(a) A square has a perimeter of 68 cm. What is the length of each side?

Answers

Answer 1

Answer:

17cm

Step-by-step explanation:

The perimeter of a square is the 4 sides added up, so we can just divide 4 by 68 to find out what one length is.

68/4= 17

We can prove this by adding it again.

17+17+17+17=68


Related Questions

Which one of the following statements is correct when the homoskedasticity assumption is violated while the rest of the OLS assumptions are correct.?
a.The beta parameter estimates can be calculated but they are wrong.
b.The beta parameter estimates are biased
c.The beta parameter estimates are unbiased because homoskedasticity assumption is not required for unbiasedness.
d.The beta parameter estimates cannot be calculated

Answers

The correct answer is option b. When the homoskedasticity assumption is violated, The beta parameter estimates are biased while the rest of the OLS assumptions are correct.

When the homoskedasticity assumption is violated, the ordinary least squares (OLS) estimator is still consistent but no longer efficient. This means that the estimates of the regression coefficients (beta parameters) are still unbiased, but they have higher variances and covariances.

In other words, the OLS estimator is no longer the best linear unbiased estimator (BLUE) and it may be biased when the errors are heteroscedastic. Therefore, option b is correct.

Learn more about homoskedasticity assumption:

https://brainly.com/question/14745756
#SPJ4

4 + 7(1 + 3m)
simplified

Answers

Answer:

11 + 21m

Step-by-step explanation:

4 + 7(1 + 3m)

= 4 + 7 + 21m

= 11 + 21m

So, the answer is 11 + 21m

the population full-time equivalent number of students (ftes) at lake tahoe community college for 2005-2006 through 2010-2011 was given in an updated report. the data are reported here. year 2005-06 2006-07 2007-08 2008-09 2009-10 2010-11 total ftes 1,585 1,690 1,735 1,935 2,021 1,890 calculate the mean, median, standard deviation, the first quartile, the third quartile and the iqr. round to one decimal place. mean _____
median _____
Standard deviation ______
first quartile _____
third quartile ____
IQR _____

Answers

The correct answer for the required values is 1825.5, 1,812.5, 165.2, 1,690, 1,935, and 245 respectively.

To find the mean, median, standard deviation, first quartile, third quartile, and interquartile range (IQR) of the full-time equivalent number of students (FTES) at Lake Tahoe Community College for the given years, we can solve it using the following formulas for various aspects:

Mean: μ = (Σx)/n

Median: Middle value of the data set

Standard deviation: σ = sqrt[Σ(x-μ)²/n]

First quartile (Q1): Median of the lower half of the data set

Third quartile (Q3): Median of the upper half of the data set

IQR: Q3 - Q1

Year         FTES

2005-06  1,585

2006-07  1,690

2007-08  1,735

2008-09  1,935

2009-10   2,021

2010-11         1,890

1. μ = (Σx)/n = (1,585 + 1,690 + 1,735 + 1,935 + 2,021 + 1,890)/6 = 1,825.2

Therefore the mean is 1,825.2

2. To find the median, arrange the data in ascending order:

1,585, 1,690, 1,735, 1,890, 1,935, 2,021

Since there are an even number of values, the median is the average of the two middle values, which are 1,812.5 and 1,812.5. So, the median is:

Median = (1,812.5 + 1,812.5)/2 = 1,812.5

3. σ = sqrt[Σ(x-μ)²/n]

= sqrt[((1,585-1,825.2)² + (1,690-1,825.2)² + (1,735-1,825.2)² + (1,935-1,825.2)² + (2,021-1,825.2)² + (1,890-1,825.2)²)/6]

= 165.2

4. To find the first quartile (Q1), find the median of the lower half of the data set, which consists of the values 1,585, 1,690, and 1,735.

Since there are an odd number of values, the median is the middle value, which is 1,690. Therefore, Q1 = 1,690.

5. To find the third quartile (Q3), we need to find the median of the upper half of the data set, which consists of the values 1,890, 1,935, and 2,021.

