Answer:
D. Approach from the side
Explanation:
Cattle similar to horses' approach on the left side. As well when working stock sheep and goats usually work on the left side of the animals. You are always approaching from the side.
explain two situations on a pedigree that would allow you to determine the genotype of an individual with the dominant phenotype
1) If the individual with the dominant phenotype has a parent with the recessive phenotype, the genotype of the individual is heterozygous (Aa).
2) If the individual with the dominant phenotype has offspring with the recessive phenotype, the individual must be heterozygous (Aa).
The two situations on a pedigree that would allow you to determine the genotype of an individual with the dominant phenotype.
Situation 1: Identify the individual with the dominant phenotype (let's call them Individual A).By analyzing the presence of the recessive phenotype in the parents or offspring of an individual with the dominant phenotype, we can determine their genotype as heterozygous (Aa).
For more such question on genotype
https://brainly.com/question/902712
#SPJ8
7. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA would
you see on the electrophoresis gel?
BamI (CCTAGG) --- 5' CCTAGG 3'; EcoRI (GAATTC) --- 5'G LAATTC 3'
5'ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 3
3’TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5
Based on their recognition sequences, two DNA bands will be produced by Bam1 and three DNA bands will be produced by EcoR1.
What are restriction sites?Restriction sites are sequences of nucleotides which are recognized by restriction enzymes and are acted upon by the restriction enzymes.
Restriction enzymes cuts DNA at recognition sites based on their recognition sequences.
Examples of restriction enzymes are Bam1 and EcoR1.
For Bam1, the recognition sequence is (CCTAGG) --- 5' CCTAGG 3'
Two bands will be produced using Bam1 as shown below:
5'ACGAATTCAGTATTATCCTAGG 3'
3'TGCTTAAGTCATAATAGGATCC 5'
5'TATCCGCCGCCGAATTCTCATCA 3'
3'ATAGGCGGCGGCTTAAGAGTAGT 5'
For EcoR1, the recognition sequence is (GAATTC) --- 5'GAATTC 3'
Three bands will be produced using with EcoR1 as shown below:
5'ACGAATTC 3'
3'TGCTTAAG 5'
5'AGTATTATCCTAGGTATCCGCCGCC 3'
3'TCATAATAGGATCCATAGGCGGCGG 5'
5'TCATCA 3'
3'AGTAGT 5'
Therefore, two DNA bands will be produced by B-am1 and three DNA bands will be produced by Eco-R1.
Learn more about restriction sites at: https://brainly.com/question/8886948
The trait for medium-sized leaves in iris is determined by the genetic condition PP'. Plants with large leaves are PP, whereas plants with small leaves are P'P'. The trait for red flowers is controlled by the genes RR, pink by RR', and white by R'R'. A cross is made between two plants each with medium-sized leaves and pink flowers. If they produce 640 seedlings, what would be the expected phenotypes, and in what numbers would they be expected
Answer:
See the answer below
Explanation:
Medium size leaves genotype = PP'
Large leaves genotype = PP
Small leaves genotype = P'P'
Red flower genotype = RR
Pink flower genotype = RR'
White flower genotype = R'R'
Two plants each with medium-sized leaves (PP') and pink flowers (RR') were crossed.
PP'RR' x PP'RR' (let PP' = Aa and RR' = Bb)
Progeny and expected phenotypes
1 PPRR - large leaves, red flower = 1/16 x 640 = 40 seedlings
2 PPRR' - large leaves, pink flower = 2/16 x 640 = 80 seedlings
2 PP'RR - medium leaves, red flower = 2/16 x 640 = 80 seedlings
4 PP'RR' - medium leaves, pink flower = 4/16 x 640 = 160 seedlings
1 PPR'R' - large leaves, white flower = 1/16 x 640 = 40 seedlings
2 PP'R'R' - medium leaves, white flower = 2/16 x 640 = 80 seedlings
1 P'P'RR - small leaves, red flower = 1/16 x 640 = 40 seedlings
2 P'P'RR' - small leaves, pink flower = 2/16 x 640 = 80 seedlings
1 P'P'R'R' = small leaves, white flower = 1/16 x 640 = 40 seedlings
Hi can someone whos good with biology please help me with this im struggling with it
Explanation:
For the Punnett square, for each genotype (Letters), you just find out how many of a certain combination in the boxes that there are .
(e.g, if there's one BBRR = 1/16, if there's 3 BbRrs = 3/16)
Do that for each Genotypic Ratio.
For the phenotypic ratio, you need to find out which genotype is dominant, and if the genotype combo will show up in a guinea pig physically.
