The ecosystem has numerous functions that allow it to function year after year. These functions include energy flow, nutrient cycling, carbon cycle, water cycle, biodiversity, and habitat creation.
An ecosystem refers to a community of living and nonliving things that coexist and interact with one another in a particular area. It includes organisms such as plants, animals, and microorganisms as well as non-living components like air, water, and soil. Ecosystems have numerous functions that enable them to function year after year. Some of these functions include the following:
1. Energy Flow: The energy flow in an ecosystem is the process through which energy moves through different trophic levels of organisms in the food chain. It allows for the transfer of energy from one organism to another, thus enabling life to exist in the ecosystem. 2. Nutrient Cycling: Nutrient cycling is the process of recycling nutrients in the ecosystem. Through this process, nutrients are absorbed from dead organic matter, and then reused by living organisms.
3. Carbon Cycle: The carbon cycle is the process of moving carbon from the atmosphere into living organisms and back to the atmosphere. It enables the regulation of atmospheric carbon dioxide levels. 4. Water Cycle: The water cycle is the process through which water is recycled in the ecosystem. Water evaporates from the surface of water bodies and plants, condenses into clouds, and falls back to the ground in the form of precipitation.
5. Biodiversity: Biodiversity is the variety of species that exist in an ecosystem. It ensures that the ecosystem is resilient to changes and helps to maintain ecological stability. 6. Habitat Creation: Ecosystems provide habitats for various organisms. The organisms depend on the ecosystem for survival, and the ecosystem depends on the organisms for its functioning.
For more such questions on ecosystem
https://brainly.com/question/31459119
#SPJ8
When a human services professional engages in therapeutic and personal roles with a client, it is considered a(n) _____ relationship.
dual
symbiotic
healing
ethical
Answer:
I feel that its D
Explanation:
But it could also be H
What is the main difference between a child and a teenager?
Answer:
puberty
Explanation:
Answer:
A child is a kid that is in a learning age. a child might say anything that does not make any sense. However, a teenager must be learned on how to behave. A teen must talk sense able things and not like a kid.
Explanation:
Hoped this helped.
URGENT
A steroid hormone approaches its target cell. Which will happen first?
The hormone will enter the nucleus
The hormone will combine with proteins to form lipoproteins
The hormone and its receptor will interact with the DNA
The hormone and its receptor will enter the cell’s nucleus
A steroid hormone approaches its target cell, therefore the hormone will enter the nucleus and is what will happen first which is therefore denoted as option A.
What is a Hormone?This is referred to as a chemical messenger which is released directly into the bloodstream and is responsible for the control of certain metabolic reactions occurring in the cell and an example is steroid hormone such as androgens.
In a situation whereby a steroid hormone approaches its target cell, it first passes through the plasma membrane before it then becomes adhered to the receptors which are present in the nucleus or cytoplasm.
Read more about Hormone here https://brainly.com/question/11979378
#SPJ1
1. made of DNA holds genetic information
3. This type of ER transports and modifies lipids
4. type of respiration that does not use oxygen
6. Found only in plant cells, this surrounds the cell
8. the jelly like area in cell that hold organelles
13. type of transport that does not require energy
14. nerves that regulate responds to stimuli
Answer: im not sure
Explanation:
Task 1
In this task you will analyse an RFLP in order to determine which family members carry an inherited genetic trait. This variant is thought to cause cheek dimples! The DNA sequence analysed is as follows
Normal
5΄-ATGTGCTGGATGACAGATGTCGACCACCCATGTAGTTGTGTAGACCCCCCAGT-3΄
Variant
5΄-ATGTGCTGGATGACAGATATCGACCACCCATGTAGTTGTGATACCCCCCCAGT-3΄
The restriction enzyme that was used in the analysis is called EcoRV and it recognises and cuts the following sequence 5΄GATATC 3΄.
The following family members were tested:
1. Maternal grandmother
2. Paternal grandmother
3. Paternal grandfather
4. Mother
5. Father
6. Child A
7. Child B
8. Child C
Below is the agarose gel electrophoresis results following the RFLP analysis.