Since there are an odd number of values, the median is the middle value, which is 1,935. Therefore, Q3 = 1,935

6. IQR = Q3 - Q1

Substituting the calculated values in the equation

IQR = 1935 - 1690

= 245

Read more about Distribution from:

https://brainly.com/question/28941367

#SPJ4

A graph may represent the solution to multiple compound Which compound inequalities have the solution set
inequalities.
represented by the given graph? Check all that apply.

A graph may represent the solution to multiple compound Which compound inequalities have the solution

Answers

The graphed compound inequality is the one in the third option:

3x - 3 < 3 and 2x + 8 ≥  22

Which is the compound inequality graphed?

We can see an inequality that:

Has an open circle at x = 2 and a line that goes to the left.

Has a closed circle at x = 8 and a line that goes to the right.

So the compound inequality is:

x < 2 or x ≥ 8

We can rewrite these two, the first one can be rewritten as:

x < 2

3x < 3*2

3x < 6

3x - 3 < 6 - 3

3x - 3 < 3

And the second one:

x ≥ 8

2x  ≥ 2*8

2x ≥  16

2x + 8 ≥  16 + 8

2x + 8 ≥  22

Then the compound inequality is:

3x - 3 < 3 and 2x + 8 ≥  22

So the correct option is the third one.

Learn more about inequalities at:

https://brainly.com/question/24372553

#SPJ1

2y+5x=4 please help quickly

Answers

Answer:

5x+2y=4

Step-by-step explanation:

PLEASE HELP AGAIN. IM TIMES

Answers

Answer:

u didnt put any questions

Step-by-step explanation:

Imagine you have asked 1000 people how much they enjoy eating on a scale of 1-7. You have very skewed data, such that there are only outliers in the "negative" or left-hand side of the distribution. You decide to convert everyone's scores to z-scores. 1. After you convert the scores into z-scores, what would the shape of the distribution be? Explain your answer. Imagine you have ask the same 1000 people how much they enjoy running on a scale of 1-7. You have perfectly normal data. You decide to convert everyone's scores to z-scores. 2. Which z-score would be more probable, a z = -2.0 or a z = +0.5. Explain your answer.

Answers

Answer:

Follows are the solution to this question:

Step-by-step explanation:

Given that:

n=1000  

Where the data is distorted and the bad outlier is just axed,when we transform scores of its distribution form into z-score, that become negative or skewed to the left.  If n=1000 doesn't have normal skewed knowledge, then:  

The data range is between 1 to 7

\(\to 1 \ to \ 7 = 6 \sigma \\\\\to \sigma =\frac{7-1}{6} \\\\\to \sigma = \frac{6}{6}\\\\\to \sigma = 1\\\\\mu = 4\\\)

In point (1):

The score that matches:  

\(\to Z=-2 \ \ \ \mu -26 \\\\ \to 4-2 =2\\\\ \to Z_{score} =2\)

In point (2):

Its value of Z= 0.5 is \(\mu \ \ to \ \ 5 \ \ \sigma\)

\(= 4+ 0.5 \times 1\\\\= 4+ 0.5\\\\=4.5\\\)

A jury pool consists of 27 people, 12 men and 15 women. Compute the probability that a randomly selected jury of 12 people is all male.

I really need this in the form of a decimal if you can!

Answers

Answer:The probability of selecting 12 males is 7/ 1337220

Step-by-step explanation:

I searched it up and saw an answer not my work tho so here there https://brainly.com/question/17075596 for more information

Answer:  Approximately 0.00000005752462

There are seven "0"s between the decimal point and the "5".

Round that value however you need to.

If you need the exact answer as a fraction, then it would be \(\frac{1}{17,383,860}\) and you may need to delete the commas if necessary.

=========================================================

Explanation:

We use the nCr combination formula to determine how many ways there are to form a jury if we had n = 27 people and r = 12 slots.

\(n C r = \frac{n!}{r!(n-r)!}\\\\27 C 12 = \frac{27!}{12!*(27-12)!}\\\\27 C 12 = \frac{27!}{12!*15!}\\\\27 C 12 = \frac{27*26*25*24*23*22*21*20*19*18*17*16*15!}{12!*15!}\\\\ 27 C 12 = \frac{27*26*25*24*23*22*21*20*19*18*17*16}{12!}\\\\ 27 C 12 = \frac{27*26*25*24*23*22*21*20*19*18*17*16}{12*11*10*9*8*7*6*5*4*3*2*1}\\\\27 C 12 = \frac{8,326,896,754,176,000}{479,001,600}\\\\ 27 C 12 = 17,383,860\\\\\)

There are a little over 17 million ways to form the jury. This is where order doesn't matter because no juror outranks any other (and there aren't any special positions).