For example, for the Black, Rough Phenotype, it would be the BBRR combo, since both are dominant and will be present in the guinea pig.
i hope this helped you !!!!!!!!!!!
A dihybrid cross is a breeding experiment that involves studying the inheritance patterns of two different traits simultaneously.
It examines the inheritance of two different genes located on different pairs of homologous chromosomes. This type of cross allows for the analysis of independent assortment and the determination of the phenotypic and genotypic ratios of offspring.
The genotypic and phenotypic ratios are:
Genotype ratio:
BBRR: 1/16
BBRr: 2/16
BBrr: 1/16
BbRR: 2/16
BbRr: 4/16
Bbrr: 2/16
bbRR: 1/16
bbRr: 2/16
bbrr: 1/16
Phenotype ratio:
Black, rough: 9/16
Black, smooth: 3/16
White, rough: 3/16
White, smooth: 1/16
Learn more about dihybrid cross, here:
https://brainly.com/question/12540319
#SPJ1
Which of the following is a consumer? *
1 point
Seed
Grass
Insect
Fruit
HELP ME PLESE NEED IT BY TODAY WILL GIVE U 10PIONTS HELPPPPPPPPPPPP
Insect is the answer.
.. .. ..
4. While camping, Travon could barely see what he was eating in the dark. When he got home, he gathered
supplies and attached a small flashlight to a fork with a rubber band, but it was very heavy. Travon
dec ded to try different combinations of forks and lights. When his brother Marcus asked him what he
was doing, Travon told him he was doing a scientific investigation. Marcus said that Travon had skipped
sters and needed to go back to form a hypothesis. Travon said he could do science any way he wanted.
Which boy is right?
A. Marcus is right. Science always follows the Scientific Method.
B. Travon is right. Science investigation can look different depending on the situation.
C. They are both right because Travon followed the Scientific Method.
D. They are both wrong because Travon is building something not doing science.
Marcus is right. Science always follows the Scientific method. Therefore, option A is correct.
What is the scientific method?Through testing and experimentation, the scientific method establishes facts in an unbiased manner. Making an observation, formulating a hypothesis, making a prediction, carrying out an experiment, and then evaluating the findings are the fundamental steps.
With the use of the scientific method, we can test a hypothesis and tell the difference between a phenomenon's observed effects being correlated with one another and having a real cause.
Marcus is right. Science always follows the Scientific method. Therefore, option A is correct.
Learn more about the scientific method, here:
https://brainly.com/question/7508826
#SPJ1
Explain the ruminant Process of digestion of animal farm animal?
DNA encodes the cell's genetic instructions for making proteins. The process of making proteins from DNA is divided into two stages called transcription and translation. Transcription is further divided into three steps called initiation, elongation, and termination. Classify the statements about transcription according to the step in which each occurs.
Initiation Elongation Termination
1. The RNA polymerase binds to the group of transcription factors at the promoter.
2. The DNA double helix unwinds, and RNA synthesis begins.
3. The RNA polymerase traverses the DNA template, adding complementary base pairs in the 5' to 3' directions.
4. The newly transcribed RNA transcript is proofread for errors.
5. The RNA polymerase stops adding base pairs when it reaches a certain DNA sequence that signals the end of the gene.
6. The RNA transcript is released.
7. The RNA polymerase detaches from the DNA.
Explanation:
Initiation:
1 The RNA polymerase binds to the group of transcription factors at the promoter.
Elongation:
2. The DNA double helix unwinds, and RNA synthesis begins.
3 The RNA polymerase traverses the DNA template, adding complementary base pairs in the 5' to 3' directions.
4The newly transcribed RNA transcript is proofread for errors.
Termination:
5. The RNA polymerase stops adding base pairs when it reaches a certain DNA sequence that signals the end of the gene.
The RNA transcript is released.
The RNA polymerase detaches from the DNA.
Transcription is the process of making an RNA copy of a gene sequence. This process is divided into three steps: initiation, elongation, and termination.
Initiation is the step where the RNA polymerase binds to the group of transcription factors at the promoter.
Elongation is the step where the RNA polymerase traverses the DNA template, adding complementary base pairs in the 5' to 3' directions.
Termination is the step where the RNA polymerase stops adding base pairs when it reaches a certain DNA sequence that signals the end of the gene, the RNA transcript is released, and the RNA polymerase detaches from the DNA.
Explain what traits you would give a pathogen if you wanted to make it hard for a vaccine to be used. List at least 4 things help please
Answer:
Here are four traits that would make it hard for a vaccine to be used:
1. Rapid mutation rate. If a pathogen mutates rapidly, it will be able to evade the immune system's defenses, including the antibodies produced by a vaccine. This is a particular problem with viruses, which can mutate very quickly.