1 2 3 4 5 6 7 8
(Note: the banding patterns for family members 1,2 and 4 are the same, and banding pattern for family members 3, 5, 6 and 7 are the same.)
Questions
a. Looking at the two versions of DNA, the normal and the variant, explain which one you expect to be restricted by the enzyme. (2 marks)
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
b. Give the affected family members and explain you answer. (5 marks)
__________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
c. Hypothesise why the banding pattern for child C shows three bands. (2 marks)
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
d. Which feature of DNA allows for its movement through an agarose gel when an electric current is applied? (1 mark)
___________________________________________________________________________
e. What is the reason for this feature in DNA? (1 mark)
___________________________________________________________________________
f. If the following sequence was restricted by the above enzyme, how many bands would appear on the gel? Explain your answer. (3 marks)
5΄ TGTCACTGATCGTCAGATGATATCACTGGTCCCAATCTGATC 3΄
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
g. In the diagram showing the DNA sequence above, what is the strand that is not shown called and what is the direction of this strand? (2 marks)
___________________________________________________________________________
h. Is it important to always show this missing strand in diagrams? Explain your answer. (2 marks)
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
i. Give a reason for why RFLP analysis is not as commonly used anymore for such analysis and give one technique that has replaced it. (2 marks)
__________________________________________________
What will most likely happen if all the chloroplasts are removed from a plant cell?
Elizabeth is a carrier of PKU and is married to Alan, who is homozygous recessive for the PKU disease. They just gave birth to their first child, a girl named Sarah.
Draw a Punnett square for Elizabeth and Alan.
To draw a Punnett square for Elizabeth and Alan, we need to consider their genotypes for the PKU disease.
Elizabeth is a carrier of PKU, which means she has one normal allele (denoted as N) and one PKU allele (denoted as p). Therefore, her genotype is Np.Alan is homozygous recessive for PKU, meaning he has two PKU alleles (pp) and does not have a normal allele.
The Punnett square will show the possible combinations of alleles that their child, Sarah, could inherit.
| N | p |
-----------------------------
p | Np | pp |
-----------------------------
p | Np | pp |
-----------------------------
In the Punnett square, the top row represents the alleles from Elizabeth (Np), and the left column represents the alleles from Alan (pp).
From the Punnett square, we can see that there are two possible genotypes for Sarah: Np and pp.
If Sarah inherits the genotype Np, she will be a carrier like her mother Elizabeth. She will have one normal allele and one PKU allele, but she will not have the disease.If Sarah inherits the genotype pp, she will have PKU since she has received two PKU alleles from both parents.
It's important to note that Punnett squares provide a theoretical representation of genetic outcomes and do not guarantee the actual genetic inheritance of a child.
for more such questions on disease
https://brainly.com/question/13611770
#SPJ11
Type the correct answer in the box. Spell all words correctly.
What is a close relationship between two organisms that live together called?
The close relationship between two organisms that live together is called
Reset
Next
Answer:
symbiosis.
Explanation:
The term that you are referring to is symbiosis. (a symbiotic relationship)
Symbiosis is a proximate and often long-term interaction between two or more different biological species.
Describe the ocean bottom in three words.
Answers:
Deep, mysterious, vast.
Muddy, varied, abyssal.
Harsh, diverse, mysterious.
Dark, rugged, unexplored.
1. How has your understanding about race changed since you began learning about it? (2
points)
Children learn to comprehend, respect, and value differences between people when we teach them from an early age that discussing race is acceptable.
Why do we study race?Children learn to comprehend, respect, and value differences between people when we teach them from an early age that discussing race is acceptable. As a result, kids become better equipped to recognize when something in their surroundings seems unfair or unjust and can take action to change it.The definition of race changes based on the society.White, Black or African American, American Indian or Alaska Native, Asian, and Native Hawaiian or Other Pacific Islander are the five minimal classifications required by OMB.Children learn to comprehend, respect, and value differences between people when we teach them from an early age that discussing race is acceptable.To learn more about race refer to:
https://brainly.com/question/27129680
#SPJ1
Use the model here to describe the transfer of matter and flow of energy from one trophies level to another within an ecosystem. All of the following must be addressed in your response to receive full credit.
