(5,-3)(-2,4) slope inter

Answers

Answer 1

Answer:

The correct answer is -1


Related Questions

= Homework: Lsn 30- Review For Midterm #1 QL 2. A wheel made 200 revolutions at 275 revolutions per minute. How many minutes did it rotate? 7 63 How many minutes did the wheel rotate? 7 191 (Type a whole number, proper fraction, or mixed number)​

Answers

9514 1404 393

Answer:

  8/11 minutes

Step-by-step explanation:

To find the time, divide the quantity by the rate:

  (200 rev)/(275 rev/min) = (200/275) min = 8/11 min

The wheel rotated for 8/11 minutes.

Select the correct answer.
A food manufacturer recently developed a new preservative to extend the shelf life of its perishable food items. It makes two
batches of the perishable items. The preservative is added only to the second batch. After some time, researcher compares
the shelf lives of the batches. Which method is the researcher applying?
O experiment
O observational study
O separation study
O survey
Submit

Answers

The researcher is conducting an experiment to evaluate the effectiveness of the new preservative in extending the shelf life of the perishable food items.

The method that the researcher is applying in this scenario is an experiment.

In an experiment, the researcher manipulates or controls one or more variables to observe the effects on other variables. In this case, the researcher is comparing the shelf lives of two batches of perishable items, where the only difference is the addition of the new preservative to the second batch. By adding the preservative to one batch and not to the other, the researcher is introducing a controlled variable to test its impact on the shelf life of the perishable items.

Therefore, the researcher is conducting an experiment to evaluate the effectiveness of the new preservative in extending the shelf life of the perishable food items.

for such more question on effectiveness

https://brainly.com/question/14768591

#SPJ8

what is the solution to the equation:
5(n - 1/10) = 1/2
a. n= 13/5
b. n= 3/25
c. n= 0
d. n= 1/5

Answers

SolutioN:-

\( \sf \longrightarrow \: 5 \bigg( \: n - \frac{1}{10} \bigg) = \frac{1}{2} \\ \)

\( \sf \longrightarrow \: 5 \bigg( \: \frac{n}{1} - \frac{1}{10} \bigg) = \frac{1}{2} \\ \)

\( \sf \longrightarrow \: 5 \bigg( \: \frac{10 \times n - 1 \times 1}{1 \times 10} \bigg) = \frac{1}{2} \\ \)

\( \sf \longrightarrow \: 5 \bigg( \: \frac{10n - 1}{ 10} \bigg) = \frac{1}{2} \\ \)

\( \sf \longrightarrow \: \: \frac{50n - 5}{ 10} = \frac{1}{2} \\ \)

\( \sf \longrightarrow \: \: 2(50n - 5) =1(10) \\ \)

\( \sf \longrightarrow \: \: 2(50n - 5) =10 \\ \)

\( \sf \longrightarrow \: \: 100n - 10=10 \\ \)

\( \sf \longrightarrow \: \: 100n =10 + 10\\ \)

\( \sf \longrightarrow \: \: 100n =20\\ \)

\( \sf \longrightarrow \: \:n = \frac{2 \cancel{0}}{10 \cancel{0}} \\ \)

\( \sf \longrightarrow \: \:n = \frac{1}{5} \\ \)

Answer:-

Answer:- D) n = ⅕ ✅

To solve the equation \(\sf 5(n - \frac{1}{10}) = \frac{1}{2} \\\) for \(\sf n \\\), we can follow these steps:

Step 1: Distribute the 5 on the left side:

\(\sf 5n - \frac{1}{2} = \frac{1}{2} \\\)

Step 2: Add \(\sf \frac{1}{2} \\\) to both sides of the equation:

\(\sf 5n = \frac{1}{2} + \frac{1}{2} \\\)

\(\sf 5n = 1 \\\)

Step 3: Divide both sides of the equation by 5 to isolate \(\sf n \\\):

\(\sf \frac{5n}{5} = \frac{1}{5} \\\)

\(\sf n = \frac{1}{5} \\\)

Therefore, the solution to the equation \(\sf 5(n - \frac{1}{10})\ = \frac{1}{2} \\\) is \(\sf n = \frac{1}{5} \\\), which corresponds to option (d).

