3. Write the complimentary sequence of DNA for the following strand:
5'-AATTAGGAGCCCAGCTTTGCCGA-3'

Answers

Answer 1
The correct answer is TTAATCCTCGGGTCGAAACGGCT

This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.

Adenine -> Thymine
Cytosine -> Guanine

Hope this helps!! :)

Related Questions

3. Why do breathing and heart rate increase during exercise? Explain how these responses tie directly
to the reaction that gives our cells energy.

Answers

Answer: The breathing rate increases during excercise to bring more oxygen into the body and remove the carbon dioxide that was produced. The heart rate increases to supply the muscles with extra oxygen and remove the carbon dioxide produced.

Explanation:

earthquakes are caused by plates moving. what causes the plates to move​

Answers

Answer:

The tectonic plates are always slowly moving, but they get stuck at their edges due to friction. When the stress on the edge overcomes the friction, there is an earthquake that releases energy in waves that travel through the earth's crust and cause the shaking that we feel.

Explanation:

[Anatomy, muscles] On the pinky side, to bring back to anatomical position, from a clenched fist

(The answer is 3 words long, it must fit in the spaces I drew in the image)

[Anatomy, muscles] On the pinky side, to bring back to anatomical position, from a clenched fist (The

Answers

Between the hand's bones is where the interossei muscles start. There are three palmar interossei and four dorsal interossei. The dorsal interossei allow us to stretch our fingers apart whereas all interossei bend the MCP joints. The interossei on our palms bring our fingers together.

The first and secondhand bones serve as the origin of the greatest dorsal interosseous muscle. When a patient has severe cubital tunnel syndrome because of ulnar nerve injury, it is frequently the first muscle to shrink. It creates the shape between the thumb and index finger when looking at the top of the hand. It draws the thumb towards the index finger as well as dragging the index finger away from the middle finger.

To know more about muscles visit:

https://brainly.com/question/9883108

#SPJ1

which statement best describes why genetic variation is beneficial to populations of organisms A. Individuals look different from one another. B . Only one parent is needed to produce offspring. C. Populations of the organism increases more rapidly. D. Species can better survive environmental changes.

Answers

Answer:

Explanation:

Its D, species began having more beneficial adaptions to their environment causing them to live longer.

Answer:

It's D. Species can better survive environmental changes.

The cells in your body are all about the same age. TRUE OR FALSE

Answers

Answer:

False

Explanation:

What helps the chromosome coil up ?

A. Volume

B. Histones

C. Polymerase

D. Hydrogen


( please help its due right now ) ( ✌︎'ω')✌︎

Answers

Answer:

B. Hitsones

Explanation:

DNA in each chromosome is wrapped around proteins called histones.

The answer is hitstones!! ⚡️⚡️

What most likely happens if water flows through a permeable soil layer and reaches a clay layer?

It dries up.
It soaks in.
It pools on top of the clay layer.
It flows down through the clay layer.

Answers

Answer:

It pools on top of the clay layer.

the factor that promotes filtrate formation at the glomerulus is the . the factor that promotes filtrate formation at the glomerulus is the . myogenic mechanism colloid osmotic pressure of the blood capsular hydrostatic pressure glomerular hydrostatic pressure

Answers

Glomerular hydrostatic pressure alone is the factor that promotes filtrate formation. The correct option to this question is c.

Glomerulus The force the fluid in capillaries applies to the glomeruli to facilitate glomerular filtration is known as glomerular hydrostatic pressure.Other suggestions are flawed because the glomerular capillaries are forced to reabsorb the capsular fluid due to blood colloid osmotic pressure and capsular hydrostatic pressure.A system of capillaries found in the kidney's nephrons is called the glomerulus. To remove waste materials and extra fluid from the circulation, the first stage in the generation of urine is glomerular filtration.By forcing water and other solutes in blood plasma through the glomerular filter, glomerular blood hydrostatic pressure (GBHP) encourages filtration. GBHP, or glomerular capillary blood pressure, is 55 mm Hg or below.

For more information on glomerular hydrostatic pressure kindly visit to

https://brainly.com/question/4631715

#SPJ1

this represents the range of which hominid species? group of answer choices a. afarensis homo habilis orrorin tugenesis homo floresiensis homo erectus

Answers

This represents homo habilis hominid species according to the given data, option B is correct.