2. Ability to evade the immune system. Some pathogens are able to evade the immune system by hiding inside cells or by changing their surface proteins so that they are no longer recognized by the immune system. This makes it difficult for the immune system to mount an effective response to the infection.
3. Ability to spread easily. If a pathogen is easily spread from person to person, it will be more difficult to prevent infection through vaccination. This is a particular problem with respiratory viruses, which can be spread through coughing and sneezing.
4. Lack of animal reservoirs. If a pathogen does not have animal reservoirs, it will be more difficult to develop a vaccine against it. This is because vaccines are typically developed using weakened or killed versions of the pathogen. If there are no animal reservoirs, there will be no source of the pathogen to use for vaccine development.
It is important to note that these are just a few of the traits that can make it difficult to develop a vaccine against a pathogen. There are many other factors that can contribute to the difficulty of vaccine development, such as the cost of vaccine development, the availability of funding, and the political will to support vaccine development.
Select the correct answer from each drop-down menu.
A candy company designs a package to hold chocolates. The height of the container is 13 inches and the diameter of its bottom is 9 inches.
9 in
13 in
Which shape best models the package, and what is the approximate surface area of the package?
The best model for the package is a
The approximate surface area is
square inches.
Reset
Next
The best model for the package is a cone.
The approximate surface area is 258. 10 square inches.
How to best model the package ?The package to hold chocolates that the candy company designs looks a lot like a cone which would make a cone the best model for this item.
This allows us to use the formula for the approximate surface area of a cone to find the surface area of this item. The formula is :
= π x radius ( radius + √ ( height ² + radius ²) )
= π x 4. 5 ( 4. 5 + √ ( 13 ² + 4 . 5²) )
= 258. 09966
= 258. 10 inches ²
Find out more on surface area at https://brainly.com/question/24517120
#SPJ1
What happens after activation of T cells
Answer:
Helper T cells are arguably the most important cells in adaptive immunity, as they are required for almost all adaptive immune responses. They not only help activate B cells to secrete antibodies and macrophages to destroy ingested microbes, but they also help activate cytotoxic T cells to kill infected target cells.
Explanation:
Helper T cells become activated when they are presented with peptide antigens by MHC class II molecules, which are expressed on the surface of antigen-presenting cells (APCs). Once activated, they divide rapidly and secrete cytokines that regulate or assist the immune response.
5. Josie set up an experiment to test the effect of light on tomato plants. The results of her experiment are shown below. What is the best conclusion she could make
from this experiment?
Tomato Tomato Tomato
Soil
Height 20.4 cm
Mass 0.7 g
Height: 19.4 cm
Mass: 2.1g
Height: 12.7 cm
Mass: 3.8g
422
Daily water 60 mL A Daily water 60 mL B
OA Tomato plants grow tallest in bright light
OB. Tomato plants grow heaviest in dim light
OC Tomato plants grown in bright light will be shorter but have more mass than tomato plants grown in dim light.
OD. No conclusion can be drawn from this experiment because it was not a fair test
Daily water 60 mL C
The best conclusion that Josie could make from this experiment is as follows:
Tomato plants grown in bright light will be shorter but have more mass than tomato plants grown in dim light.Thus, the correct option is C.
What is an Experiment?An experiment may be defined as a complete procedure that must be carried out under controlled instances in order to reveal an unknown fact or law, to test or establish a hypothesis, or to illustrate valid evidence.
The complete experiment given above clearly demonstrates that the plant which grows in dim light attains a maximum height of 20.4 cm. as compared to bright or moderate light.
But the mass of the plant that grows in dim light is found to be lower than the bright light which is 2.1 g.
Therefore, the conclusion is that the plant grown in bright light will be shorter but have more mass than tomato plants grown in dim light. Thus, the correct option is C.
To learn more about Plant growth with respect to light, refer to the link:
https://brainly.com/question/2515369
#SPJ1
21. Some fish, some dogs and some children are swimming in a bay. There are 40 legs in total, twice as
many heads as tails and more dogs than fish.
How many fish are in the bay?
true/false. after tissue repair is completed, factor xii catalyzes the formation of a plasma enzyme called kallikrein, that, in turn, converts an inactive plasminogen into , a fibrin-dissolving enzyme that breaks up the clot.
After tissue repair is completed, factor xii catalyzes the formation of a plasma enzyme called kallikrein, that, in turn, converts an inactive plasminogen into plasma , a fibrin-dissolving enzyme that breaks up the clot is true.