\(\huge{\mathfrak{\colorbox{black}{\textcolor{lime}{I\:hope\:this\:helps\:!\:\:}}}}\)

♥️ \(\large{\underline{\textcolor{red}{\mathcal{SUMIT\:\:ROY\:\:(:\:\:}}}}\)

PLEASE HELP! i got ten mins till due,

please answer the three following questions
Which represents the inverse of the function f(x) = 4x?

A.h(x) = x + 4
B.h(x) = x – 4
C.h(x) = three-quarters x
D.h(x) = one-quarter x


What is the inverse of the function f(x) = 2x – 10?


A.h(x) = 2x – 5

B.h(x) = 2x + 5

C.h(x) = one-halfx – 5

D.h(x) = one-halfx + 5


And Picture Question below

PLEASE HELP! i got ten mins till due,please answer the three following questions Which represents the

Answers

Answer:

If f(x) = 5x + 40, what is f(x) when x = –5 (D)

What is the inverse of the function f(x) = 2x – 10? (B)

Step-by-step explanation:

PLEASE HELP I WILL GIVE BRAINLIEST IF YOU GET IT RIGHT 7TH GRADE MATHH

PLEASE HELP I WILL GIVE BRAINLIEST IF YOU GET IT RIGHT 7TH GRADE MATHH

Answers

Answer:

990

Step-by-step explanation:

(21*18*2)+(21*3*2)+(18*3*2)

=990

Does anyone know how to find the area?

Does anyone know how to find the area?

Answers

Answer:49

Step-by-step explanation:

A = \(\frac{3+11}{2}\) · 7

= \(\frac{14}{2} \\\) · 7

= 7·7

=49

need confirmation on this....​

need confirmation on this....

Answers

Answer:

X + 2y = 1

3x + y = 13

Step-by-step explanation:

A and b are the coefficients of X and y

I wasn't sure about my answer so used Gauthmath

Arrange the following temperatures in ascending order and descending order.
a) 37°C, -15°C, 16°C, -12°C, 0°C, 96°C, -73°C
b) 20°C, -1°C -15°C 0°C, -7°C, 23°C, -36°C.​

Answers

Answer:

a) -73°C, -15°C, -12°C, 0°C, 16°C, 37°C, 96°C

a) 96°C, 37°C, 16°C, 0°C, -12°C, -15°C, -73°C

b) -36°C, -15°C, -7°C, -1°C, 0°C, 20°C, 23°C

b) 23°C, 20°C, 0°C, -1°C, -7°C, -15°C, -36°C

What are the domain and range of the relation that models this situation!! Plz help and explain it so Ican understand thank you!

What are the domain and range of the relation that models this situation!! Plz help and explain it so

Answers

Answer:

Domain:\(0 \le t \le 9\)

Range: \(7200 \ge \ d \ge \ 0\)

Step-by-step explanation:

Given

\(d = 7200 - 800t\)

Required

Determine the domain and range

From the attached graph, the values of t (on the horizontal axis) starts from 0 and ends at 9.

Hence, the domain is: \(0 \le t \le 9\)

When t = 0:

\(d = 7200 - 800t = 7200 - 800 * 0 = 7200\)

When t = 9

\(d = 7200 - 800t = 7200 - 800 * 9 = 0\)

Hence, the range is:

\(7200 \ge \ d \ge \ 0\)

Krysta's Bakery recently spent a total of $264 on new equipment, and their average hourly
operating costs are $18. Their average hourly receipts are $26. The bakery will soon make
back the amount it invested in equipment. What would the total expenses and receipts both
equal? How many hours will that take?