Homo habilis, is the correct choice based on the given options. Homo habilis is a hominid species that existed approximately 2.1 to 1.5 million years ago during the early Pleistocene epoch. It is considered one of the earliest members of the Homo genus and is known for its tool-making capabilities.

Homo habilis had a relatively small brain size compared to later hominids and displayed a mix of primitive and more advanced features. The species is significant in human evolutionary history as it represents a transitional form between Australopithecus and more advanced Homo species, option B is correct.

To learn more about species follow the link:

https://brainly.com/question/9506161

#SPJ4

The complete question is:

This represents the range of which hominid species? group of answer choices

A. afarensis

B. homo habilis

C. orrorin tugenesis

D. homo floresiensis

E. homo erectus

this represents the range of which hominid species? group of answer choices a. afarensis homo habilis


A pink snapdragon is crossed to a white snapdragon. What is the probability of getting a red snap dragon

Answers

Answer:

0%

Explanation:

Hope this helped! ^^

Which of these is specifically necessary to distinguish bacteria that carry plasmids with disrupted lacZ?
a. X-gal b. IPTG bee c. lacO
d. T7 phage RNA polymerase e. antibiotic

Answers

The specific chemical necessary to distinguish bacteria that carry plasmids with disrupted lacZ is option a) X-gal.

X-gal (5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside) is a colorless compound that is used as a substrate for the enzyme β-galactosidase. When β-galactosidase is active, it cleaves X-gal into a blue product.

In the case of bacteria carrying plasmids with disrupted lacZ, the lacZ gene is nonfunctional, resulting in the absence of β-galactosidase activity.

Therefore, when X-gal is added to a culture containing these bacteria, no blue product will be formed. This allows for the visual identification of bacterial colonies that have successfully taken up and expressed the disrupted lacZ plasmid.

These colonies will appear white or colorless, while colonies with functional lacZ will produce a blue color.

Option b) IPTG (isopropyl β-D-1-thiogalactopyranoside) is a compound often used to induce lac operon expression in bacteria but is not directly involved in distinguishing bacteria with disrupted lacZ.

Options c) lacO, d) T7 phage RNA polymerase, and e) antibiotic are not directly related to the detection of bacteria with disrupted lacZ and are not specific for this purpose. Therefore, the correct answer is A.

For more such answers on  X-gal

https://brainly.com/question/14240119

#SPJ11

Damming the chagres river basin to create the panama canal watershed group of answer choices caused the banana plantation business to thrive. killed the rain forest. caused a rain forest to grow. forced residents of the submerged towns to move.

Answers

Damming the Chagres river basin to create the Panama canal watershed forced residents of the submerged towns to move.

The Panama Canal watershed was created by damming the Chagres River basin. This created a large reservoir, which flooded the land around it, including many towns and villages that were located there. This flooding caused the residents of those towns to lose their homes and businesses, and be forced to move to other areas. By flooding the area, the Panama Canal watershed not only created a new reservoir but also disrupted the lives of the people who lived there.

To know more about Panama Canal refer to the  link brainly.com/question/29739549

#SPJ4

in most cases, the two major climatic factors affecting the distribution of organisms in terrestrial ecosystems are

Answers

Answer:

temperature and water

temperature in water are important abiotic factor that affects species distribution

which grade of tumor is also known as a well-differentiated tumor?

Answers

The grade of tumor also known as a well-differentiated tumor is: Grade I.

The grading of tumors is used to indicate how abnormal the cells appear under the microscope and how quickly the tumor is likely to grow and spread.

The grading system is different for each type of cancer, but it generally ranges from Grade I (well-differentiated) to Grade IV (poorly differentiated or undifferentiated).

In Grade I tumors, the cells appear almost normal and are well-differentiated, meaning they look similar to normal cells in the tissue from which they arise.

These tumors are generally considered to be slow-growing and less aggressive. As the grade of the tumor increases, the cells become more abnormal and less like normal cells, and the tumor is likely to grow and spread more quickly.

Knowing the grade of a tumor can help doctors make treatment decisions and predict the likely outcome of the disease.

