass transfer limitations, and maintaining uniform conditions throughout the reactor.

Bed Clogging: Depending on the feedstock properties, there is a possibility of bed clogging in fixed-bed reactors, which can impede the flow of gases and reduce reactor performance.

To know more about syngas refer here

brainly.com/question/33358917

#SPJ11

how important is the force of gravity to the motion of bacteria through air, compared to the force exerted by the motion of the air itself? in other words, consider the terminal velocity of the bacteria, and compare it to your estimate of the speed with which air moves in a typical room.

Answers

Air movement completely dominates the forces acting on bacteria (i.e. gravity is negligible).

What is terminal velocity?

Terminal velocity is the maximum velocity an object can reach when falling through a liquid. Occurs when the sum of drag and buoyancy equals the downward force of gravity acting on an object. Since the net force on the object is zero, the acceleration of the object is zero. Air resistance to the movement of an object in free fall depends on many factors, including: Object size, shape, air density and temperature, and free-falling object velocity.

The bacterial terminal velocity can be calculated as:

v = mg/6 x π x η x R,

where v is the final velocity,

η is the viscosity of air

m is the effective mass

The bacterial load is too low and can be considered negligible. Therefore, its terminal velocity is meaningless compared to the air velocity in the room.

To know more about terminal velocity, visit:

https://brainly.com/question/2654450

#SPJ4

A normal body cell of a fruit fly contains eight chromosomes. Each normal gamete of this organism contains.

Answers

A normal body cell of a fruit fly contains eight chromosomes. Each normal gamete of this organism contains four chromosomes. During meiosis, gametes, which are haploid reproductive cells, form that contain half the number of chromosomes as the parent cell.

Meiosis produces four haploid daughter cells, each of which contains half of the chromosomes of the original cell, in the case of the fruit fly, four chromosomes per gamete, to prepare for fertilization by a gamete from another parent and the creation of a diploid zygote that will develop into a new organism.Meiosis involves two cell divisions: Meiosis I and Meiosis II.

Meiosis I is also known as the reductional division, during which the diploid cell divides into two haploid cells, and Meiosis II is known as the equational division, during which the two haploid cells split into four haploid cells that have the same number of chromosomes as the original cell, but with different genetic information due to genetic recombination. In summary, a normal gamete of a fruit fly contains four chromosomes.

To know more about chromosomes visit:-

https://brainly.com/question/30077641

#SPJ11

in the popular classificiation method called blank how many other homoplasys can be made

Answers

In the popular classification method called cladistics. The number of possible homoplasies that can be made in cladistics depends on the number and complexity of the traits being considered, as well as the evolutionary relationships among the organisms being classified.

Homoplasy is the term used in cladistics to describe a similarity in traits that is not attributable to a shared ancestor but rather to convergent evolution, parallel evolution, or evolutionary reversal.

In general, homoplasy is more likely to happen the more qualities that are taken into account. Cladistics, on the other hand, aims to reduce homoplasy by emphasising shared derived features (synapomorphies) that are particular to some groupings and point to a common ancestor.

Cladistics seeks to develop a classification scheme that accurately depicts the links between organisms during evolution by utilising synapomorphies.

For such more question on organisms:

https://brainly.com/question/17259533

#SPJ11

The following question may be like this:

In the popular classification method called _____. How many other homoplasy's can be made.

Explain what is meant by a female being a carrier.

Answers

In genetics, a female carrier refers to a woman who possesses one copy of a genetic mutation that can cause a genetic disorder, but she does not show any symptoms of the disorder.

If the carrier's partner also carries a mutated gene for the same disorder, there is a chance that their offspring may inherit two copies of the mutated gene, one from each parent, and therefore develop the disorder.

Being a carrier can be important information for individuals and their families when considering family planning. Carrier testing can be performed to determine if someone is a carrier for a specific genetic disorder. If both parents are carriers, they may choose to undergo genetic counseling and prenatal testing to assess the risk of having an affected child.

To learn more about genetic follow the link:

https://brainly.com/question/12985618

#SPJ4

Which of the following 'unit name' describes the fully assembled ribosome in bacterial cells? a. 70 {~S} b. 50 {~S} c. 80 {~S} d. 30 {~S}

Answers

The fully assembled ribosome in bacterial cells is described as 70S.

Ribosomes are cellular structures responsible for protein synthesis. They exist in both bacterial and eukaryotic cells, but their sizes differ. Ribosomes are characterized by their sedimentation coefficient, denoted by the letter 'S.'

In bacterial cells, the fully assembled ribosome consists of a large subunit and a small subunit, combining to form a 70S ribosome. The large subunit is approximately 50S, while the small subunit is around 30S. When these two subunits come together, they form the 70S ribosome.

The other options listed, 50S, 80S, and 30S, refer to either the individual subunits or ribosomes found in different organisms. The 80S ribosome, for example, is characteristic of eukaryotic cells rather than bacterial cells.