Answers

Answer:

The net profit would be 26-18=6 dollars per hour.

we need hours such that 8h≥264 =>h≥33 hours

After graduating from college, Trevor gets a job at a software company with a starting salary of 50,000 dollars and is given a 10% raise every year. After 10 years, what will his total earnings have been at the company? (Round to the nearest dollar)

Answers

Answer:

796871

Step-by-step explanation:

Based on the given conditions, formulate:

5000 x (1 - (1 + 10%) 10)

-------------------------------                                                                  

           1 - (1 + 10%)                                                                          

Evaluate the equation/expression:

796871.23005

Find the closest integer to

798871.23005

=  796871

Your taxable wages for Social Security purposes are $1100. How much is your Social Security tax if you have previous taxable wages of $102,000?

Answers

If you have previous taxable wages of $102,000 and your current taxable wages are $1,100, your Social Security tax would be $6,324 for the previous wages and $68.20 for the current wages.

To calculate the Social Security tax, we need to know the tax rate for Social Security and the taxable wages. Let's assume the Social Security tax rate is 6.2% for both the employee and the employer.

Given that your taxable wages for Social Security purposes are $1,100, and your previous taxable wages are $102,000, we can determine the Social Security tax amount.

First, we need to calculate the Social Security tax on the previous taxable wages of $102,000. Multiply $102,000 by 6.2% (0.062) to find the Social Security tax for that amount:

Social Security tax = $102,000 x 0.062 = $6,324

Next, we calculate the Social Security tax on the current taxable wages of $1,100. Multiply $1,100 by 6.2% to find the tax amount:

Social Security tax = $1,100 x 0.062 = $68.20

Therefore, if you have previous taxable wages of $102,000 and your current taxable wages are $1,100, your Social Security tax would be $6,324 for the previous wages and $68.20 for the current wages.

For more such answers on Tax

https://brainly.com/question/28414951

#SPJ8

For the following exercises, consider the function f(x) = (1+x)^1/x. Round all answers to five decimal places. Evaluate f(-0.01).

Answers

The value of f(-0.01) is approximately 0.99005.

To evaluate f(-0.01), we substitute -0.01 into the function f(x) = (1+x)^(1/x). Thus, we have f(-0.01) = (1+(-0.01))^(1/(-0.01)).

Using a calculator, we simplify this expression to f(-0.01) = 0.99005. Therefore, the value of f(-0.01) rounded to five decimal places is approximately 0.99005.

The function f(x) = (1+x)^(1/x) represents an exponential function with a variable exponent. In this case, we are evaluating the function at x = -0.01.

By substituting this value into the function and performing the necessary calculations, we find that f(-0.01) is approximately 0.99005. This means that when x is equal to -0.01, the function value is approximately 0.99005.

For more such answers on function

https://brainly.com/question/11624077

#SPJ8

The base of the right triangle in the figure increases at a rate of 4 cm/s, while the height remains constant at ℎ=20 cm. How fast is the angle changing when =32?

Answers

The rate at which the angle changes when the base is equal to 32 is:

a' = 2.876 /s.

How fast is the angle changing?

We have a right triangle where the two catheti measure:

b = 32cm + 4cm/s*th = 20cm

(We don't know which angle we want, I assume that we want the angle adjacent to the base). So we can use the trigonometric relation:

tan(a) = (opposite cathetus)/(adjacent cathetus).

In this case, we will have:

Opposite cathetus = 20cmAdjacent cathetus = 32cm + 4cm/s*t

tan(a) = 20cm/(32cm + 4cm/s*t)

a = Atan(20cm/(32cm + 4cm/s*t))

Now we need to differentiate it with respect to x, remember that:

\(\frac{dAtan(x)}{dx} = \frac{1}{1 + x^2}\)

Then we will have:

\(a' = \frac{4cm/s}{1 + (20cm/(32cm + 4cm/s*t)^2}\)

The rate of change when b = 32, is what we get when we have t = 0s, replacing that we get:

\(a' = \frac{4cm/s}{1 + (20cm/(32cm))^2} = 2.876 /s\)

If you want to learn more about rates of change, you can read:

https://brainly.com/question/8728504

If m42 = 26, what is mZ16?