Plasma kallikrein was set up to be a good activator ofpro-urokinase, the inactive zymogen form of urokinase. The complete activation ofpro-urokinase by tube kallikrein was attained in 2 h with an enzyme/ substrate weight rate of1/30. The rate of activation ofpro-urokinase by tube kallikrein was similar to that catalyzed by plasmin and trypsin. The rate of activation ofpro-urokinase by factor XIIa was roughly one- seventh of that by tube kallikrein. The activation of the zymogen was due to the fractionalization of a single internal peptide bond, performing in the conversion of a single chainpro-urokinase( Mr = ,000) into two- chain urokinase( Mr = ,000 and,000), and these two chains were linked by a disulfide bond( s). These results indicate an important part of tube kallikrein for the activation ofpro-urokinase in the factor XII-dependent natural pathway of fibrinolysis.
Learn more about plasma enzyme at
https://brainly.com/question/15233244
#SPJ4
A model of a hypothetical rabbit population can be seen. In this case there is plenty of food and the rabbit population thrives, reproduces, and grows. Over time though, the death rate increases and the population decreases. In this situation what is/are the limiting factor(s)?
a
predators
b
food and shelter
c
living space for shelter
d
mating partners
Based on the given information, the limiting factor(s) for the rabbit population could be (c) living space for shelter.
What is the effect of population growth?As the population grows, the available living space decreases, which can lead to increased competition for resources and increased stress, making the rabbits more susceptible to diseases and parasites. This can cause the death rate to increase and the population to decrease over time.
What is limiting factor of rabbit population?While (a) predators could also be a limiting factor for rabbit populations, the statement suggests that there is plenty of food and no mention of predators, which implies that they are not the main limiting factor in this case. (b) Food and shelter and (d) mating partners are also important factors, but they are less likely to be the primary limiting factors in this scenario as the statement indicates that there is plenty of food available for the rabbit population to thrive and reproduce.
To know more about limiting factor visit:-
brainly.com/question/6084377
#SPJ1
Plz help I’ll mark brainliest
Answer:
C. The study of the interaction between living and nonliving factors in an environment
Explanation:
Ecology is the study of both living and nonliving things in an environment, the only answer that relates to this in significance is C.
What 2 things are police officers taught to do at a crime scene?
Answer:
look for evidence
Explanation:
crime
Answer:
check for fingerprints and blood samples
Explanation: G'day mate!
P.S- brainlest plz, I olny need one more!
a nursing student is reviewing for an upcoming anatomy and physiology examination. which of the following would the student correctly identify as a function of the liver? select all that apply.
The important function of the liver is carbohydrate and glucose metabolism, protein metabolism, and ammonia conversion. So options A, B, D, and E apply.
As the primary regulator of the storage and delivery of glucose to peripheral tissues, and in particular, to glucose-dependent organs including the brain and erythrocytes, the liver serves as the center of carbohydrate and glucose metabolism.
Also, the deamination of amino acids, urea production to remove ammonia, plasma protein synthesis, and interconversions between amino acids are all processes that take place during protein metabolism in the liver.
Since zinc cannot be produced by the body, it must be taken from food. The majority of it is kept in the bone and muscle.
The complete question is -
A nursing student is reviewing for an upcoming anatomy and physiology examination. Which of the following would the student correctly identify as a function of the liver? Select all that apply.
A. Carbohydrate metabolism
B. Ammonia conversion
C. Zinc storage
D. Protein metabolism
E. Glucose metabolism
To know more about the liver:
https://brainly.com/question/29202439
#SPJ4
How many moles would there be in 100 g of glucose? In 500 g of glucose? SHOW WORK
Answer:
a) 0.56moles
b) 2.78moles
Explanation:
The number of moles can be calculated by using the formula;
Mole (n) = Mass (M) ÷ Molar mass (MM)
For a glucose molecule, with chemical formula: C6H12O6
Where atomic mass of C= 12, H=1, O= 16
Molar mass of C6H12O6= 12(6) + 1(12) + 16(6)
= 72 + 12 + 96
= 180g/mol
a) In 100g of glucose;
Mole = 100/180
Mole = 0.56moles
b) In 500g of glucose
Mole = 500/180
Mole = 2.78moles
Which of the following is NOT a prokaryote?A. E. ColiB. FungiC. BacteriaD. Archaea
The correct option is B. Fungi
Fungi is a group of eukaryotic organisms, they can be single celled or very complex multicellular organisms.
E. Coli is a bacteria so it´s prokaryote.
Archaea constitute a domain of single-celled organisms. These microorganisms lack cell nuclei and are therefore prokaryotes.
Why do silver and copper have similar properties?