Therefore, the correct option is option (a)

Learn more about ribosome here:

https://brainly.com/question/19899938

#SPJ11

How do pregnancy and HRT influence breast cancer risk?

Answers

There are two main types of HRT:

combination HRT contains the hormones estrogen and progesterone

estrogen-only HRT contains only estrogen

Each type of HRT seems to have a different effect on breast cancer risk.

Combination HRT increases breast cancer risk by about 75%, even when used for only a short time. Combination HRT also increases the likelihood that cancer may be found at a more advanced stage, as well as increasing the risk that a woman diagnosed with breast cancer will die from the disease.

Women who are older than 30 when they give birth to their first child have a higher risk of breast cancer than women who have never given birth (15). Recent childbirth. Women who have recently given birth have a short-term increase in breast cancer risk that declines after about 10 years. During pregnancy and lactation, the levels of estrogen and prolactin are increased, and some studies demonstrate that high levels of estrogen and prolactin are associated with the development of breast cancer.

Why do all organisms need food?

Answers

Answer: all living things need food to stay alive to get there to energy and nutrition

Explanation:

All living things need food to stay alive, grow, and get energy. Nutrition is the process by which living things get or make food. All animals get food by eating other living things. ... Decomposers, such as fungi and earthworms, feed on rotting plant and animals.

which of these statements about enzyme inhibitors is true?

Answers

The action of inhibitors may be both either reversible or irreversible  is trues about enzyme inhibitors.

What is enzyme inhibitors?

A chemical that binds to an enzyme and inhibits its activity is termed  as an enzyme inhibitor. Proteins are referred as enzymes speed up the chemical processes that turn substrate molecules into products and are essential for life. An enzyme inhibitor is what? Inhibitors of enzyme activity are chemicals that bind to the enzyme without altering the protein structure of the enzyme.

Enzyme inhibition reactions come in three different varieties.

The inhibition of competition.Inhibitive non-competition.Inhibitive Non-Competition.

To know more about  enzyme inhibitors visit

https://brainly.com/question/17320375

#SPJ4

besides temperature change in the atmosphere, what are three evidences that the climate is currently changing? [3 points]

Answers

Besides temperature change in the atmosphere, here are three additional evidences that the climate is currently changing:

1. Changing precipitation patterns: Climate change is causing shifts in rainfall and snowfall patterns. Some regions are experiencing increased rainfall and more intense storms, leading to flooding and increased risk of landslides.

Other areas are facing more frequent and severe droughts, resulting in water scarcity and negative impacts on agriculture.

2. Rising sea levels: As a result of global warming, melting glaciers and ice sheets, along with the thermal expansion of seawater, are causing sea levels to rise.

This phenomenon poses significant threats to coastal communities, leading to increased coastal erosion, saltwater intrusion into freshwater sources, and heightened vulnerability to storm surges and flooding.

3. Melting ice and shrinking glaciers: The warming climate is causing significant ice loss in polar regions and mountainous areas. Arctic sea ice extent has been decreasing over the years, impacting ecosystems and the habitats of various species.

Similarly, glaciers worldwide are retreating at an accelerating rate, affecting water supply in regions dependent on glacial meltwater.

These are just three examples of the numerous observable changes occurring as a result of climate change.

Other evidence includes shifts in ecosystems and biodiversity patterns, changes in ocean acidity, and alterations in the timing of natural events such as flowering and migration patterns.

To know more about climate refer here

https://brainly.com/question/31966219#

#SPJ11

Which of the following statements about evaporation are true?
Select all that apply.
Evaporation only occurs over oceans.
Water only evaporates when it boils.
The heat from the sun can power evaporation.
Evaporation from plant leaves is called transpiration.

Answers

The true statements about evaporation are The heat from the sun can power evaporation , Evaporation from plant leaves is called transpiration.

Evaporation is the process in which a liquid changes into a gas or vapor. It occurs when the molecules of a liquid gain enough energy to break free and become a gas. Evaporation can happen from any surface, not just oceans. The heat from the sun is a common source of energy for evaporation.

                                    Water does not need to boil to evaporate, as it can happen at any temperature. Transpiration is the process in which plants lose water through their leaves, and it is a type of evaporation.
                                  Evaporation from plant leaves is called transpiration - Transpiration is the process by which water is lost from plant leaves as water vapor, contributing to the overall evaporation process in the environment.

Statements 1 and 2 are false. Evaporation occurs over various water bodies, not just oceans, and it can happen at temperatures below the boiling point of water.