Since there are 12 men and 12 spots on the jury, there's only one way to have a jury of all men.

The probability of getting a jury of all men is roughly

\(\frac{1}{17,383,860} \approx 0.00000005752462\)

which is an incredibly small probability. There are seven "0"s between the decimal point and the "5"

The company also has plans to open a third obstacle course, The Gridiron, where the first three checkpoints will have coordinates A′′(0,−5), B′′(9,−5), and C′′(4,−5). What relationship could this location have to the previous locations? Select all answers that apply.

Answers

Answer: It is a reflection of Reflections of You (second location) in the x-axis.

Step-by-step explanation: Based on the given information, the relationship between the new location (The Gridiron) and the previous locations can be determined.

The correct answer is:

   It is a reflection of Reflections of You (second location) in the x-axis.

The coordinates of the first three checkpoints of The Gridiron (A''(0,−5), B''(9,−5), and C''(4,−5)) indicate that they have the same y-coordinate (-5) as the corresponding checkpoints in the second location, Reflections of You. However, there is no indication of a reflection in the y-axis or any transformation related to the first location, Transformation Fitness Studios. Therefore, the correct answer is that The Gridiron is a reflection of Reflections of You in the x-axis.

a)Write 2350 million in standard form.

b) Write 25 x 10% in standard form.

c) Which of these numbers is a square number?

4 x 10^5
9 x 10^4
4 x 10^3
9 x 10^3

Answers

Answer:

a)

\(2.35 \times {10}^{ - 3} \)

b)

\(2.5 \times {10}^{1} \)

c)

\(4 \times {10}^{3} \)

Step-by-step explanation:

above I think

Aidan measure the perimeter of his classroom.He notices the classroom is 1m wider than it is long.Theperimeter of the classroom is between 20 and 35m.The length of each side is a whole number .
what could the dimensions of the room be?find four different possibilities

Answers

Answer:

Step-by-step explanation:

The area of Mrs Brown’s classroom is

63 m2

. The area of Mr Black’s

classroom is 64 m2

. Mr Black’s

classroom is bigger.

math project : I need an interesting project idea for mathematics that can relate 3 different topics, I should write a full research paper related on the topic this are some examples related to the project

You must state a question that you would like to answer. This must be a specific question within your topic and should be explored thoroughly to create a complete paper.

Examples:

(i) How can we use Mathematical/Calculus-based tools to study the spread of COVID-19?

(ii) Designing a new Mathematical/Calculus-based model to analyze the spread of COVID-19

(iii) How many entrances should there be at Expo to accommodate all visitors?

(iv) How much water does the UAE need in order to sustain its ever changing population? (i.e. comparing water usage vs. water production)

Literature review:

You must show using multiple references and sources of the current literature on your given topic. This does NOT imply that information is simply copied from the internet but rather you must present a comprehensive review and summary of the latest research on your topic. It is suggested that you chose a specific aspect of your topic in order to include all required elements.

Examples:

(i) Review of the existing Mathematical/Calculus-based models used to analyze the spread of COVID-19

(ii) Review of existing Mathematical/Calculus-based models and calculations regarding risk insurance.

Answers

Answer:

Here's an interesting project idea for mathematics that can relate three different topics:

Topic 1: Fractals

Topic 2: Chaos Theory

Topic 3: Differential Equations

Research Question: Can fractals be used to model chaotic systems described by differential equations?

In this project, you can explore the concept of fractals and their applications in modeling complex systems. You can also delve into chaos theory and differential equations to understand how they are used to describe chaotic systems. By combining these three topics, you can investigate whether fractals can provide a better understanding of chaotic systems by modeling them more accurately.

Your research paper can cover the following areas:

Introduction: Provide an overview of fractals, chaos theory, and differential equations, and explain their relevance to the research question.

Fractals: Discuss the properties of fractals and how they can be used to model complex systems. Provide examples of fractals in nature and technology.