A. Discuss the transfer of biomass when one organism eats another. Use your knowledge of digestion to discuss how food is broken down and used by the consumer.
B. Explain what happens to the energy that is not transferred from one organism to another.
C. Explain why there are typically fewer organisms at the top of an energy pyramid.
D. Use specific numbers and calculations to support your explanation.
A. Within ecosystems, biomass is transmitted when one organism eats another. During digestion, food is broken down by mechanical and chemical mechanisms. Enzymes break down complex compounds into simpler forms so that consumer cells can absorb them. Nutrients are obtained for energy production, growth and tissue repair. The organic matter of the eaten organism is assimilated by the consumer, increasing its biomass.
B. The energy transferred during metabolic processes is released in the form of heat. This loss results from inefficient energy transport and use. Energy transfer efficiency is the proportion of energy from a trophic level that is transformed into biomass at each consumer level. Through respiration and other metabolic processes, the rest of the energy is lost as heat. Because less energy is transferred to the next trophic level as it moves up the food chain, less energy is available.
C. There are fewer organisms at the top of an energy pyramid due to loss of energy and a drop in the circulation of nutrient levels. Only part of the energy is transferred as it moves up the food chain, which limits the amount of energy accessible to higher trophic levels. At the top of the pyramid, there are fewer individuals and less biomass because higher level species require more energy for their metabolism. This pattern, where the number of people declines with increasing trophic levels, is known as the ecological pyramid of numbers.
D. The explanation of energy transfer and loss in ecosystems is supported by precise data and computations. Assuming 10% efficiency in energy transfer, only 10% of the energy from one trophic level is transferred to the next. For example, the primary consumer would only receive 100 units (or 10% of 1,000) if the primary producer captured 1,000 units of energy. The second consumer would get 10 units (or 10% of 100), and so on. These calculations show that energy uptake gradually decreases as trophic levels increase, providing quantitative evidence for the idea that ecosystems lose energy.
Learn more about ecological pyramid, here:
https://brainly.com/question/19460098
#SPJ1
Cell Work Unit Test
describe the relationship between a glose molecule and the products it makes during cellular respiration.
ATP is made via the metabolic process of cellular respiration, which breaks down glucose. The phases of cellular respiration are glycolysis, pyruvate oxidation, the citric acid cycle, or Krebs cycle, and oxidative phosphorylation.
Each glucose molecule undergoes a slow breakdown into carbon dioxide and water during cellular respiration. In the course of the processes that change glucose, some ATP is created directly. However, a process known as oxidative phosphorylation produces a lot more ATP later. The electron transport chain, which consists of a number of proteins lodged in the inner membrane of the mitochondrion, is what drives the process of oxidative phosphorylation.
Learn more about cellular respiration
https://brainly.com/question/16192136
#SPJ9
Another term(not an animal) that can be used to describe a 2nd level consumer is ...
100 POINTS)Which change is an environmental effect of building dams?
A) increased fertility downstream
B) weed growth upstream
C) sediment builds up downstream
D) increased water temperature upstream
Answer:
weed growth upstream
Explanation:
When dams are build up on a river the water at upstream rises .
Buliding dams also have some other side effects like dieing of fishes ,quick floods etc .
Option B
-2 In a pasture ecosystem a large portion of the biomass is represented
pasture vegetation compared to animals that feed on these grasses.
illustrated by such a pasture ecosystem is called alan...
A food chain.
B food web.
с ecological pyramid.
D energy flow.
a
Explanation:
im not really sure about the answer i chosed but maybe yes
Quagga mussels, an invasive species of mollusk originally from
Russia, have been introduced to the lake after being carried in on
the hulls of boats. An assessment of the size of the quagga
mussel problem is needed, along with suggestions to curb their
population growth.
what field of science is this?
This is a problem in the field of ecology.
The problem of quagga mussels in the lake is an ecological issue that requires scientific assessment and management.
It falls under the discipline of ecology, which studies the relationships between organisms and their environment.