To know more about "Tumor" refer here:

https://brainly.com/question/14143650#

#SPJ11

an invasive plant species exhibits a wide variety of plastic responses to leaf herbivory by insects. when insects are abundant and plant damage occurs, some plants exhibit a morphological response, increasing the number of trichomes and the thickness of the waxy cuticle on their leaves. other plants exhibit a physiological response, producing in their leaf tissues large amounts of acidic secondary compounds that are distasteful to herbivores. still other plants change their life history, rapidly producing large numbers of flowers to reproduce quickly, though these flowers contain fewer and smaller seeds than flowers produced later in life. of these plastic response strategies to insect herbivory, which is most likely to be advantageous in an environment where insect herbivory occurs in infrequent, short bursts followed by long periods of relatively little herbivory?

Answers

In an environment where insect herbivory occurs in infrequent, short bursts followed by long periods of relatively little herbivory, the plastic response strategy of changing life history by rapidly producing large numbers of flowers to reproduce quickly is most likely to be advantageous.

This strategy allows the plant to take advantage of the short periods of insect herbivory by maximizing reproductive output during those times. By producing a large number of flowers, the plant increases the chances of successful pollination and seed production. This can be especially beneficial when herbivory events are sporadic and unpredictable.

While morphological responses such as increasing trichomes and waxy cuticle thickness, and physiological responses such as producing acidic secondary compounds, can also provide some level of protection against herbivory, these responses require energy and resources to be maintained. In an environment with infrequent herbivory, investing resources in these responses may not be as advantageous as investing in reproductive efforts.

By rapidly producing large numbers of flowers during herbivory events, the plant can quickly reproduce and ensure the survival of its genetic material, even if the individual seeds produced during these events are smaller or fewer in number compared to seeds produced later in life. This strategy allows the plant to take advantage of the occasional bursts of herbivory and maximize its reproductive success in an environment with relatively little herbivory over longer periods of time.

To know more about pollination , visit:

https://brainly.com/question/33779882

#SPJ11

Which statement is NOT a function of the lymphatic vessels?
initiate an immune response to pathogens that enter the body
return excess tissue fluid to
the blood vascular system
return leaked plasma proteins to the blood vascular system
absorb digested fats from the small intestine
initiate an immune response to pathogens that enter the body
Lymph nodes initiate the immune response to invading pathogens, not lymph vessels.

Answers

The lymphatic vessels are arranged around the entire body collecting harmful substances that can affect the different organic tissues.

Lymphatic system and its functionsThey participate in the reabsorption of fats through the intestine.

Responds to the constant threats generated by external pathogens.

The functions that are not the responsibility of the lymphatic vessels are those related to proteins and the reabsorption of tissue fluid, since this is carried out by the blood vascular network. Therefore, both the functions related to proteins are not those belonging to the lymphatic system.

For more information about lymphatic system here: https://brainly.com/question/6504171

#SPJ4

Which statement is NOT a function of the lymphatic vessels?initiate an immune response to pathogens that

As soon as left ventricular pressure exceeds the pressure in the aorta, the:

Answers

When left ventricular pressure exceeds the pressure in the aorta, the aortic valve opens, initiating the ventricular ejection phase.

During the cardiac cycle, the left ventricle contracts to pump blood into the systemic circulation. As the left ventricle contracts, its pressure rises. When the left ventricular pressure surpasses the pressure in the aorta, the aortic valve, located between the left ventricle and the aorta, opens.

The opening of the aortic valve allows blood to be ejected from the left ventricle into the aorta. This marks the beginning of the ventricular ejection phase. As the left ventricle continues to contract, blood is forcefully propelled into the aorta, resulting in systemic blood flow.

The ventricular ejection phase is an essential part of the cardiac cycle, as it ensures efficient delivery of oxygenated blood to the body's tissues and organs. Once the left ventricular pressure falls below the pressure in the aorta, the aortic valve closes, preventing blood from flowing back into the ventricle during diastole.

This closure signifies the end of the ventricular ejection phase and the start of the ventricular relaxation phase, known as diastole, in preparation for the next cardiac cycle.

To learn more about diastole visit:

brainly.com/question/31845729

#SPJ11

Answer pls
All three

Answer pls All three

Answers

A food chain has six elements; not all of them are always present. They have a producer, like algae, a herbivore primary consumer, like shrimps, an omnivore secondary consumer, like killifish, a carnivore tertiary consumer, like catfish, another carnivore tertiary consumer, like alligators, and a decomposer like a fungus.