Chaos Theory: Explain the concept of chaos and how it is described by differential equations. Discuss the importance of chaos theory in understanding complex systems.

Differential Equations: Provide an overview of differential equations and their applications in physics, engineering, and other fields. Explain how differential equations are used to model chaotic systems.

Combining the three topics: Explain how fractals can be used to model chaotic systems described by differential equations. Provide examples of fractals used in modeling chaotic systems and compare the results to traditional methods.

Conclusion: Summarize the findings of your research and discuss the implications of using fractals to model chaotic systems.

Overall, this project can be a challenging and rewarding exploration of the interplay between three different mathematical topics.

Step-by-step explanation:

you want to install molding around the circular room. How much it would cost you to install the molding that you picked if it cost $4.22 per foot?

Answers

The cost of the molding is given as follows:

$119.30.

What is the measure of the circumference of a circle?

The circumference of a circle of radius r is given by the equation presented as follows:

C = 2πr.

The parameters for this problem are given as follows:

d = 9 -> r = 4.5.

(as the radius is half the diameter)

Hence the circumference is given as follows:

C = 2 x π x 4.5

C = 28.27 ft.

The cost is of $4.22 per ft, hence the total cost is given as follows:

4.22 x 28.27 = $119.30.

More can be learned about the circumference of a circle at brainly.com/question/12823137

#SPJ1

you want to install molding around the circular room. How much it would cost you to install the molding

plz help. The local library is a T-shaped building. Calculate the total area of the floor tiles covering the floor of the library and the book storage room. thank you sooo uch if you answer plz answer im stuck on this for weeks plz help

plz help. The local library is a T-shaped building. Calculate the total area of the floor tiles covering

Answers

Answer:

Area= 40,000

Step-by-step explanation:

I really hope that is correct I used an online calculator, hopefully its right!

If 12 donkeys can load a barge in 75 minutes, how long will it take
donkeys to load.

Answers

What do you mean?if it’s how long does it take to load one donkey is 6.25 minutes

Look Below. (Will give brianliest)

Answers

Answer:

what is your question friend? :)

Please help thank uuuuu

Please help thank uuuuu

Answers

Answer:

12

Step-by-step explanation:

You simply add the coefficients together.
3 + 4 + 5 = 12

angle A= ?
HELP HELP HELP

angle A= ? HELP HELP HELP

Answers

Answer:

A = 41.41

Step-by-step explanation:

Since this is a right angle, we can use trig functions

cos A = adjacent/ hypotenuse

Cos A = 6/8

Taking the inverse cos of each side

cos ^ -1 ( cos A) = cos ^-1 ( 6/8)

A =41.40962211

Rounding to the nearest hundredth

A = 41.41

For two n by n square matricies A and B,
suppose rankA = rankB = n-1.

Can rank(AB) become less than n-1 ?
(e.g. rank (AB) = n-2)

If so, I humbly ask you for an example.
Thank you very much.

Answers

No, the rank of the product of two n by n square matrices A and B, denoted as AB, cannot be less than n-1 if both A and B have ranks of n-1.

According to the Rank-Nullity theorem, for any matrix M, the sum of its rank and nullity is equal to the number of columns in M. In this case, the number of columns in AB is n, so the sum of the rank and nullity of AB must be n.

If rank(A) = rank(B) = n-1, it means that both A and B have nullity 1. The nullity of a matrix is the dimension of its null space, which consists of all vectors that get mapped to the zero vector when multiplied by the matrix. Since both A and B have rank n-1, their null spaces consist only of the zero vector.

Now, considering AB, if the rank of AB were less than n-1, it would mean that the nullity of AB is greater than 1.

However, this would violate the Rank-Nullity theorem since the sum of the rank and nullity of AB must be n, which is the number of columns.

Therefore,  if rank(A) = rank(B) = n-1, the rank of AB cannot be less than n-1.

For more such questions on rank

https://brainly.com/question/28839672

#SPJ8

Complete the two column proof. Given m2 equals m5 are supplementary. Prove l parallel m

Answers

The complete column is;

A) GivenB) Vertically opposite angle.C) Since, ∠3 ≅ ∠2D) Since, the interior angles on the same side of the transversal are supplementary.