Ecologists investigate the impacts of invasive species on the ecosystem and devise strategies to control their spread and minimize their effects.
In this case, scientists will need to examine the size of the quagga mussel population, their distribution, and their ecological interactions with native species.
They will also need to recommend measures to prevent further introduction of quagga mussels and to manage their population growth, such as using chemical treatments or biological controls.
For more such questions on ecology, click on:
https://brainly.com/question/842527
#SPJ11
Which tissues, organs, and biological systems are involved in the process, and how the systems interact during the process? Explain the interaction of the different systems and why they have to work together.
The process of digestion involves several tissues, organs, and biological systems, which work together to break down food and absorb nutrients. These systems include the digestive system, the circulatory system, the nervous system, and the endocrine system.
The mouth, oesophagus, stomach, small intestine, large intestine, pancreas, liver, and gallbladder are among the organs that make up the digestive system. These organs work together to digest food, break it down into its component parts, and absorb nutrients.
The mouth and stomach break down food mechanically, while the small intestine and pancreas break it down chemically. The liver produces bile, which helps to break down fats, and the gallbladder stores and releases bile as needed.
The circulatory system is also involved in digestion, as it transports nutrients from the small intestine to the rest of the body. The nutrients are absorbed into the bloodstream and transported to the liver for processing.
The digestive, circulatory, nervous, and endocrine systems work together to break down food, absorb nutrients, and regulate digestion.
The nervous system helps to regulate digestion by sending signals to the digestive system to stimulate or inhibit the release of digestive enzymes and hormones. The vagus nerve, which connects the brain to the digestive system, plays an important role in this process.
The endocrine system produces hormones that regulate digestion, such as insulin and glucagon, which help to control blood sugar levels. These hormones are produced by the pancreas and released into the bloodstream.
All of these systems work together to ensure that food is broken down and nutrients are absorbed efficiently. For example, the digestive system breaks down food into small enough particles for absorption, while the circulatory system transports the nutrients to the rest of the body.
The nervous system and endocrine system regulate the digestive process to ensure that it occurs at the right pace and that nutrient absorption is optimized.
These systems must work together to ensure that the body can extract the nutrients it needs from food and maintain overall health.
Learn more about digestive system Here:
https://brainly.com/question/956634
#SPJ1
NEED HELP ASAP PLS AND THX
PIC IS ATTACHED
Carbon-12 atomic number is 6, Mass number is also 12, Atomic mass is 12.011 amu , carbon has 6 proton, 6 electron but 6 neutron.
What is Atomic Number?The charge number of an atomic nucleus is the chemical element's atomic number, often known as its nuclear charge number. This is the number of protons present in the nucleus of every atom of that element, or the proton number, for conventional nuclei.
Protium atomic number is 1, Mass number is also 1, Atomic mass is 1.00794 amu , protium has 1 proton, 1 electron but no neutron.
Carbon-12 atomic number is 6, Mass number is also 12, Atomic mass is 12.011 amu , carbon has 6 proton, 6 electron but 6 neutron.
Magnesium-24 atomic number is 12, Mass number is also 12, Atomic mass is 24.305 amu , magnesium has 12 proton, 12 electron but 12 neutron.
To Learn more about Atomic Number, visit:
https://brainly.com/question/11353462
#SPJ1
When the earth and moon are lined up,the tides are______than normal?
Answer:
Greater
Explanation:
When the Sun and Moon are lined up (at new moon or full moon), the tides produced reinforce each other and are more significant than average (Figure 4). These are called spring tides (the name is connected not to the season but to the idea that higher waves “spring up”).
Answer:
The tides are higher than normal!
Explanation:
The carbohydrate molecule ____
is a powerhouse energy source.
A) Glucose
B) sucrose
C) lipid
D) amino acid
The carbohydrate molecule ____ is a powerhouse energy source.
→ A) Glucose
Which of the following would NOT be considered growth and development?
The statement that would not be considered growth and development is as follows: group of molecules that are attracted together to form a larger sheet.
What is growth and development?Growth in living organisms refers to the increase in size and number of living cells while development refers to the progressive changes in within an organism.