Food chains are essential for the ecosystem and the survival of species. Each consumer depends on another animal or plant to survive.  It is from where they obtain their nourishment.

1. a food chain that connects the algae to the alligator is algae, shrimp, killifish, catfish, alligator.

A food chain from the salt meadows to the alligator is the salt meadow, muskrat, alligator.

2. Primary producers are the ones that produce their food. They are plants. Even though alligators do not eat plants, primary producers ae an indirect energy supply for them since a primary consumer and then a secondary consumer eats it. Without the primary producer, the alligator would not have a secondary consumer that supplies the energy.

3. Decomposers are at the end of the diagram. They will process the rest of the animal that the alligator ate, giving the necessary nutrients to the soil where plants grow.

In conclusion, all elements in the food chain are necessary since they benefit directly or indirectly from the previous consumers.

Learn more at:

https://brainly.com/question/396252

Intensity of a stimulus, such as the intensity of noise that a person experiences, can be communicated through ______.

Answers

The intensity of a stimulus, such as the intensity of noise that a person experiences, can be communicated through the number of neurons that fire action.

A stimulus is a change detected by the neurons in a body for which a response is produced. The sensory nerves sense a stimulus and send signals to the brain. The brain interprets this message and sends a response action signal through the motor neurons.

The intensity of a stimulus is detected by the impulse of action potential carried by the sensory neurons. The number of sensory neurons will increase if an intense stimulus, which will lead to the generation of an increased action potential. The brain will determine the intensity of the increased action potential and send a response action from the motor neurons to act accordingly.

To learn more about neurons, click here:

https://brainly.com/question/11538106

#SPJ4

which fluorinated gasses played a large part in destroying the protective ozone layer?A. HCFCs and CFCsB. HFCsC. SF6sD. PFCs

Answers

Chlorofluorocarbons (CFCs), hydrochlorofluorocarbons (HCFCs) and halons destroy the earth's protective ozone layer, which shields the earth from harmful ultraviolet (UV-B) rays generated from the sun.

Answer: A

what qualitative information can a high-resolution transmission electron microscope (hr-tem) reveal about a material? (check all that apply.)

Answers

A high-resolution transmission electron microscope (HR-TEM) can reveal several qualitative information about a material, including its crystal structure, lattice defects, grain boundaries, chemical composition, and the presence of nanoparticles or nanoscale features.

A high-resolution transmission electron microscope (HR-TEM) is a powerful tool for investigating the structure and properties of materials at the atomic scale. By using a focused electron beam to transmit through a thin specimen, HR-TEM can provide detailed qualitative information about the material under study.

Firstly, HR-TEM can reveal the crystal structure of a material. By analyzing the diffraction patterns produced by the electron beam interacting with the crystal lattice, researchers can determine the arrangement of atoms within the material.

Secondly, HR-TEM can identify lattice defects within a material. These defects include vacancies, dislocations, stacking faults, and other structural imperfections that can affect the material's mechanical, electrical, or optical properties. HR-TEM allows researchers to visualize and characterize these defects at high resolution.

Furthermore, HR-TEM can detect and analyze grain boundaries in polycrystalline materials. Grain boundaries are interfaces between adjacent crystalline grains and can significantly influence the material's properties. HR-TEM enables researchers to examine the structure and properties of grain boundaries, providing insights into the material's behavior.

Additionally, HR-TEM can provide information about the chemical composition of a material. By utilizing energy-dispersive X-ray spectroscopy (EDS) in combination with TEM, researchers can map and identify the elements present in the material, aiding in the understanding of its composition and elemental distribution.

Lastly, HR-TEM is capable of visualizing nanoparticles and nanoscale features within a material. The high-resolution imaging capability of HR-TEM allows for the observation and characterization of nanoscale structures, such as nanoparticles, nanotubes, and nanowires, providing valuable insights into their size, shape, and arrangement.

In summary, a high-resolution transmission electron microscope (HR-TEM) can reveal qualitative information about a material's crystal structure, lattice defects, grain boundaries, chemical composition, and the presence of nanoparticles or nanoscale features. This information is crucial for understanding the material's properties and behavior at the atomic and nanoscale levels.