What are parallel lines?

Lines that are equally spaced apart from one another and never cross each other are said to be parallel.

Given that;

∠2 and ∠5 are supplementary angles.

Now, Prove lines l || m as;

1. ∠2 and ∠5 are supplementary angles.

Reason = Given

2. ∠3 ≅ ∠2

Reason = Vertically opposite angle.

3. ∠3 and ∠5 are supplementary angles.

Reason = Since, ∠3 ≅ ∠2

4. l || m

Reason = Since the interior angles on the same side of the transversal are supplementary.

Therefore, l ll m.

Learn more about parallel lines, here:

https://brainly.com/question/16701300

#SPJ1

Complete the two column proof. Given m2 equals m5 are supplementary. Prove l parallel m

What the degree of 8ax^4

Answers

The degree of the expression \(8ax^4\) is 4.

The degree of a monomial expression is defined as the highest exponent of the variable in that expression.

In this case, we have the expression \(8ax^4\), where x is the variable and its highest exponent is 4.

The coefficient 8a is just a constant multiple and does not affect the degree of the expression.

Therefore, the degree of the expression 8\(ax^4\) is 4. It is important to understand the concept of degree, as it helps us to classify polynomial expressions and determine their behavior.

Furthermore, by knowing the degree of an expression, we can also determine the number of possible roots or solutions of that expression.

for such more question on monomial expression

https://brainly.com/question/28924388

#SPJ11

Question

"What is the degree of the expression 8ax^4?"

Cómo se mide la velocidad

Answers

Answer:

d wound be the only answer I think

There are 27 boys and 35 girls in the assembly hall and there are 15 boys and 17 girls in the laboratory room. Which room has the higher proportion of girls?

Answers

Given the problem:
There are 27 hits and 35 girls in the assembly hall and there are 15 boys and 17 girls in the laboratory room. Which room has the higher proportion of girls?

To start solving this problem, we must understand what the question is asking for: which room has the higher proportion of girls, not number of girls. So ratio basically.

Let’s set up the ratios for both the assembly hall and laboratory room, in girl/boy ratio.
Assembly hall: 35/27
Laboratory: 17/15

Now let’s expand the fractions to make the denominators the same to see which has a higher numerator, and therefore, higher promotion of girls.
35/27 17/15
Multiply the other side with the other denominators:
35x15/27/15 17x27/15x27
Solve:
525/405 459/405
So is 525 or 459 greater? 525.
The answer is the assembly hall.

Find the area of the figure. Use 3.14 for it.
2 ft.
8 ft
3 ft
4 ft
3 ft
8 ft

Find the area of the figure. Use 3.14 for it.2 ft.8 ft3 ft4 ft3 ft8 ft

Answers

Answer:

I dont know if you still need it but the area of the figure is 51.5 ft2.

The area of the given figure is equivalent to 39.5 square feet.

What is Area?

Area is a collection of two - dimensional points enclosed by a single dimensional line. Mathematically, we can write -

V = ∫∫F(x, y) dx dy

Given is to find the area of the given figure as shown in the image.

We can write the area of the given figure as -

A{total} = A{Rectangle} + A{Δ1} + A{Δ2}

A{total} = (8 x 4) + (1/2 x 3 x 3) + (1/2 x 3 x 2)

A{total} = 32 + 4.5 + 3

A{total} = 39.5 square feet

Therefore, the area of the given figure is equivalent to 39.5 square feet.

To solve more questions on areas, visit the link-

https://brainly.com/question/29213222

#SPJ2

Given: HF || JK; HG ≅ JG
Prove: FHG ≅ KJG
To prove that the triangles are congruent by ASA, which statement and reason could be used as part of the proof?

Answers

To prove that the triangles are congruent by ASA, the statement and reason could be used as part of the proof is option (A) ∠FGH ≅ ∠KGJ because vertical angles are congruent.

Here we have two triangle FHG and KJG,

The sides HF and the side JK are parallel

The length of the side of the HG and the length of the side JG are equal

HG ≅ JG

According to the ASA property of congruent, if the two angle and one side of the triangle are equal to the two angle and one side of the other triangle, then the both triangles are congruent

Here we have to prove that angle FHG and angle KJG are vertical angles

Here the vertical angles are congruent

Therefore, the statement that can be the part of proof is option (a) angle FGH ≅ angle KGJ because vertical angles are congruent.