Growth and development can be exemplified by the following scenarios:
A single cell getting larger before dividingAn egg becoming multiple cellsAn organism going through multiple stages of lifeTherefore, this reveals that statement that would not be considered growth and development is as follows: group of molecules that are attracted together to form a larger sheet.
Learn more about growth and development at: https://brainly.com/question/8347621
What is the differences of mitosis and meiosis
mitosis refers to the parts of the original nucleus into two nuclei. On the other hand, meiosis refers to each having half chromosomes of the original cell.
in mitosis, there is the maintenance of chromosomes takes place while meiosis leads to a reduction in the no. of chromosomes. There are no variations in mitosis and variants occur in meiosis.
hence at last we can say that the above are the major difference between mitosis and meiosis. All of the explained differences will clearly lead to identifying them in particular. mitosis and meiosis plays a vital role in formation of gametes.
read more about mitosis and meiosis at:
https://brainly.com/question/18602191
Science
In a cell, what is the function of the cell membrane?
OA. It only maintains the cell shape.
ОВ.
It removes waste and stores ingested food.
OC. It generates energy for the cell.
OD.
It controls the entry and exit of substances.
Have a good day ❤️
Answer:
D. It controls the entry and exit of substances.
Explanation:
The cell membrane provides protection for the cell, transporting nutrients in and carrying toxic substances out.
Translate the DNA, mRNA, amino acid shown in picture (DNA sample)
DNA:
mRNA:
amino acid:
TACGCCTTTACT TACTCGTCAATT TACCCGACGACCACT TACTACTAGATC TACCACCACACT TACTCATCGATC TACTGGTAAGTAACT TACTTTCAGGGTACT
DNA: DNA stands for Deoxyribonucleic Acid, which is a molecule that contains the genetic instructions for the development, functioning, and reproduction of all living organisms.
It is a long, double-stranded molecule made up of four types of nucleotides: adenine (A), thymine (T), guanine (G), and cytosine (C).
TACGCCTTTACTTACTCGTCAATTTACCCGACGACCACTTACTACTAGATCTACCACCACACTTACTCATCGATCTACTGGTAAGTAACTTACTTTCAGGGTACT
mRNA:mRNA stands for Messenger Ribonucleic Acid, which is a type of RNA molecule that carries the genetic information from DNA to the ribosomes, where it serves as a template for protein synthesis.
mRNA is synthesized through a process called transcription.
AUGCGGAAAUGAAUGAGCAGUAAAUUGGGCUGUGCUGGUGAAUGAUGGUGGUGUGAUGAGUAGUAGGUGGUAGAUGAUGACCAUUCACCCAUUGAGUCA
Amino acid:Amino acids are the building blocks of proteins. They are organic compounds made up of an amino group (-NH2), a carboxyl group (-COOH), and a side chain that is specific to each amino acid. There are 20 different amino acids that are commonly found in proteins, each with a different side chain that gives it unique properties.
Met-Arg-Lys-Asp-Arg-Gln-Stop-Leu-Gly-Leu-Cys-Trp-Val-Asn-Asp-Val-Val-Val-Asp-Ser-Val-Gly-Asp-Met-Leu-Pro-Leu-Glu-Ser
To know more about amino acid, visit :
https://brainly.com/question/14583479
#SPJ1
reasons why science teachers think practical sciences is a good thing.
rubric
identify reasons 4 marks
explanation and practical example 16 marks
Science teachers consider practical sciences to be a valuable component of science education for several reasons:
Hands-on Learning: Practical sciences provide students with the opportunity to engage in hands-on learning experiences. This approach allows students to actively explore and manipulate materials, conduct experiments, and make observations.
Example: In a biology class, students may conduct a dissection of a preserved specimen to study the anatomy and structure of organisms. By physically dissecting and examining the different organs and systems, students gain a tangible understanding of the subject matter.
Application of Theory: Practical sciences enable students to apply theoretical knowledge acquired in the classroom to real-world situations. By engaging in practical activities, students can bridge the gap between abstract concepts and their practical applications, fostering a more comprehensive understanding of scientific principles.