If m42 = 26, what is mZ16?

Answers

Answer:

∠ 16 = 26°

Step-by-step explanation:

∠ 10 = ∠ 2 = 26°  ( corresponding angles )

∠ 12 = ∠ 10 = 26°  ( vertical angles )

∠ 16 = ∠ 12 = 26° ( corresponding angles )

At a sand and gravel plant, sand is falling off a conveyor and onto a conical pile at a rate of 4 cubic feet per minute. The diameter of the base of the cone is approximately three times the altitude. At what rate is the height of the pile changing when the pile is 22 feet high?

At a sand and gravel plant, sand is falling off a conveyor and onto a conical pile at a rate of 4 cubic

Answers

\(h^{\prime}=\frac{4}{1089\pi}ft\text{ /min}\)

STEP - BY - STEP EXPLANATION

What to find?

dh/dt

Given that;

At a sand and gravel plant, sand is falling off a conveyor and onto a conical pile at a rate of 4 cubic feet per minute. The diameter of the base of the cone is approximately three times the altitude.

Since we have that the rate is 4 cubic per minute, then dv/dt = 4 (since v is the volume of the cone at time t.)

The formula for the volume of a cone is

\(V=\frac{1}{3}\pi r^2h---------------(1)\)

Where r is the radius and h is the height.

We have that, the diameter of the cone is approximately three times the altitude.

That is;

diameter = 3h

But, d = 2r

⇒2r = 3h

r = 3h/2

Now, we substitute r=3h/2 into equation (1).

\(V=\frac{1}{3}\pi(\frac{3h}{2})^2h\)\(=\frac{1}{3}\pi(\frac{9h^2}{4})h\)\(V=\frac{3}{4}\pi h^3\)

Now, differentiate the above with respect to t.

\(\frac{dv}{dt}=\frac{3}{4}\pi3h^2\frac{dh}{dt}\)

Simplify .

\(\frac{dv}{dt}=\frac{9}{4}\pi h^2\frac{dh}{dt}\)

Make dh/dt subject of formula.

\(\frac{dh}{dt}=\frac{dv}{dt}\times\frac{4}{9\pi h^2}----------(2)\)

Recall that, dv/dt = 4 and h=22

Substituting the values into equation (2), we have;

\(\frac{dh}{dt}=4\times\frac{4}{9\pi(22)^2}\)\(=\frac{16}{9\pi\text{ (484)}}\)\(=\frac{4}{9\pi\text{ (121)}}\)\(=\frac{4}{1089\pi}\)

Therefore, h' = dh/dt = 4/1089π ft/min.

For a system to be closed under an operation, and when any two elements in the system are combined using the operation, the result must still be an element of that system. For instance, when any two natural numbers (1, 2, 3, . . .), are added together, the result will always be a natural number. When answering the following questions, consider the system of all polynomial equations and the system of all rational equations.

Part A
Which systems are closed under addition? If either system is not closed under addition, provide a counterexample
Part B
Which systems are closed under subtraction? If either system is not closed under subtraction, provide a counterexample.
Part C
Which systems are closed under multiplication? If either system is not closed under multiplication, provide a counterexample.
Part D
Which systems are closed under division? If either system is not closed under division, provide a counterexample.
Part E
Based on which operations the system of polynomial equations is closed under, which system of numbers is most similar to the system of polynomial equations? Explain your answer, and provide any needed counterexamples.
Part F
Based on which operations the system of rational equations is closed under, which system of numbers is most similar to the system of rational equations? Explain your answer, and provide any needed counterexample

Answers

The answers to all parts is shown below.

What are Numbers?

An arithmetic value used to indicate amount is called a number. A number is a mathematical concept that is used for counting, measuring, and labelling. Thus, mathematics is built on numbers.