State your claim. Make sure your claim fully explains how two different materials can have similar properties.
Summarize the evidence you have gathered to support your claim and explain your reasoning. Type your response below and click submit in Schoology.
Answer:
These metals, especially silver, have unusual properties that make them essential for industrial applications outside of their monetary or decorative value. They are all excellent conductors of electricity. The most conductive (by volume) of all metals are silver, copper and gold in that order. Silver is also the most thermally conductive element, and the most light reflecting element. Silver also has the unusual property that the tarnish that forms on silver is still highly electrically conductive.
Copper is used extensively in electrical wiring and circuitry. Gold contacts are sometimes found in precision equipment for their ability to remain corrosion-free. Silver is used widely in mission-critical applications as electrical contacts, and is also used in photography (because silver nitrate reverts to metal on exposure to light), agriculture, medicine, audiophile and scientific applications.
Gold, silver, and copper are quite soft metals and so are easily damaged in daily use as coins. Precious metal may also be easily abraded and worn away through use. In their numismatic functions these metals must be alloyed with other metals to afford coins greater durability. The alloying with other metals makes the resulting coins harder, less likely to become deformed and more resistant to wear.
Explanation:
What is karyotyping?
O A. A method of cutting strands of DNA at specific sites
B. A method of separating DNA fragments so they can be seen
C. A method of making one DNA sample into many copies
O D. A method of illustrating what chromosomes are present
Answer:
D. A method of illustrating what chromosomes are present
Explanation:
Karyotyping can illustrate the different types of chromosomes from an individual, it is often used to check if there are any chromosomal abnormalities. However, DNA cannot be seen through karyotyping because they are too small.
Answer:
D
Explanation:
why do geologist think earths core contains mostly iorn
I hope my answer helped you! If you need more information or help, comment down below and I will be sure to respond if I am online. Have a wonderful rest of your day!
The return of water vapor to a liquid form is called: condensation A. rain B. dew point C. evaporation D.
Answer:
condensation
Explanation:
What is the surface of the Earth called?
Crust
Mantel
Inner core
Outer core
Answer:
crust
Explanation:
what are the changes the parents end up with a child that doesn't look like either of them
Answer:
The changes that occurred that resulted in this outcome was most likely recessive genes surfacing that both parents had, but neither physically showed.
Explanation:
The question was quite unclear, but I tried my best. Hope this helps!
Anyone who has/is currently getting a degree in environmental science from an online university, which school is it and what has your experience been. Thank you!
Answer: I go to Pomona College and they are amazing at teaching so many things about the environment through science and in my opinion I think you should go. My experience so far is amazing and if you are curious and want to know something new this is where to go:)
Explanation:
Question 2 of 9
Corn seeds were germinated (grew and put out shoots after a period of dormancy) in a dark room
placed in the light, 75 of these seedlings turned green. Which conclusion about chlorophyll (the
plants can most reasonably be drawn from this information?
(1 point)
DA. Light is the only factor that controls the production of chlorophyll
.
B. Darkness is the only factor that prevents the production of chlorophyll.
IC Light and vitamins are necessary for chlorophyll production.
D. Light and some other factor are necessary for chlorophyll production.
----Page 2 of 9----
Answer:
The correct answer is option D. Light and some other factors are necessary for chlorophyll production
Explanation:
By this experiment, it is clear that light is the major factor that helps in the production of chlorophyll in seedlings or plants. In this study, placing the seeds in the light turns 75 seedlings green which is possible by the production of the green pigment, chlorophyll only. So, it is proved that light is a key factor in the production of chlorophyll.
Besides light, there must be some other factors (mineral nutrition and chemical metabolites) that also play role in the production of chlorophyll or increase or decrease of the chlorophyll production as few seedlings did not turn green in the study.
which of the following cellular structure is possessed by all cells?
a. nucleus
b. cell membrane
c. chloroplast
d. mitochondria
Answer:
A
Explanation:
the nucleus is needed for all living creatures cells it contains the dna info to create basically the whole plants being.
All cells that can either prokaryotic or eukaryotic possess a cell membrane. The correct option is b.
What is cell membrane?The cell membrane is a biological membrane that segregates the inside of all cells from their surroundings and helps to protect the cell.
It is present in all organisms including a prokaryotic and eukaryotic cell.
Thus, the correct option is b.
For more details regarding cell membrane, visit:
https://brainly.com/question/13524386
#SPJ2
Which type of mutation?
A. Insertion
B. Substitution
C. Deletion
D. Addition
It is a substitution mutation because one strain got substituted with another strain and there wasn't an increase/decrease in strain and none of the strains got shifted over.
Hope that helped!