Example: In a chemistry class, students might perform experiments to understand chemical reactions and concepts like stoichiometry. By actually mixing and observing different substances, measuring quantities, and analyzing the results, students can see how theoretical concepts translate into practical applications.
Development of Scientific Skills: Practical sciences help students develop essential scientific skills, such as critical thinking, problem-solving, observation, data analysis, and communication. Through practical activities, students learn to formulate hypotheses, design experiments, collect and analyze data, draw conclusions, and communicate their findings effectively.
Example: In a physics class, students could design and conduct an experiment to investigate the relationship between force and motion. By planning the experiment, taking measurements, analyzing the data, and presenting their findings, students enhance their scientific skills and develop a deeper understanding of physics concepts.
Engagement and Motivation: Practical sciences often increase student engagement and motivation in science education. Hands-on activities provide a more interactive and dynamic learning environment, making science more interesting and accessible to students. It can spark curiosity, promote active participation, and cultivate a sense of wonder and excitement about the natural world.
Example: In an environmental science class, students may visit a local ecosystem to conduct field observations, collect samples, and analyze the data they gather. By immersing themselves in the real environment and actively participating in the scientific process, students are more likely to be motivated and engaged in their learning.
To know more about science education:
https://brainly.com/question/28309499
#SPJ1
Three hypotheses—ecocide, rat outbreak, and climate change—are candidates as explanations of why the society of Easter Island collapsed. Explain each hypothesis, present at least one piece of evidence for each one, and state a lesson that each hypothesis contains for the world today. For each hypothesis, write one paragraph of at least four lines
In the ecocide hypothesis, humans used the resources irresponsibly and caused deforestation.
How is the hypothesis depictedHumans used the logs from the trees to transport the big statues and people also used the trees to build a shelter. In the ecocide hypothesis, the resources were used irresponsibly.
In the rat outbreak, rats were introduced to the environment and fed on the trees. In this case, the trees had bite marks on the bottom of the tree and this wasn’t an intentional introduction.
For climate change, as the climate changed, lakes were separated from the main body of water.
Learn more about hypothesis on:
https://brainly.com/question/606806
Examination of the amino acid composition of a newly isolated protein indicates the presence of 10 lysines, 5 arginines, and 4 methionines. When the protein is treated with cyanogen bromide, four peptides are obtained. When it is treated with trypsin, 16 peptides are obtained. What do these results suggest regarding the sequence of the protein
Answer:
The protein has a lysine or arginine at it's C-terminal end.
Explanation:
Given isolated protein indicates the presence of 10 lysines, 5 arginines, and 4 methionines. So, sequence of the protein . These results indicate that the sequence of proteins contains lysine or arginine at the end of the C-terminal. Because we have 15 sites that can be separated from trypsin and so it only causes 16 peptides.if you were not able to experience the above listed changes, what might have caused such difference?
Answer:
If you don't experience the listed changes above you will get very curious about yourself and you might lose some confidence due to not being able to experience some changes others have experienced.
Fish have a two chambered heart.
Please select the best answer from the choices provided
T
ОО
F.
Answer:
it is TRUE that they DO have a two chambered heart
Answer:
true hgtgfgcgfxsggddcfdddss
fill in the blank. information is transferred from the nucleus to ribosomes via___. information is transferred from the nucleus to ribosomes via___. smooth endoplasmic reticulum rough endoplasmic reticulum dna
A messenger RNA (mRNA) molecule that travels from DNA in the nucleus to the cytoplasmic locations where proteins are synthesised in cells.
In 1956, researchers Elliot Volkin and Lazarus Astrachan published the first description of the molecule that would eventually be known as mRNA. Ribosomal RNA (rRNA) and transfer RNA are two more significant RNA forms in addition to mRNA (tRNA).
Each mRNA molecule contains the instructions for making one protein (or multiple proteins in bacteria), with each sequence of three nitrogen-containing bases in the mRNA indicating which amino acid should be included in the protein. The mRNA molecules move from the nuclear envelope into the cytoplasm, where they are translated by ribosomes using their rRNA.
Learn more about mRNA here:
https://brainly.com/question/12903143
#SPJ4