1. Real numbers are "closed" under addition Integers are "not closed" under division. Irrational numbers are "not closed" under multiplication. Rational numbers are "closed" under subtraction.

2. Rational numbers are "closed" under subtraction. If an operation is closed under a set of numbers that means that the result of the operation will always be within that same set of numbers.

3. The  closure property of multiplication holds for natural numbers, whole numbers, integers and rational numbers.

4. Rational numbers are closed under division as long as the division is not by zero. Irrational numbers are not closed under addition, subtraction, multiplication or division.

5. The whole number system and the polynomial system are nearly identical. Actually, there are not many differences between polynomial functions and our whole number system. We employ a base-10 (decimal) approach for counting. The above-mentioned polynomial is an example of a "base x" system.

6. The system of polynomials is almost the same with the system of whole numbers.

Learn more about Number here:

https://brainly.com/question/4262258

#SPJ1

Consider the line 5x+2y=−4. What is the equation of the line parallel to the given line that passes through the point (−2, 6) in slope-intercept form? Enter your answer by filling in the boxes to complete the equation.

Answers

Answer:

  y = -5/2x +1

Step-by-step explanation:

You want the slope-intercept form equation for the line through the point (-2, 6) that is parallel to 5x +2y = -4.

Parallel line

The equation of a parallel line can be the same as the given equation, except for the constant. The new constant can be found by substituting the given point coordinates:

  5(-2) +2(6) = c

  -10 +12 = c

  2 = c

Now we know the equation of the parallel line can be written as ...

  5x +2y = 2

Slope-intercept form

Solving for y puts this in slope-intercept form:

  2y = -5x +2 . . . . . . . . subtract 5x

  y = -5/2x +1 . . . . . . . . divide by 2

We don't know what your boxes look like, but we can separate the numbers to make it look like this:

  \(\boxed{y=\dfrac{-5}{2}x+1}\)

#95141404393

Consider the line 5x+2y=4. What is the equation of the line parallel to the given line that passes through

for any Integer 'a',a ÷ 0 is _______
give me answer​

Answers

Answer:

undefined, invalid

and for a limit expression like a/x, x->0 we also say this is infinite.

Two cars are traveling in the same direction. The first car is going 40mph, and the second car is going 55 mph. The first car left 3 hours before the second car. Which equation could you use to find how many hours it will take for the second car to catch up to the first car? hint: how many miles has the first car gone in those 3 hours?

Answers

Assuming both cars start at the same position, in the first 3 hours the first car covers a distance of

(40 mi/h) (3 h) = 120 mi

Take the 3 hour mark to be the origin, so that the first car's position after t hours is

120 mi + (40 mi/h) t

while the second car's position is

(55 mi/h) t

The second car catches up to the first when their positions are equal:

120 mi + (40 mi/h) t = (55 mi/h) t

120 mi = (15 mi/h) t

t = (120 mi) / (15 mi/h)

t = 8 h

12a

A boy is standing on the very edge of a cliff that is 58.8 m high. The boy throws a rock straight up in the air at 7.36 m/s. (a) What is the rock's velocity when it hits the ground? (use up as the positive direction)
How long (from the time it was thrown) will it take for the rock to hit the ground?
What is the total distance traveled by the rock?

Answers

Answer:

The exact same from when it went up

Step-by-step explanation:

it never said the rock was thrown at a angle besides directly up and the boy didn't move so it hit his head

use the gas prices data below to calculate a 3-month simple moving average (sma) forecast for the average gas prices and predict the average retail gasoline price for june 2020. round your answer to two decimal places, if necessary.

Answers

Three- month simple moving average (sma) forecast for the average gas prices are $3.08

$3.16 , $3.29 and predict the average retail gasoline price for june 2020 is $3.54.

What Is a Simple Moving Average (SMA)?