I have solved the question in general, as the given question is incomplete

The complete question is:

Given: HF || JK; HG ≅ JG

Prove: FHG ≅ KJG

To prove that the triangles are congruent by ASA, which statement and reason could be used as part of the proof?

a) FGH ≅ KGJ because vertical angles are congruent.

b) JKG ≅ HFG because vertical angles are congruent.

c) FHG ≅ JKG because right angles are congruent.

d) HFG ≅ KJG because alternate interior angles are congruent.

Learn more about vertical angle here

brainly.com/question/24460838

#SPJ4

Given: HF || JK; HG JGProve: FHG KJGTo prove that the triangles are congruent by ASA, which statement

question 10 we hypothesize that there is a relationship between mathematics anxiety and statistics performance. we administer a math anxiety scale to 12 students in a statistics class and then collect their scores from the first course quiz. use the data given here to compute r. choose which statement is the best conclusion given your computations result. math anxiety quiz student score score a 2 10 b 13 3 c 12 4 d 10 6 e 8 8 f 3 10 g 7 5 h 6 10 i 9 6
what is the value of the correlation coefficient you calculated?

Answers

To calculate the correlation coefficient between math anxiety and statistics performance, we can use the Pearson correlation coefficient formula. Therefore, the correlation coefficient between math anxiety and quiz scores is 0.474.

The formula for calculating Pearson's correlation coefficient is:

r = (NΣXY - ΣXΣY) / sqrt((NΣX^2 - (ΣX)^2) * (NΣY^2 - (ΣY)^2))

where N is the number of pairs of scores, ΣXY is the sum of the products of paired scores, ΣX is the sum of the X scores, ΣY is the sum of the Y scores, ΣX^2 is the sum of the squared X scores, and ΣY^2 is the sum of the squared Y scores.

Using the data given in the question, we can compute the correlation coefficient between math anxiety and quiz scores as follows:

N = 12

ΣX = 72

ΣY = 62

ΣXY = 464

ΣX^2 = 760

ΣY^2 = 492

Plugging these values into the formula, we get:

r = (12464 - 7262) / sqrt((12760 - 72^2) * (12492 - 62^2))

r = 0.474

Now, to interpret this result, we need to look at the magnitude and direction of the correlation coefficient. A correlation coefficient can range from -1 to 1, with a value of 0 indicating no correlation, a positive value indicating a positive correlation, and a negative value indicating a negative correlation. The magnitude of the correlation coefficient indicates the strength of the relationship, with values closer to -1 or 1 indicating a stronger relationship.

In this case, a correlation coefficient of 0.474 indicates a moderate positive correlation between math anxiety and quiz scores. This means that as math anxiety increases, quiz scores also tend to increase, but not necessarily in a linear way.

Therefore, the best conclusion given our computed result is that there is a moderate positive correlation between math anxiety and statistics performance, suggesting that students with higher levels of math anxiety may still perform well on statistics quizzes, but their performance may be slightly affected by their anxiety levels.

For more such questions on correlation coefficient

https://brainly.com/question/9316238

#SPJ4

Mar. 1) Egert invested $159,000 cash along with $22,300 in office equipment in the company.

Answers

The transactions of Egert's Company are entered in the general journal as follows:

General Journal

Date      Account Titles          Debit       Credit

Mar. 1 Cash                         $159,00

Office Equipment              $22,300

Common stock                                   $181,300

Mar. 2 Prepaid Rent           $1,200

Cash                                                      $1,200

Mar. 3 Office equipment $3,300

Office supplies                 $1,580

Accounts Payable                              $4,880

Mar. 6 Cash                     $4,300

Service Revenue                               $4,300

Mar. 9 Accounts Receivable $7,800

Service Revenue                              $7,800

Mar. 12 Accounts Payable $4,800

Cash                                                 $4,800

Mar. 19 Prepaid Insurance $5,300

Cash                                                 $5,300

Mar. 22 Cash                     $4,700

Accounts Receivable                     $4,700

Mar. 25 Accounts Receivable $4,200

Service Revenue                          $4,200

Mar. 29 Dividends          $5,400

Cash                                             $5,400

Mar. 30 Office supplies    $900

Accounts Payable                         $900

Mar. 31 Utility expenses  $800

Cash                                               $800

What is the general journal?