Learn more about Evaporation

brainly.com/question/28319650

#SPJ11

Part C
Once again, Kathy ran her fingers through her hair and then touched surfaces that people
touch often, such as door knobs, refrigerator door handles, phones, and the computer
keyboard. She ran a third cotton swab over her hand, under her fingernails, and between her
fingers. Then she rubbed it in a zigzag pattern over the third petri dish. She covered the dish
and disposed of the swab. She labeled this petri dish "unwashed #2."
Kathy applied hand sanitizer to her hands, following the directions on the bottle. She rubbed
her hands together until the sanitizer evaporated. She rubbed a new cotton swab on her
hand, making sure to get under her nails and between her fingers, and then rubbed it in a
zigzag pattern over the fourth petri dish. She covered the dish and disposed of the swab. She
labeled the petri dish "sanitizer." She stored these petri dishes at room temperature.
The photographs show these petri dishes after 24 and 48 hours. Write down your
observations.
unwast
24 hours
Sanitizer

Answers

A possible observation that fits Kathy's experiment is the petri dish marked as "unwashed" shows significantly more bacterial growth in comparison to the "sanitizer" petri dish.

What is an observation?

In experiments, observations involve recording specific details about the phenomenon being studied. In this case, the focus is bacterial growth, and therefore possible observations should focus on whether the bacteria is growign as well as the characteristics in the colonies (color, shape, density, among others).

Learn more about observations in https://brainly.com/question/14897780

#SPJ1

What kind of energy is released when burning fuels?

Answers

These fuels undergo exothermic processes during combustion that release heat and light energy into the environment.

Burning fuels causes exothermic processes, sometimes referred to as combustion reactions, that release heat and light energy into the environment. Numerous different substances, most frequently alkanes and alcohols, can be utilized as fuels.

When coils, oils, wood, and gas are burned in the presence of air, the stored energy in those materials is released into the environment as heat and a few other byproducts.

In the course of burning, molecular changes occur in the wood. Burning fuels such as wood, coal, oil, or gas cause the energy contained inside to change forms and be released into the environment. From potential energy to material energy to heat energy, the energy transforms.

To learn more about burning fuels

https://brainly.com/question/14917863

#SPJ4

Explore which of these is an explanation slash prediction of what you think will happen during an investigation? A variable B hypothesis C fair test D control

Answers

Answer:

B. Hypothesis

Explanation:

Hypothesis is an explanation about a phenomenon that is proposed. This explanation is further subject to a test to make a scientific hypothesis.

scientific hypotheses is usually based on previous observations that is not satisfactorily explained with available scientific theories but need further clarifications.

After an hypothesis is formulates it is then subjected to test to ascertain if the hypothesis will be accepted or rejected. When rejected further investigation can be carried out to be sure of the outcome.

Other Questions
What is the average time for the toy car to move 1.0 m on tile? 20.2 s 24.4 s 28.1 s 60.7 s Discuss in detail the value of effective time management during an examination session The age of an ancient tree trunk is estimated using radiocarbon dating. If the trunk has a C-14 decay rate that is 34% of what it is in living plants, how old is the trunk, years what is the quantity demanded at $150 per game console? quantity demanded: game consoles b. what is the quantity supplied at $150 per game console? quantity supplied: game consoles c. what is the consumer surplus generated at a price of $150 per game console? The major characteristic of the data that affects the selection of appropriate statistics is?the level of measurementthe size of the population.the representativeness of the samplethe number of cases 3|y|+ (y-x*x) if y =-1 and x =-5 Plz help ASAP you will get 10 points if you answer correctly A customer wants rhombus-shaped tiles for his countertops. the height is 3 inches and the area of each tile is 21.6 in.2. what is the length of each side of the tiles? enter your answer in the box. The Milky Way is our home galaxy. Which of the following are the main components of a galaxy?A.gravity, sedimentary rocks, and waterB.ice, meteoroids, and mineralsC.orbits, cores, and eclipsesD.gas, dust, and stars Find the function f(x) = ax + bx + cx+d for which f(-3)= -91, f(-1)= 1, f(1) = 5, and f(2)=4. *** f(x) = =(Simplify your answer.) suppose that garbage collectors and landscaping workers have no unions. now suppose that garbage collectors form unions. what does this do to the labor supply and wages of landscaping workers? question 2 options: both labor supply and wages increase. labor supply increases, and wages decrease. labor supply decreases, and wages increase. both labor supply and wages decrease. a woman who has given birth two or more times is known as _____. six sigma describes the measurement of quality as 3.4 defects per million.T/F A gas has a pressure of 700. mmhg when the temperature is 107 c. at what temperature (in c) will the pressure be 600. mmhg, if there is no change in volume or amount of gas? David and Carlo ran laps to train for the long-distance running team. The ratio of the number of laps David ran to the number of laps Carlo ran was to . If David ran miles, what percentage of the total number of miles did Carlo run? If you follow the arc of the handle of the big dipper away from the dipper, the first moderately bright star you come to is:_______-- According to the realist thinkers, international organizations like the un and nato function best under what conditions/circumstances? Explain the significance of each of the following.James Oglethorpe write a recurrence relation and initial conditions for , the subsets of a set with elements. Which of these represents the release of chemical energy? A Filling up the gas tank in your car B Placing a pile of wood next to a fireplace C Using the microwave to heat up your food D Burning wood in your fireplace