A simple moving average (SMA) is defined as an arithmetic moving average calculated by adding recent prices and then dividing that figure by the number of time periods in the calculation average. The formula for SMA is:

SMA = (A + A + ------+ A )/n

where, Aₙ = the price of object at nth period

n = the number of total periods

We have, a average gas prices for different months. Calculate the three-month moving average, add together the first three sets of data, for this example it would be Dec, January, and February. This gives a total of $9.25 , then calculate the average of this total, by dividing this figure by 3 we get 3-month simple moving average. We have to predict the 3-month simple moving average for June 2020. As we seen in above table we calculate the 3-month simple moving average for different months.

The 3-month simple moving average for June 2020 is ( $3.29 + $3.51 + $3.82 )/3 = $3.54

So, required value is $3.54..

To learn more about Simple moving average, refer:

https://brainly.com/question/13495627

#SPJ4

Complete question:

use the gas prices data below to calculate a 3-month simple moving average (sma) forecast for the average gas prices and predict the average retail gasoline price for june 2020. round your answer to two decimal places, if necessary.

Year - month Averge gas price

19-Dec $3.07

20-Jan $3.10

20-Feb $3.08

20-Mar $3.29

20-Apr $3.51

20-May $3.82

20-Jun

use the gas prices data below to calculate a 3-month simple moving average (sma) forecast for the average

What polygon is formed by
joining the points
(1, −1), (4, −1), (−1, −3),
and (7, −3)?

Answers

Answer:

the polygon is a trapezoid

Step-by-step explanation:

(1, −1), (4, −1), the two points having the same y coordinate they make a horizontal line

(−1, −3), (7, −3) the two points having the same y coordinate they make another horizontal line

All horizontal lines are parallel.

The shape is a trapezoid because it has one pair of parallel lines.

What polygon is formed by joining the points(1, 1), (4, 1), (1, 3), and (7, 3)?

Find the value of x, 6,4, 3x, 4x+1

Find the value of x, 6,4, 3x, 4x+1

Answers

Answer:

If two chords intersect in a circle, then the product of the segments of one chord equals the product of the segments of the other chord.

6(3x) = 4(4x + 1)

18x = 16x + 4

2x = 4

x = 2

What is the surface area for a triangle prism 15cm 25cm 25cm 12cm 9cm

Answers

Answer:

86 IF you have to add them

Which of the following conditions or set of conditions must be met for a parallelogram to be a rectangle?
A. Diagonals are perpendicular.
B. Diagonals are congruent.
C. All sides are congruent.
D. The length of a diagonal is equal to the length of a side.

Answers

A parallelogram can only be a rectangle if the following conditions are satisfied: B) The diagonals must be congruent, and A) the diagonals must be congruent and perpendicular.

What is meant by parallelogram?A unique kind of quadrilateral known as a parallelogram is defined by having both pairs of its opposite sides parallel and equal. The opposing sides of a parallelogram are all parallel and of equal length. a quadrilateral parallelogram. Rhombus: An equal-length parallelogram with four sides. A parallelogram is a square. Always. This is accurate. A square is a quadrilateral with two sets of parallel sides, four right angles, and four congruent sides.Since not all parallelograms have equal sides, not every parallelogram is a rhombus. The opposite is true, though, when every rhombus is a parallelogram.Every rectangle is a parallelogram, but not every parallelogram is a rectangle, is the correct statement.

Therefore,

One feature of a parallelogram is that its diagonals are divided in half. A rectangle also has congruent diagonals.

In addition to being congruent, the diagonals in a square are perpendicular to one another.

To learn more about parallelogram, refer to:

https://brainly.com/question/970600

#SPJ4

NO LINKS!! URGENT HELP PLEASE!!!

9. Find the equation of the PARABOLA with a vertex at (-2, 6) and passing through the point (1, -3)

Answers

Answer:

y= -x²-4x+2

Step-by-step explanation:

write in vertex form

a(x-h)²+k

in our case h = -2 and k= 6

y=a(x+2)²+6

now we just need to solve for a. we know that when x= 1 y = -3. plug these values in and solve for a

-3= a(1+2)²+6

-9=9a

a= -1

thus the formula is -(x+2)²+6

generally, teachers want things in standard form, so expand the exponent and simplify.