To learn more about transmission electron microscope visit:

brainly.com/question/28804998

#SPJ11

What mechanisms regulate fluid intake? Note: more than one answer may be correct. reduced blood pressure increased salivation increased blood osmolarity increased blood pressure reduced salivation decreased blood osmolarity

Answers

The mechanisms that regulate fluid intake are increased salivation, reduced salivation, reduced blood pressure, and increased osmolarity. All these processes are controlled by the thirst mechanism.

Fluid is a substance that flows freely and has no definite shape of its own. Fluids include liquids, gases, and plasmas. They are the only state of matter that can be deformed by stress continuously.

Salivation is the act of producing saliva, a watery fluid secreted by the salivary glands in the mouth. Saliva has many functions, including aiding in digestion, neutralizing acid, and preventing tooth decay.

Increased salivation: Saliva helps to moisten food and aid in digestion, and its production is stimulated by the thirst mechanism.Reduced salivation: Saliva production is reduced in response to dehydration or excessive sweating.Reduced blood pressure: When blood pressure is low, the thirst mechanism is activated, and the desire to drink fluids is increased.Increased osmolarity: When blood osmolarity is high, the thirst mechanism is activated, and there is a stronger desire to drink fluids.

The following mechanisms do not regulate fluid intake:

Increased blood pressure: Increased blood pressure does not directly regulate fluid intake. However, it can indirectly affect fluid intake by causing the body to release ADH or AVP.Decreased blood osmolarity: Decreased blood osmolarity does not directly regulate fluid intake. However, it can indirectly affect fluid intake by causing the body to release less ADH or AVP.

Thus, the correct options are : option a, b, c, e

To learn more about osmolarity :

https://brainly.com/question/13258879

#SPJ11

an rna product from a fragment of dna has the sequence of aauuggcu. the sequence of the nontemplate strand in the dna that gave rise to the sequence is which one of the following?

Answers

The sequence of the nontemplate strand in the DNA that gave rise to this sequence is  (C) AATTGGCT.

Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around one another to create a double helix. The polymer contains genetic instructions for all known organisms and viruses' genesis, functioning, growth, and reproduction. Nucleic acids include DNA and ribonucleic acid.

Do all humans have the same DNA?

The human genome is mostly the same in all people. But there are variations across the genome. This genetic variation accounts for about 0.001 percent of each person's DNA and contributes to differences in appearance and health.

Learn more about DNA to visit this link

https://brainly.com/question/264225

#SPJ4

Full Question :An RNA produced from a fragment of DNA has the sequence of AAUUGGCU. The sequence of the nontemplate strand in the DNA that gave rise to this sequence is which one of the following?

(A) AGCCAATT

(B) AAUUGGCU

(C) AATTGGCT

(D) TTAACCGA

(E) UUAACCGA

A scientist is conducting embryological studies on a new species of invertebrate. She notices that it has spiral determinate cleavage and a blastopore that develops into a mouth. How does she classify the new species? chordate urochordate deuterostome protostome radiate

Answers

Answer:

Based on the information provided, the scientist can classify the new species as a protostome. Here's the reasoning behind this classification:

Spiral determinate cleavage: Spiral cleavage is a characteristic feature of protostomes. In this type of cleavage, the cell divisions are diagonal and spiral-shaped, leading to the formation of a distinct pattern of cells. Determinate cleavage refers to the fate of the cells being determined early in development. These features are commonly observed in protostomes, but not in deuterostomes.

Blastopore developing into a mouth: In protostomes, during gastrulation, the blastopore forms and develops into the mouth of the organism. This is in contrast to deuterostomes, where the blastopore typically develops into the anus, and the mouth forms later.

Given these characteristics, the scientist can classify the new species as a protostome. The options you provided (chordate, urochordate, deuterostome, and radiate) do not align with the observed traits of spiral determinate cleavage and the blastopore becoming the mouth.

Explanation:

What are the benefits of a Cowrie shell?

Answers

Answer:

Please mark Brainliest

"Cowrie shells are known as the most successful and the best form of currency in the various regions of the world. According to the African legends, the cowrie shells are representing the goddess protection which is highly powerful and is connected with the strength and power of the Ocean."