The general journal is the first accounting record of a business transaction.

The general journal identifies the accounts involved in each transaction, specifying which will be debited or credited in the general ledger.

Transaction Analysis:

Mar. 1 Cash $159,00 Office Equipment $22,300 Common stock $181,300

Mar. 2 Prepaid Rent $1,200 Cash $1,200

Mar. 3 Office equipment $3,300 Office supplies $1,580 Accounts Payable $4,880

Mar. 6 Cash $4,300 Service Revenue $4,300

Mar. 9 Accounts Receivable $7,800 Service Revenue $7,800

Mar. 12 Accounts Payable $4,800 Cash $4,800

Mar. 19 Prepaid Insurance $5,300 Cash $5,300

Mar. 22 Cash $4,700 Accounts Receivable $4,700

Mar. 25 Accounts Receivable $4,200 Service Revenue $4,200

Mar. 29 Dividends $5,400 Cash $5,400

Mar. 30 Office supplies $900 Accounts Payable $900

Mar. 31 Utility expenses $800 Cash $800

Learn more about journalizing transactions in the general journal at https://brainly.com/question/14639535

#SPJ1

Question Completion:

1 Egert invested $159,00 cash along with $22,300 in office equipment in the company in exchange for common stock. 2 The company prepaid $1,200 cash for six months' rent for an office. The company's policy is to record prepaid expenses in balance sheet accounts. 3 The company made credit purchases of office equipment for $3,300 and office supplies for $1,580. Payment is due within 10 days. 6 The company completed services for a client and immediately received $4,300 cash. 9 The company completed a 7,800 project for a client, who must pay within 30 days. Mar. 12 The company paid $4,800 cash to settle the account payable created on March 3. Mar. 19 The company paid $5,300 cash for the premium on a 12-month insurance policy. The company's policy is to record prepaid expenses in balance sheet accounts. Mar. 22 The company received $4,700 cash as partial payment for the work completed on March 9. Mar. 25 The company completed work for another client for $4,200 on credit. Mar. 29 The company paid $5,400 cash in dividends. Mar. 30 The company purchased $900 of additional office supplies on credit. Mar. 31 The company paid $800 cash for this month's utility bill.

Enter the transactions in the general journal.

4 pound tomato cost 14 dollar how much does 1 pound cost

Answers

Answer:$3.50

Step-by-step explanation:

14/4 =3.5. To check answer multiply 3.5 by 4. You get 14

pls help quick it is in the picture

pls help quick it is in the picture

Answers

Answer:

90 degrees it looks like

Step-by-step explanation:

what is 3X +4 equals 8X -16 add by 16 from both side

Answers

x=4 is the answer !!!!!
Other Questions
Read this passage from My Antonia.I can remember a score of these country girls who were in service in Black Hawk during the few years I lived there, and I can remember something unusual and engaging about each of them. Physically they were almost a race apart, and out-of-door work had given them a vigour which, when they got over their first shyness on coming to town, developed into a positive carriage and freedom of movement, and made them conspicuous among Black Hawk women.That was before the day of high-school athletics. Girls who had to walk more than half a mile to school were pitied. There was not a tennis-court in the town; physical exercise was thought rather inelegant for the daughters of well-to-do families. Some of the high-school girls were jolly and pretty, but they stayed indoors in winter because of the cold, and in summer because of the heat. When one danced with them, their bodies never moved inside their clothes; their muscles seemed to ask but one thingnot to be disturbed. I remember those girls merely as faces in the schoolroom, gay and rosy, or listless and dull, cut off below the shoulders, like cherubs, by the ink-smeared tops of the high desks that were surely put there to make us round-shouldered and hollow-chested.Which theme is best supported by the comparison in this passage? Translate the figure 2 units left and 4 units up.Plot all of the points of the translated figure.You may click a plotted point to delete it. Which Greek deity was honored with a towering gold-and-ivory statue inside the Parthenon?PoseidonZeusAthenaHera Should Clarence Thomas be impeached yes or no and explain why How much charge could be packed onto a green pea (diameter 0.73 cm ) before the pea spontaneously discharges 1. who was john locke?2. what were his 3 big ideas?3. what does each of his 3 big ideas mean? What are the reactants of cellular respiration and also the products of photosynthesis?A.6 water, 6 cartoon diode, and sunB.1 glucose and 6 oren zaC.38 ATP. 6 water, 6 carbon dioxide best answer will get brainliest, but can someone please help!!!!what is Mexico's migration policy and what parts of it work well?50 points!! f(x)g(x)=x=x+95We can think of gg as a translated (shifted) version of ff.Complete the description of the transformation.Use nonnegative numbers.To get the function gg, shift ff by units and to the by units. identify the predominant intermolecular forces in each of the given substances. As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA primers to amplify the bold and underlined region of the DNA by PCR. Provide the 10 nucleotide sequence of the primers that you would design and indicate the 5 and 3' ends of each primer. (1) ATTGTATCCGCATTTGATGCTACCGTGGTTGAGTCAGCGTCGAGCACGCGGCACTTATTGCATGAGTAGAGTTGA CTAAGAGCCGTTAGATGCCTCGCTGTACTAATAGTTGTCGACAGATCGTCAAGATTAGAAAACGGTAGCAGCAT TATCGGAGGTTCTCTAACTAGTATGGATAGCCGTGTCTTCACTGTGCTGCGGCTACCCATCGCCTGAAAACCAGTT GGTGTTAAGCGATCCCCTGTCCAGGACGCCACACGTAGTGAAACAT What is the Tm and annealing temperature? (1) Which inequality below compares the twointegers for this situation correctly?Sunday at noon, the temperature was 16degrees above zero. Wednesday atnoon, the temperature was 10 degreesbelow zero.Choose...16 < -10-10 > 1616 > -1016 < 10 Chapter 18 talked about public economy and one of the issues is voter participation. In the U.S. voting is not mandatory, but in several countries in the world citizens do have to vote in every election. Economists have suggested why a utility-maximizing person might rationally decide not to vote or not to become informed about the election. This theory is called Rational Ignorance. Describe what rational ignorance is, and state your opinion about voting. Do you agree with this theory? Provide at least 2 arguments for why you agree or disagree with the rational ignorance.(minimum of 100 words, maximum of 250 words what does mi libro mean? Does the amount of a substance lower the freezing point and increase the melting point? Which major civilization developed in the region indicated on this map duringthe classical era?OA. Axum (Aksum)OB. ChavnOC. BantuOD. Olmec PREVIOUSSUBMIT A manufacturer produces three types of plastic fixtures. The time required for molding trimming, and packaging is given in the table below. (Times are given in hours per dozen .)The table is presented with five columns. The first column is labeled "Process" and lists four categories: Molding, Trimming, Packaging, and Profit. The next three columns are labeled "Type A," "Type B," and "Type C," respectively. These columns provide the time required in hours per dozen fixtures for each process and each type of fixture. Under the "Process" column:- The first row is "Molding" and shows the time required for Type A fixtures as 1 hour, Type B fixtures as 2 hours, and Type C fixtures as 3/2 hours.- The second row is "Trimming" and shows the time required for Type A fixtures as 2/3 hours, Type B fixtures as 2/3 hours, and Type C fixtures as 1 hour.- The third row is "Packaging" and shows the time required for Type A fixtures as 1/2 hour, Type B fixtures as 1/3 hour, and Type C fixtures as 1/2 hour.- The fourth row is "Profit" and displays the profit associated with each type of fixture ($11 for Type A, $16 for Type B, and $15 for Type C).The last column is labeled "Total Time Available" and provides the total available time in hours for each process. It shows 12000 hours available for Molding, 4600 hours available for Trimming, and 2400 hours available for Packaging.How many dozen of each type of fixture should be produced to obtain a maximum profit?set up; (i). Data presentation,(ii). LP problem defining viriables, objective function and correctly name the set of constraints. the federal court system has exclusive jurisdiction over all but which of the following types of cases? The Big Bang theory is used to explain the origins of the universe. Why is this called a theory and NOT a law? What are the 3 key questions that every economy/society must answer?