-(x²+4x+4)+6

y= -x²-4x+2

Answer:

\(y = -x^2 - 4x + 2\)

Step-by-step explanation:

The equation of a parabola in vertex form is:

\(y = a(x - h)^2 + k\)

where (h, k) is the vertex of the parabola.

In this case, the vertex is (-2, 6), so h = -2 and k = 6.

We also know that the parabola passes through the point (1, -3).

Plugging these values into the equation, we get:

\(-3 = a(1 - (-2))^2 + 6\)

\(-3 = a(3)^2 + 6\)

-9 = 9a

a = -1

Substituting a = -1 into the equation for a parabola in vertex form, we get the equation of the parabola:

\(y = -1(x + 2)^2 + 6\)

This equation can also be written as:

\(y = -x^2 - 4x -4+6\\y=x^2-4x+2\)

How do your write a feaction with a denominator of 20 as a decimal?​

Answers

Answer:

Step-by-step explanation:

What is 20 as a decimal? To write 20 as a decimal you have to divide numerator by the denominator of the fraction. 20 is not a fraction so it is a decimal already. And finally we have: 20 as a decimal equals 20

What are the new coordinates if the figure were rotated 90 degrees counterclockwise

What are the new coordinates if the figure were rotated 90 degrees counterclockwise

Answers

Answer:

third option

Step-by-step explanation:

under a counterclockwise rotation of 90° about the origin

a point (x, y ) → (y, - x )

Then

A (- 1, - 2 ) → (- 2, - (- 1) ) → (- 2, 1 )

B (2, - 2 ) → (- 2, - 2 )

C (1, - 4 ) → (- 4, - 1 )

The new coordinates are (d) A = (2, -1) B = (2, 2) and C = (4, 1)

How to determine the new coordinates rotating by 90 degrees counterclockwise

From the question, we have the following parameters that can be used in our computation:

The figure,

Where, we have

A = (-1, -2)

B = (2, -2)

C = (1, -4)

The rule of 90 degrees counterclockwise is

(x, y) = (-y, x)

Using the above as a guide, we have the following:

A = (2, -1)

B = (2, 2)

C = (4, 1)

Hence, the new coordinates are (d) A = (2, -1) B = (2, 2) and C = (4, 1)

Read more about transformation at

https://brainly.com/question/27224272

#SPJ1

we play a game with a pot and a single die. the pot starts off empty. if the die roll is 1, 2 or 3, i put 1 pound in the pot, and the die is thrown again. if its 4 or 5, the game finishes, and you win whatever is in the pot. if its 6, you leave with nothing.

Answers

Your expected winnings from playing this game are 2 pounds.

What is a game?

A game is an activity or a form of play, often with a set of rules and goals, that is undertaken for enjoyment, competition, or skill development.

Let's analyze this game to see what your expected winnings are.

If the first roll is 1, 2, or 3, the game continues and you have a 3 in 6 chance (or 1/2 chance) of continuing to roll the die. Each subsequent roll has the same probabilities and outcomes as the first roll.

Let's start with the case where you win on the first roll with a probability of 1/2. In this case, your winnings are 1 pound.

If you don't win on the first roll, the game continues with a probability of 1/2, and your expected winnings from that point on are the same as your expected winnings from the beginning of the game (since the probabilities and outcomes are the same for all rolls).

Therefore, the expected winnings from the start of the game are:

E = 1/2 * 1 + 1/2 * E

Solving for E, we get:

E = 1 + E/2

E/2 = 1

E = 2

Therefore, your expected winnings from playing this game are 2 pounds.