Tools that are in good condition and can perform its regular function Answer?

Answers

Functional means it is in good condition and can perform well. Non-functional tools and equipment means that they are in good condition and can perform its regular functions. Non functional means cannot be used due to damage or defective and needs to be repaired.

This is an example of a _ reaction

a. entropy
b. exergonic
c. endergonic
d. anabolic

This is an example of a _ reaction a. entropy b. exergonic c. endergonicd. anabolic

Answers

Answer: b. exergonic

Explanation:

There is a loss of energy over time. As can be seen in the attached image a reaction is exergonic when the final energy < initial.

It is endergonic if energy is absorbed and final energy > initial

This is an example of a _ reaction a. entropy b. exergonic c. endergonicd. anabolic

based on scientific research, which statement best describes mutations?

Answers

Answer:

Based on scientific research the best statement to describe mutations is that they are rare occurrences.

Explanation:

:)


6.The original source of all the energy in the ecosystem is the

Answers

the sun
it’s part of our solar system and provides plants and animals with energy
I think the answer is: the sun

Opposite of cellular respiration

Answers

Answer:

On a simplified level, photosynthesis and cellular respiration are opposite reactions of each other. In photosynthesis, solar energy is harvested as chemical energy in a process that converts water and carbon dioxide to glucose. Oxygen is released as a byproduct.

Answer: Photosynthesis

Explanation: Cell respiration and photosynthesis are essentially opposite processes. Photosynthesis is the process by which organisms make high-energy compounds – the sugar glucose in particular – through the chemical "reduction" of carbon dioxide (CO2).

Other Questions
The structure of the eye that provides about 80% of the eye's focusing power is the iris. pupil. cornea. lens. for locke, primary qualities were the properties that were in the objects themselves like shape. true or false PLEASE GIVE ANSWERS WILL GIVE BRAINLESS MY TUTOR DOSENT EVEN KNOW HOW TO DO IT. simplify (3x^2y)(-5x^3y^2) The International Criminal Court (ICC) is sometimes called a. an arm of US foreign policy. b. the court of last resort. c. the Karlsruhe Criminal Court, for the city where it is based. d. weak, ineffective, and because it can only prosecute crimes committed before July 1, 2002. Carson uses debt and common equity. It can borrow unlimited amount at rd = 9% as long as it finances at its target capital structure - 25% debt and 75% common equity. Its last common stock dividend was $1.50. Dividend for this year is expected to be $1.59 and will grow at the same constant rate in the future. Its common stock is selling for $25 per share; its tax rate is 25%. Estimate Carson's WACC. I have to find the difference I need help tho April works diligently to accomplish the company goals in an efficient and effective manner, utilizing her employees through planning, organizing, leading, and controlling company resources. April is. Exercise 1 Underline the correct word in each sentence.One may never be safe from a tornado in a mobile home. Decision making under risk means the decision maker:A. has no data on which to base his or her decision.B. is risk-averse, avoiding risky investments.C. knows all the risks involved in the decision.D. can estimate decision data with some probability. The mean and standard deviation of the maximum loads supported by 60 cables are 11.09 tons and 0.73 tons, respectively. Find (a) 95%, (b) 99% confidence limits for the mean of the maximum loads ofall cables produced by the compan She spoke _______ that Im sure theyll agree to her plan.So convincedVery convincinglySo convincinglySuch conviction which language has no traceable origins to any other language? Tara and Glen share a 16-ounce bucket of clay. By the end of the week, Tara has used 3/8 of the bucket, and Glen has used 1/4 of the bucket of clay. How many ounces are left in the bucket? daphne turns on one burner of her stove to cook dinner and fills a pot with water. she is aware of which burner to place the pot on because the part of her brain that processes visual information is also the part that processes awareness of where to put the pot. in other words, the occipital lobe will process both visual information and awareness of visual information, according to the a blood transfusion is prescribed fora client experieicing complications of sickle cell anemia Empty inverted glass is not immersed in water, why? how to automatically include your header, navigation, and footer on every page [Select the word that belongs in the blank space.] "_______ practice" is when you apply special extra attention in practicing the material that you find to be the most difficult. This is the type of practice that experts use to speed up their knowledge gain.Deliberate how many fifths are in 4 4/10