Learn more about game here : brainly.com/question/26107008

#SPJ1

Other Questions
the perimeter of an isosceles triangle with equal side of length 4cm and third side of length 6cm will be A Punnett square without the genotypes of the parents is shown below.????CCWhat are the genotypes of the parents? A paramecium is covered with motile hair called cilia that propel it at a speed of 1mm/s.PartA: if the paramecium has a volume of 2E-13m3 and a density equal that of water, what is the de brogile wavelength when in motion?Part B: what fraction of the paramecium 150um in length does this wavelength represent? Thenumbers are {0, 1, 2, 3, 4, ...}.wholerationalnaturalrealinteger which invention allowed computers to become smaller in size? can you please compare the DNA sequences in thisimage, mark any insertion, deletion, polymorphism, and addition.Discuss about the yellow region in sequences and the nucleotides.discuss all the simi>M12-LCMT-F_D02.ab1TAAAGCCATTTACCGTACATAGCAC >M13-LCMT-F E02.ab1TAAAGCCATTTACCGTACATAGCAC >M14-LCMT-F_F02.ab1TAAAGCCATTTACCGTACATAGCAC325 >M15-LCMT-F_G02.ab1TAAAGCCATTTACCGTACATAGCAC >M16-LCMT-F_H02.ab1TAAAGCCATTTACCGTACATAGCAC>M12-LCMT-F_D02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M13-LCMT-F_E02.ab1ATTACAGTCAAATCCCTTCTCGTCC >M14-LCMT-F F02.ab1ATTACAGTCAAATCCCTTCTCGTCC350>M15-LCMT-F G02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M16-LCMT-F_H02.ab1ATTACAGTCAAATCCCTTCTCGTCC w >M12-LCMT-F_D02.ab1CCATGGATGACCCCCCTCAGATAGG>M13-LCMT-F_E02.ab1CCATGGATGACCCCCCTCAGATAGG >M14-LCMT-F_F02.ab1CCATGGATGACCCCCCTCAGATAGG375 >M15-LCMT-F_G02.ab1CCATGGATGACCCCCCTCAGATAGG>M16-LCMT-F_H02.ab1CCATGGATGACCCCCCTCAGATAGG>M12-LCMT-F_D02.ab1GGTCCCTTGACCAC>M13-LCMT-F_E02.ab1GGTCCCTTGACCAC >M14-LCMT-F_F02.ab1AGTCCCTTGACCAC >M15-LCMT-F_G02.ab1GGTCCCTTGACCAC>M16-LCMT-F H02.ab1GGTCCCTTGACCAC 400 The California State University (CSU) undergraduate full-time tuition fee per academic year increased from $1,428 in 2001 to $5,472 in 2011. Find the percent increase in the CSU tuition from 2001 to 2011. Round your final answer to one decimal place if necessary. Also, write a sentence to state your answer in context. help me pleasee!!!!!! A spring has an elastic constant of 8.75 x 103 N/m. What is the magnitude of the force required to stretch this spring a distance of 28.6 cm from its equilibrium position? Please please help please please ASAP (5) let A={4,5,6,7,8,9,10},B={0,2,4,6,810} C={0,1,2,3,4,5,6} Find B(CA) The predicted reliability determined by the design of the product or process is called the _____ reliability. Find the area bounded by the graphs of the indicated equations over the given interval. y = -xy=0; -15xs3 The area is square units. (Type an integer or decimal rounded to three decimal places as neede What type of sentence is the one below? Sergeant Torres handed my brother a bottle of water, and then he asked him to explain what had happened. What type of sentence is this?A. SimpleB. ComplexC. ImperativeD. Compound What was the key finding that enabled Meselson and Stahl to settle on ONE hypothesis? Which hypothesis did their findings support? 1. Does the following table represent a linear function? If so, what is the constant rate of change? I need help writing this :) Need help on this please work out the following numbers: a. 473 569+ 4798. b. 89 264 + 126 578. c. 900 008-124 829. d. 876 954- 765 612 1) A man walks 10km north and then 10km west.a) What distance has he covered?b) How would you measure hisdisplacement?c) What angle would his displacement be at compared tonorth?